Starting /dee2/code/volunteer_pipeline.sh SRR6958262 current disk space = 1550019432448 free memory = 1595888564 SRR6958262 SRAfilesize 3362b990c2c2484dfb0efc0291ad94ce SRR6958262.sra SRR6958262.sra file validated SRR6958262 is paired end SRR6958262 is conventional basespace SRR6958262 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958262_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.8935 32.0 18.0 32.0 18.0 33.0 2 22.53575 18.0 18.0 27.0 18.0 33.0 3 28.34875 27.0 27.0 30.0 27.0 33.0 4 27.438 29.0 27.0 31.0 15.0 33.0 5 31.8395 32.0 32.0 33.0 31.0 33.0 6 34.17875 36.0 33.0 38.0 29.0 38.0 7 36.8115 38.0 37.0 38.0 35.0 38.0 8 36.85125 38.0 37.0 38.0 34.0 38.0 9 37.3125 38.0 38.0 38.0 36.0 38.0 10-14 37.47125 38.0 38.0 38.0 37.0 38.0 15-19 37.517649999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.48780000000001 38.0 38.0 38.0 37.4 38.0 25-29 37.4698 38.0 38.0 38.0 37.2 38.0 30-34 37.452600000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.409299999999995 38.0 38.0 38.0 37.2 38.0 40-44 37.44355 38.0 38.0 38.0 37.0 38.0 45-49 37.3992 38.0 38.0 38.0 37.0 38.0 50-54 37.347899999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.04645 38.0 38.0 38.0 36.2 38.0 60-64 36.5557 38.0 38.0 38.0 35.6 38.0 65-69 37.1866 38.0 38.0 38.0 36.0 38.0 70-74 37.2158 38.0 38.0 38.0 36.0 38.0 75-79 37.10365 38.0 38.0 38.0 36.0 38.0 80-84 37.00875 38.0 38.0 38.0 36.0 38.0 85-89 36.93745 38.0 38.0 38.0 35.4 38.0 90-94 36.8502 38.0 38.0 38.0 35.0 38.0 95-99 36.7964 38.0 38.0 38.0 34.8 38.0 100-104 36.6006 38.0 38.0 38.0 34.0 38.0 105-109 36.39235000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.32745 38.0 37.8 38.0 33.8 38.0 115-119 36.1942 38.0 37.4 38.0 33.6 38.0 120-124 35.919399999999996 38.0 36.8 38.0 32.2 38.0 125-129 35.69195 38.0 36.6 38.0 31.0 38.0 130-134 35.37335 38.0 36.0 38.0 31.0 38.0 135-139 34.7732 38.0 35.6 38.0 28.0 38.0 140-144 34.08345 38.0 34.0 38.0 24.4 38.0 145-149 33.7325 38.0 33.4 38.0 24.2 38.0 150-151 28.686875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 4.0 20 3.0 21 2.0 22 2.0 23 8.0 24 11.0 25 14.0 26 19.0 27 17.0 28 30.0 29 39.0 30 49.0 31 53.0 32 60.0 33 94.0 34 166.0 35 324.0 36 975.0 37 2126.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 56.2 9.3 7.825 26.674999999999997 2 29.299999999999997 11.575000000000001 34.625 24.5 3 21.95 18.15 26.05 33.85 4 24.625 22.825 24.675 27.875 5 26.224999999999998 28.975 24.05 20.75 6 23.799999999999997 32.300000000000004 23.400000000000002 20.5 7 18.725 23.674999999999997 38.025 19.575 8 21.525 23.1 27.250000000000004 28.125 9 18.375 22.900000000000002 31.974999999999998 26.75 10-14 23.342334233423344 26.162616261626166 25.67256725672567 24.822482248224823 15-19 22.650000000000002 25.624999999999996 26.16 25.564999999999998 20-24 22.45 25.555 26.555 25.44 25-29 23.275000000000002 25.95 25.695 25.080000000000002 30-34 23.115 25.55 26.27 25.064999999999998 35-39 22.61 25.380000000000003 26.21 25.8 40-44 22.97 24.834999999999997 26.08 26.115 45-49 22.745 