Starting /dee2/code/volunteer_pipeline.sh SRR6958260 current disk space = 1550563487744 free memory = 1599940156 SRR6958260 SRAfilesize 47607b3902abdba05d9f844ec6f048b7 SRR6958260.sra SRR6958260.sra file validated SRR6958260 is paired end SRR6958260 is conventional basespace SRR6958260 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958260_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.98275 18.0 18.0 18.0 18.0 31.0 2 29.0255 29.0 27.0 31.0 27.0 33.0 3 30.39575 31.0 29.0 33.0 27.0 33.0 4 32.362 33.0 33.0 33.0 31.0 33.0 5 32.7715 33.0 33.0 33.0 31.0 34.0 6 36.71025 38.0 37.0 38.0 34.0 38.0 7 37.504 38.0 38.0 38.0 37.0 38.0 8 37.59525 38.0 38.0 38.0 38.0 38.0 9 37.693 38.0 38.0 38.0 38.0 38.0 10-14 37.713350000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.71345 38.0 38.0 38.0 38.0 38.0 20-24 37.6753 38.0 38.0 38.0 38.0 38.0 25-29 37.67885 38.0 38.0 38.0 38.0 38.0 30-34 37.65160000000001 38.0 38.0 38.0 37.8 38.0 35-39 37.606700000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.61985 38.0 38.0 38.0 38.0 38.0 45-49 37.63705 38.0 38.0 38.0 38.0 38.0 50-54 37.576150000000005 38.0 38.0 38.0 38.0 38.0 55-59 37.54885 38.0 38.0 38.0 38.0 38.0 60-64 37.540549999999996 38.0 38.0 38.0 38.0 38.0 65-69 37.39885 38.0 38.0 38.0 36.8 38.0 70-74 37.43895 38.0 38.0 38.0 37.0 38.0 75-79 37.3935 38.0 38.0 38.0 37.0 38.0 80-84 37.34785 38.0 38.0 38.0 37.0 38.0 85-89 37.0468 38.0 38.0 38.0 35.6 38.0 90-94 37.11409999999999 38.0 38.0 38.0 35.8 38.0 95-99 37.140499999999996 38.0 38.0 38.0 36.0 38.0 100-104 37.10765 38.0 38.0 38.0 35.8 38.0 105-109 36.9856 38.0 38.0 38.0 35.6 38.0 110-114 36.861900000000006 38.0 38.0 38.0 35.0 38.0 115-119 36.8645 38.0 38.0 38.0 35.0 38.0 120-124 36.681 38.0 38.0 38.0 34.6 38.0 125-129 36.527750000000005 38.0 38.0 38.0 34.2 38.0 130-134 36.5133 38.0 38.0 38.0 34.0 38.0 135-139 36.492200000000004 38.0 38.0 38.0 34.0 38.0 140-144 34.658100000000005 38.0 34.6 38.0 27.6 38.0 145-149 35.1833 38.0 35.2 38.0 30.8 38.0 150-151 32.167249999999996 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 0.0 21 2.0 22 1.0 23 1.0 24 1.0 25 6.0 26 7.0 27 5.0 28 10.0 29 19.0 30 18.0 31 22.0 32 37.0 33 73.0 34 116.0 35 238.0 36 724.0 37 2716.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.636363636363637 9.662337662337663 34.25974025974026 40.44155844155844 2 25.374999999999996 12.375 33.375 28.875 3 21.9 14.875 24.9 38.324999999999996 4 26.85 22.675 22.375 28.1 5 25.45 28.95 22.975 22.625 6 20.825 32.175 24.525 22.475 7 17.125 23.974999999999998 40.725 18.175 8 20.125 23.65 30.175 26.05 9 19.275000000000002 22.25 33.025 25.45 10-14 22.84 27.034999999999997 26.369999999999997 23.755000000000003 15-19 22.215 25.624999999999996 26.88 25.28 20-24 22.485 25.95 27.01 24.555 25-29 22.400000000000002 26.290000000000003 26.555 24.755 30-34 22.759999999999998 25.679999999999996 26.540000000000003 25.019999999999996 35-39 22.82 25.95 26.435 24.795 40-44 22.27 26.090000000000003 26.950000000000003 24.69 45-49 22.384999999999998 26.43 26.58 24.605 50-54 23.105 25.814999999999998 25.945 25.135 55-59 22.39 25.695 26.465 25.45 60-64 22.755 25.324999999999996 26.755000000000003 25.165 65-69 22.48 26.115 26.584999999999997 24.82 70-74 22.225 26.009999999999998 26.295 25.47 75-79 22.96 25.435000000000002 