25.480000000000004 26.064999999999998 25.71 50-54 23.47 25.430000000000003 25.75 25.35 55-59 23.096267981088424 25.329443717935824 25.953123428226537 25.62116487274922 60-64 23.03587762984043 25.03303181217603 25.60219534505539 26.328895212928145 65-69 23.400000000000002 24.895 25.69 26.015 70-74 23.544999999999998 25.0 25.840000000000003 25.615 75-79 23.294999999999998 24.535 25.935000000000002 26.235000000000003 80-84 23.645 24.82 25.46 26.075 85-89 23.599999999999998 24.89 25.540000000000003 25.97 90-94 23.74 24.82 25.900000000000002 25.540000000000003 95-99 23.345 25.009999999999998 25.6 26.045 100-104 23.565 25.215 25.169999999999998 26.05 105-109 23.605 24.955 25.635 25.805 110-114 23.56 24.779999999999998 26.090000000000003 25.569999999999997 115-119 23.51 24.44 25.669999999999998 26.38 120-124 23.555 25.115 25.345000000000002 25.985000000000003 125-129 23.57 24.75 25.705 25.974999999999998 130-134 24.09 25.185000000000002 25.41 25.314999999999998 135-139 23.875 25.21 25.369999999999997 25.545 140-144 23.365 25.119999999999997 25.44 26.075 145-149 23.755000000000003 24.855 25.0 26.39 150-151 23.25 25.2625 24.725 26.7625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 1.0 29 2.0 30 4.0 31 9.0 32 12.0 33 18.0 34 27.0 35 37.0 36 54.0 37 69.5 38 79.0 39 101.0 40 132.0 41 148.0 42 161.5 43 180.0 44 197.5 45 211.5 46 211.5 47 211.5 48 204.5 49 194.0 50 177.0 51 149.0 52 139.0 53 130.0 54 107.5 55 95.0 56 93.0 57 83.0 58 70.0 59 66.5 60 68.5 61 74.0 62 68.5 63 52.5 64 43.0 65 44.5 66 52.5 67 42.5 68 33.5 69 37.0 70 26.0 71 13.5 72 17.0 73 16.0 74 10.0 75 9.0 76 7.5 77 3.5 78 1.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.59 60-64 1.6099999999999999 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.2625000000000002 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.7875 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.5 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 3.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958262 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958262_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8635 33.0 33.0 34.0 32.0 34.0 2 32.9225 33.0 33.0 34.0 32.0 34.0 3 32.9845 34.0 33.0 34.0 32.0 34.0 4 32.923 34.0 33.0 34.0 32.0 34.0 5 32.92275 34.0 33.0 34.0 32.0 34.0 6 37.08975 38.0 38.0 38.0 37.0 38.0 7 37.03575 38.0 38.0 38.0 37.0 38.0 8 37.05925 38.0 38.0 38.0 37.0 38.0 9 37.11425 38.0 38.0 38.0 37.0 38.0 10-14 37.07 38.0 38.0 38.0 37.0 38.0 15-19 36.99995 38.0 38.0 38.0 37.0 38.0 20-24 36.969950000000004 38.0 38.0 38.0 36.6 38.0 25-29 36.965050000000005 38.0 38.0 38.0 36.8 38.0 30-34 36.95555 38.0 38.0 38.0 37.0 38.0 35-39 36.924249999999994 38.0 38.0 38.0 36.4 38.0 40-44 36.8704 38.0 38.0 38.0 36.0 38.0 45-49 36.908049999999996 38.0 38.0 38.0 36.2 38.0 50-54 36.83185 38.0 38.0 38.0 36.0 38.0 55-59 36.7822 38.0 38.0 38.0 36.0 38.0 60-64 36.736450000000005 38.0 38.0 38.0 35.8 38.0 65-69 36.7159 38.0 38.0 38.0 35.8 38.0 70-74 36.61045 38.0 38.0 38.0 35.2 38.0 75-79 