26.595000000000002 25.009999999999998 80-84 22.770000000000003 26.009999999999998 27.32 23.9 85-89 22.57 25.215 27.04 25.174999999999997 90-94 22.73 25.779999999999998 26.415 25.074999999999996 95-99 22.905 25.765 26.395000000000003 24.935 100-104 22.152183701035568 26.309470208614737 26.449547250988044 25.088798839361647 105-109 23.165 25.674999999999997 26.58 24.58 110-114 22.70408163265306 25.49019607843137 26.770708283313326 25.035014005602243 115-119 22.84142071035518 25.63781890945473 25.892946473236616 25.627813906953477 120-124 23.145 26.290000000000003 25.979999999999997 24.585 125-129 23.421935225509337 25.789658106822845 26.390348901236422 24.398057766431396 130-134 22.965 25.735000000000003 25.905 25.395 135-139 22.965 25.595000000000002 26.419999999999998 25.019999999999996 140-144 22.98 26.325 25.91 24.785 145-149 22.715 26.064999999999998 25.990000000000002 25.230000000000004 150-151 22.2125 26.950000000000003 26.0 24.837500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 2.0 27 2.5 28 3.5 29 10.0 30 15.0 31 15.5 32 19.5 33 29.0 34 38.0 35 45.5 36 59.0 37 82.0 38 99.0 39 109.5 40 126.5 41 170.5 42 212.5 43 227.5 44 215.0 45 210.0 46 242.0 47 229.0 48 192.5 49 183.5 50 162.5 51 151.5 52 133.5 53 104.5 54 84.5 55 79.5 56 80.0 57 68.5 58 65.5 59 58.0 60 52.0 61 49.5 62 50.5 63 44.5 64 41.5 65 42.5 66 39.0 67 30.5 68 24.5 69 23.5 70 18.5 71 15.5 72 11.0 73 7.0 74 7.0 75 6.5 76 4.0 77 2.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.0 110-114 0.04 115-119 0.05 120-124 0.0 125-129 0.11499999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6625000000000001 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9750000000000001 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.3625 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.5999999999999996 0.0 0.0 0.0 0.0 122-123 2.9749999999999996 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.75 0.0 0.0 0.0 0.0 128-129 4.225 0.0 0.0 0.0 0.0 130-131 4.7375 0.0 0.0 0.0 0.0 132-133 5.3 0.0 0.0 0.0 0.0 134-135 5.675 0.0 0.0 0.0 0.0 136-137 6.2125 0.0 0.0 0.0 0.0 138-139 6.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTATTG 10 0.006832588 144.9875 3 GATTATT 10 0.006832588 144.9875 2 >>END_MODULE SRR6958260 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958260_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.048 33.0 27.0 33.0 18.0 34.0 2 31.7705 33.0 32.0 34.0 27.0 34.0 3 32.50525 33.0 32.0 34.0 31.0 34.0 4 32.95425 33.0 33.0 34.0 32.0 34.0 5 33.14975 33.0 33.0 34.0 33.0 34.0 6 37.48325 38.0 38.0 38.0 38.0 38.0 7 37.52375 38.0 38.0 38.0 38.0 38.0 8 37.5455 38.0 38.0 38.0 38.0 38.0 9 37.606 38.0 38.0 38.0 38.0 38.0 10-14 37.5756 38.0 38.0 38.0 38.0 38.0 15-19 36.6363 38.0 37.2 38.0 32.6 38.0 20-24 36.51985 38.0 37.2 38.0 32.2 38.0 25-29 37.4784 38.0 38.0 38.0 37.8 38.0 30-34 37.5713 38.0 38.0 38.0 38.0 38.0 35-39 37.542100000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.472350000000006 38.0 38.0 38.0 37.8 38.0 45-49 37.056200000000004 38.0 38.0 38.0 35.6 38.0 50-54 37.51525 38.0 38.0 38.0 38.0 38.0 55-59 37.553650000000005 38.0 38.0 38.0 38.0 38.0 60-64 37.50410000000001 38.0 38.0 38.0 38.0 38.0 65-69 37.507 38.0 38.0 38.0 38.0 38.0 70-74 37.41824999999999 38.0 38.0 38.0 38.0 38.0 75-79 37.4062 38.0 38.0 38.0 38.0 