36.655499999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.6031 38.0 38.0 38.0 35.2 38.0 85-89 36.4847 38.0 38.0 38.0 34.8 38.0 90-94 36.39565 38.0 38.0 38.0 34.6 38.0 95-99 36.295500000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.169650000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.06205 38.0 38.0 38.0 33.6 38.0 110-114 35.769999999999996 38.0 37.4 38.0 32.8 38.0 115-119 35.6063 38.0 37.0 38.0 32.0 38.0 120-124 35.7176 38.0 37.2 38.0 33.0 38.0 125-129 35.6146 38.0 37.0 38.0 32.0 38.0 130-134 35.4781 38.0 36.0 38.0 31.8 38.0 135-139 35.1205 38.0 36.0 38.0 30.2 38.0 140-144 34.707 38.0 35.6 38.0 29.0 38.0 145-149 34.0021 38.0 34.0 38.0 25.8 38.0 150-151 30.005875000000003 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 9.0 4 3.0 5 2.0 6 0.0 7 1.0 8 2.0 9 1.0 10 4.0 11 3.0 12 1.0 13 2.0 14 4.0 15 1.0 16 2.0 17 1.0 18 4.0 19 6.0 20 5.0 21 2.0 22 4.0 23 12.0 24 12.0 25 15.0 26 15.0 27 23.0 28 16.0 29 25.0 30 36.0 31 41.0 32 64.0 33 93.0 34 125.0 35 222.0 36 532.0 37 2694.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.775 19.3 10.575 25.35 2 28.499999999999996 23.575 26.125 21.8 3 23.905976494123532 26.106526631657918 28.382095523880967 21.605401350337583 4 25.724999999999998 31.924999999999997 20.549999999999997 21.8 5 26.900000000000002 33.45 18.95 20.7 6 23.947895791583164 34.86973947895792 20.165330661322646 21.017034068136272 7 22.005012531328322 20.676691729323306 34.91228070175438 22.406015037593985 8 23.42184368737475 23.171342685370742 22.720440881763526 30.68637274549098 9 23.34669338677355 21.718436873747496 27.404809619238478 27.530060120240478 10-14 25.97714972940469 25.65644417718982 23.155943074764483 25.21046301864101 15-19 25.380914194065756 25.771852445870085 24.4887730553328 24.358460304731356 20-24 25.94838386369331 25.808068153345026 23.88373841142571 24.359809571535955 25-29 26.19787489975942 25.335805934242185 24.022654370489175 24.443664795509225 30-34 25.53372757341886 25.172897664628646 24.295880525207977 24.997494236744515 35-39 25.408439410644483 25.984764959406636 24.64167585446527 23.96511977548361 40-44 25.754083575508567 25.53362060326686 23.764906303236796 24.947389517987776 45-49 25.487248860163337 26.183676536900645 23.949095646074454 24.379978956861567 50-54 25.65772989225758 26.04860937108494 23.94888499123027 24.34477574542721 55-59 25.978255423618418 24.35993787263891 25.066386091487548 24.595420612255122 60-64 26.01854171886745 25.00626409421198 24.515159107992986 24.460035078927586 65-69 26.148604639510996 25.136529886266846 24.25973245152563 24.45513302269653 70-74 26.218748434290294 25.462197504885015 24.515256275364496 23.803797785460194 75-79 25.850408296177545 25.955613446220127 24.247282200290567 23.946696057311758 80-84 26.139893776931554 25.79416775227979 24.321074255937468 23.744864214851187 85-89 25.978255423618418 25.427125607495366 24.530287088531487 24.06433188035473 90-94 26.01112614644414 25.35458327068611 24.683005061895454 23.951285520974288 95-99 26.189163450453613 25.672898601573856 24.099042654503535 24.038895293468997 100-104 26.504937095884916 25.728033682522177 24.394767179589998 23.372262042002905 105-109 26.15407748985013 25.527542479073727 24.339632098641673 23.978747932434462 110-114 26.705428299333366 25.85835296476367 24.264447897348504 23.17177083855446 115-119 26.92558256076171 25.627662240040088 24.324730643948886 23.12202455524931 120-124 26.3756640272627 25.899569008720057 24.54645685075674 23.1783101132605 125-129 26.02094503181841 26.34163451420554 24.1769805080924 23.46043994588365 130-134 26.55341751854079 25.586289837642813 24.714371617558626 23.145921026257767 135-139 26.41679611164003 25.920729568572433 24.287217517662977 23.375256802124568 140-144 27.196191430719118 25.47231270358306 24.20947131044851 23.12202455524931 145-149 26.929244337542595 26.112447384245343 24.208258167969532 22.750050110242533 150-151 26.919704371790054 26.3434798947764 23.6126769384943 23.124138794939245 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.0 3 3.0 4 3.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 2.0 28 1.0 29 1.5 30 2.5 31 8.0 32 10.5 33 7.5 34 14.5 35 25.5 36 36.5 37 45.5 38 65.0 39 93.0 40 104.0 41 136.5 42 172.5 43 178.0 44 183.0 45 208.5 46 219.0 47 208.0 48 198.0 49 185.0 50 165.5 51 138.5 52 122.5 53 119.0 54 112.0 55 95.0 56 94.0 57 103.0 58 92.5 59 84.0 60 84.5 61 75.5 62 66.0 63 65.5 64 68.5 65 63.0 66 61.0 67 54.5 68 41.5 69 35.0 70 31.5 71 23.0 72 19.5 73 18.5 74 14.5 75 11.5 76 9.0 77 7.5 78 3.5 79 1.0 80 0.0 81 0.0 82 1.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.2 7 0.25 8 0.2 9 0.2 10-14 0.22 15-19 0.24 20-24 0.22499999999999998 25-29 0.24 30-34 0.22999999999999998 35-39 0.22999999999999998 40-44 0.21 45-49 0.20500000000000002 50-54 0.22499999999999998 55-59 0.20500000000000002 60-64 0.22499999999999998 65-69 0.20500000000000002 70-74 0.20500000000000002 75-79 0.19499999999999998 80-84 0.21 85-89 0.20500000000000002 90-94 0.23500000000000001 95-99 0.245 100-104 0.245 105-109 0.245 110-114 0.245 115-119 0.22499999999999998 120-124 0.22999999999999998 125-129 0.215 130-134 0.22 135-139 0.215 140-144 0.22499999999999998 145-149 0.22 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52189229994968 98.875 2 0.35228988424760943 0.7000000000000001 3 0.0754906894816306 0.22499999999999998 4 0.050327126321087066 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.8374999999999999 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.2374999999999998 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.7625000000000002 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.5125 0.0 0.0 0.0 0.0 136-137 2.9124999999999996 0.0 0.0 0.0 0.0 138-139 3.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATAG 10 0.006830828 145.0 3 TGATAGA 10 0.006830828 145.0 4 >>END_MODULE Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra Read 1278278 spots for SRR6958262.sra Written 1278278 spots for SRR6958262.sra Read 1278276 spots for SRR6958262.sra Written 1278276 spots for SRR6958262.sra SRR ids: ['SRR6958262.