38.0 80-84 37.3593 38.0 38.0 38.0 37.8 38.0 85-89 37.330499999999994 38.0 38.0 38.0 37.6 38.0 90-94 37.34105 38.0 38.0 38.0 37.6 38.0 95-99 37.303549999999994 38.0 38.0 38.0 37.6 38.0 100-104 37.18874999999999 38.0 38.0 38.0 37.0 38.0 105-109 37.0752 38.0 38.0 38.0 36.4 38.0 110-114 36.8486 38.0 38.0 38.0 35.4 38.0 115-119 37.044450000000005 38.0 38.0 38.0 36.0 38.0 120-124 36.878699999999995 38.0 38.0 38.0 35.6 38.0 125-129 35.6959 38.0 36.4 38.0 29.6 38.0 130-134 35.85585 38.0 37.0 38.0 31.2 38.0 135-139 35.7265 38.0 37.2 38.0 30.2 38.0 140-144 35.58395 38.0 36.6 38.0 31.4 38.0 145-149 33.763549999999995 38.0 33.4 38.0 25.4 38.0 150-151 30.15025 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 2.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 3.0 15 1.0 16 0.0 17 2.0 18 1.0 19 2.0 20 2.0 21 2.0 22 2.0 23 7.0 24 5.0 25 5.0 26 8.0 27 6.0 28 11.0 29 17.0 30 19.0 31 27.0 32 46.0 33 67.0 34 115.0 35 218.0 36 629.0 37 2795.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.025 20.325 12.675 30.975 2 28.775000000000002 23.799999999999997 29.325000000000003 18.099999999999998 3 23.200000000000003 25.424999999999997 27.750000000000004 23.625 4 24.8 30.45 22.0 22.75 5 27.3 33.475 20.525 18.7 6 22.875 38.2 20.5 18.425 7 22.25 19.650000000000002 36.125 21.975 8 22.425 24.325 26.575 26.674999999999997 9 22.875 23.075000000000003 30.3 23.75 10-14 25.319999999999997 26.810000000000002 24.425 23.445 15-19 24.855 26.51 25.25 23.385 20-24 25.095 27.04 25.105 22.759999999999998 25-29 25.03 26.384999999999998 24.925 23.66 30-34 25.105 26.36 25.515 23.02 35-39 25.285000000000004 26.6 25.019999999999996 23.095 40-44 25.35 26.38 25.085 23.185 45-49 25.369999999999997 26.314999999999998 25.14 23.175 50-54 24.955 27.145000000000003 25.385 22.515 55-59 25.2 26.279999999999998 24.959999999999997 23.56 60-64 25.155 26.21 25.585 23.05 65-69 24.915000000000003 26.884999999999998 25.22 22.98 70-74 25.05 26.255 25.66 23.035 75-79 24.585 26.465 25.75 23.200000000000003 80-84 24.755 26.985 25.39 22.869999999999997 85-89 25.629999999999995 27.1 24.925 22.345000000000002 90-94 25.19 26.355 25.235000000000003 23.22 95-99 25.1 26.66 25.330000000000002 22.91 100-104 25.419999999999998 26.805 25.03 22.745 105-109 24.81496299259852 26.305261052210444 25.800160032006403 23.079615923184637 110-114 25.669999999999998 26.424999999999997 25.435000000000002 22.470000000000002 115-119 25.445 27.224999999999998 24.735 22.595000000000002 120-124 25.405 26.655 25.095 22.845 125-129 25.345000000000002 26.97 25.185000000000002 22.5 130-134 26.46 26.25 25.445 21.845 135-139 26.13 27.384999999999998 24.815 21.67 140-144 25.69 27.1 25.119999999999997 22.09 145-149 26.474999999999998 27.465 24.72 21.34 150-151 25.55 27.737499999999997 24.85 21.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 2.0 26 3.0 27 3.5 28 5.5 29 10.5 30 15.0 31 13.5 32 14.0 33 21.5 34 26.5 35 35.0 36 46.5 37 63.0 38 88.5 39 125.5 40 163.5 41 183.5 42 194.5 43 199.0 44 207.5 45 215.5 46 208.5 47 205.5 48 196.5 49 184.0 50 160.5 51 133.5 52 118.0 53 116.5 54 111.0 55 85.5 56 72.5 57 71.5 58 80.0 59 76.5 60 63.0 61 57.5 62 49.5 63 44.0 64 42.0 65 47.5 66 46.5 67 36.5 68 34.0 69 26.5 70 20.5 71 21.0 72 15.5 73 10.5 74 10.5 75 7.5 76 4.0 77 1.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44584382871537 98.7 2 0.3778337531486146 0.75 3 0.15113350125944583 0.44999999999999996 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.3625 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0125 0.0 0.0 118-119 2.2750000000000004 0.0 0.025 0.0 0.0 120-121 2.55 0.0 0.025 0.0 0.0 122-123 2.9000000000000004 0.0 0.025 0.0 0.0 124-125 3.2750000000000004 0.0 0.025 0.0 0.0 126-127 3.625 0.0 0.025 0.0 0.0 128-129 4.0875 0.0 0.025 0.0 0.0 130-131 4.5875 0.0 0.025 0.0 0.0 132-133 5.125 0.0 0.025 0.0 0.0 134-135 5.5 0.0 0.025 0.0 0.0 136-137 5.975 0.0 0.025 0.0 0.0 138-139 6.3375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753098 spots for SRR6958260.sra Written 753098 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra Read 753089 spots for SRR6958260.sra Written 753089 spots for SRR6958260.sra SRR ids: ['SRR6958260.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8v0a4oao SRR6958260.sra spots: 15061789 blocks: [[1, 753089], [753090, 1506178], [1506179, 2259267], [2259268, 3012356], [3012357, 3765445], [3765446, 4518534], [4518535, 5271623], [5271624, 6024712], [6024713, 6777801], [6777802, 7530890], [7530891, 8283979], [8283980, 9037068], [9037069, 9790157], [9790158, 10543246], [10543247, 11296335], [11296336, 12049424], [12049425, 12802513], [12802514, 13555602], [13555603, 14308691], [14308692, 15061789]] SRR6958260 file size 5082245 SRR6958260 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958260 SRR6958260_1.fastq SRR6958260_2.fastq Input file: SRR6958260_1.fastq Paired file: SRR6958260_2.fastq trimmed: SRR6958260-trimmed-pair1.fastq, SRR6958260-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 17:55:08 2024 >> started Fri Dec 6 17:55:24 2024 >> done (16.079s) 15061789 read pairs processed; of these: 6558 ( 0.04%) short read pairs filtered out after trimming by size control 8648 ( 0.06%) empty read pairs filtered out after trimming by size control 15046583 (99.90%) read pairs available; of these: 5308009 (35.28%) trimmed read pairs available after processing 9738574 (64.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 10 0.00% 21 6 0.00% 22 5 0.00% 23 2 0.00% 24 18 0.00% 25 8 0.00% 26 7 0.00% 27 10 0.00% 28 10 0.00% 29 7 0.00% 30 6 0.00% 31 5 0.00% 32 12 0.00% 33 10 0.00% 34 11 0.00% 35 9 0.00% 36 14 0.00% 37 11 0.00% 38 20 0.00% 39 21 0.00% 40 31 0.00% 41 15 0.00% 42 23 0.00% 43 29 0.00% 44 18 0.00% 45 32 0.00% 46 22 0.00% 47 29 0.00% 48 41 0.00% 49 38 0.00% 50 40 0.00% 51 59 0.00% 52 58 0.00% 53 62 0.00% 54 71 0.00% 55 71 0.00% 56 70 0.00% 57 78 0.00% 58 120 0.00% 59 111 0.00% 60 144 0.00% 61 151 0.00% 62 160 0.00% 63 178 0.00% 64 218 0.00% 65 230 0.00% 66 225 0.00% 67 270 0.00% 68 298 0.00% 69 381 0.00% 70 350 0.00% 71 440 0.00% 72 561 0.00% 73 555 0.00% 74 664 0.00% 75 747 0.00% 76 1003 0.01% 77 1022 0.01% 78 991 0.01% 79 1088 0.01% 80 1393 0.01% 81 1436 0.01% 82 1737 0.01% 83 1890 0.01% 84 2540 0.02% 85 2821 0.02% 86 2850 0.02% 87 3104 0.02% 88 3489 0.02% 89 3727 0.02% 90 4015 0.03% 91 4436 0.03% 92 4894 0.03% 93 5219 0.03% 94 5629 0.04% 95 6269 0.04% 96 6841 0.05% 97 7394 0.05% 98 7900 0.05% 99 8642 0.06% 100 11101 0.07% 101 12209 0.08% 102 10309 0.07% 103 11039 0.07% 104 11644 0.08% 105 12315 0.08% 106 12934 0.09% 107 14145 0.09% 108 14529 0.10% 109 15435 0.10% 110 16318 0.11% 111 17256 0.11% 112 18172 0.12% 113 19121 0.13% 114 20069 0.13% 115 21504 0.14% 116 22279 0.15% 117 23015 0.15% 118 24107 0.16% 119 24778 0.16% 120 25961 0.17% 121 27228 0.18% 122 28104 0.19% 123 29172 0.19% 124 30437 0.20% 125 32477 0.22% 126 33742 0.22% 127 34781 0.23% 128 35590 0.24% 129 36841 0.24% 130 38289 0.25% 131 38957 0.26% 132 40622 0.27% 133 42794 0.28% 134 44501 0.30% 135 46134 0.31% 136 48114 0.32% 137 50014 0.33% 138 51667 0.34% 139 54425 0.36% 140 57683 0.38% 141 60791 0.40% 142 65424 0.43% 143 70230 0.47% 144 78027 0.52% 145 90614 0.60% 146 109621 0.73% 147 136099 0.90% 148 217300 1.44% 149 428811 2.85% 150 2794146 18.57% 151 9738574 64.72% 15046583 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=4.24 fanout-score-rank=15 prefix-density=0.59 prefix-fanout=3.2 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=81.30 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.32 fanout-score-rank=20 prefix-density=0.36 prefix-fanout=3.3 sequence=CTTCGACAACACCATGGGAGGCTTTTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGCGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=221.41 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=10.7 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958260 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 17:57:02 Started mapping on | Dec 06 17:57:59 Finished on | Dec 06 17:59:18 Mapping speed, Million of reads per hour | 685.67 Number of input reads | 15046583 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14771888 Uniquely mapped reads % | 98.17% Average mapped length | 295.71 Number of splices: Total | 16700285 Number of splices: Annotated (sjdb) | 15627492 Number of splices: GT/AG | 16474686 Number of splices: GC/AG | 194130 Number of splices: AT/AC | 7404 Number of splices: Non-canonical | 24065 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 151179 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 6329 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 128204 128204 128204 N_multimapping 151179 151179 151179 N_noFeature 653929 14356174 790565 N_ambiguous 337505 2057 58660 UnstrandedReadsAssigned:13780454 PositiveStrandReadsAssigned:413657 NegativeStrandReadsAssigned:13922663 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958260 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958260-trimmed-pair1.fastq SRR6958260-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,046,583 reads, 13,953,555 reads pseudoaligned [quant] estimated average fragment length: 242.744 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR6958260.ke.tsv 35125 SRR6958260.se.tsv 88098 total ==> SRR6958260.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.748 0 0 PNS24247 1044 802.256 47.6737 6.53813 PNS24249 1928 1686.26 49.1877 3.20937 PNS24246 1044 802.256 47.6737 6.53813 PNS24248 1044 802.256 47.6737 6.53813 PNS24244 1471 1229.26 40.7912 3.651 PNS24243 293 92.261 0 0 KQK14069 1603 1361.26 3148.4 254.47 KQK14071 474 241.215 89.9252 41.017 ==> SRR6958260.se.tsv <== BRADI_1g14170v3 3840 BRADI_1g53295v3 118 BRADI_1g59795v3 706 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 150 BRADI_1g74790v3 36 BRADI_1g09890v3 0 BRADI_1g77505v3 255 BRADI_1g48960v3 0 SRR6958260 completed mapping pipeline successfully