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wy_2y2kf SRR6958262.sra spots: 25565522 blocks: [[1, 1278276], [1278277, 2556552], [2556553, 3834828], [3834829, 5113104], [5113105, 6391380], [6391381, 7669656], [7669657, 8947932], [8947933, 10226208], [10226209, 11504484], [11504485, 12782760], [12782761, 14061036], [14061037, 15339312], [15339313, 16617588], [16617589, 17895864], [17895865, 19174140], [19174141, 20452416], [20452417, 21730692], [21730693, 23008968], [23008969, 24287244], [24287245, 25565522]] SRR6958262 file size 8641616 SRR6958262 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958262 SRR6958262_1.fastq SRR6958262_2.fastq Input file: SRR6958262_1.fastq Paired file: SRR6958262_2.fastq trimmed: SRR6958262-trimmed-pair1.fastq, SRR6958262-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:03:33 2024 >> started Fri Dec 6 18:04:00 2024 >> done (26.772s) 25565522 read pairs processed; of these: 49235 ( 0.19%) short read pairs filtered out after trimming by size control 45937 ( 0.18%) empty read pairs filtered out after trimming by size control 25470350 (99.63%) read pairs available; of these: 9759160 (38.32%) trimmed read pairs available after processing 15711190 (61.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 5 0.00% 21 5 0.00% 22 12 0.00% 23 9 0.00% 24 11 0.00% 25 4 0.00% 26 6 0.00% 27 5 0.00% 28 4 0.00% 29 10 0.00% 30 15 0.00% 31 12 0.00% 32 10 0.00% 33 8 0.00% 34 7 0.00% 35 22 0.00% 36 13 0.00% 37 12 0.00% 38 9 0.00% 39 12 0.00% 40 11 0.00% 41 13 0.00% 42 19 0.00% 43 24 0.00% 44 14 0.00% 45 25 0.00% 46 28 0.00% 47 33 0.00% 48 36 0.00% 49 33 0.00% 50 31 0.00% 51 41 0.00% 52 44 0.00% 53 53 0.00% 54 63 0.00% 55 61 0.00% 56 63 0.00% 57 81 0.00% 58 60 0.00% 59 92 0.00% 60 127 0.00% 61 130 0.00% 62 136 0.00% 63 125 0.00% 64 146 0.00% 65 168 0.00% 66 193 0.00% 67 218 0.00% 68 249 0.00% 69 292 0.00% 70 319 0.00% 71 358 0.00% 72 425 0.00% 73 460 0.00% 74 494 0.00% 75 564 0.00% 76 655 0.00% 77 749 0.00% 78 815 0.00% 79 986 0.00% 80 1082 0.00% 81 1271 0.00% 82 1488 0.01% 83 1708 0.01% 84 3210 0.01% 85 4139 0.02% 86 4161 0.02% 87 4638 0.02% 88 4713 0.02% 89 4814 0.02% 90 4947 0.02% 91 5371 0.02% 92 5552 0.02% 93 5671 0.02% 94 6107 0.02% 95 6453 0.03% 96 6882 0.03% 97 7149 0.03% 98 7480 0.03% 99 8136 0.03% 100 8583 0.03% 101 9280 0.04% 102 10123 0.04% 103 10616 0.04% 104 11502 0.05% 105 12204 0.05% 106 12837 0.05% 107 13438 0.05% 108 14119 0.06% 109 15120 0.06% 110 15706 0.06% 111 16745 0.07% 112 18070 0.07% 113 19338 0.08% 114 20716 0.08% 115 21843 0.09% 116 23185 0.09% 117 23991 0.09% 118 24934 0.10% 119 25863 0.10% 120 27008 0.11% 121 28491 0.11% 122 30531 0.12% 123 31584 0.12% 124 33841 0.13% 125 35528 0.14% 126 36640 0.14% 127 38331 0.15% 128 39838 0.16% 129 41234 0.16% 130 43315 0.17% 131 45407 0.18% 132 48585 0.19% 133 51377 0.20% 134 54350 0.21% 135 58409 0.23% 136 62104 0.24% 137 66112 0.26% 138 70159 0.28% 139 74324 0.29% 140 79742 0.31% 141 87195 0.34% 142 96077 0.38% 143 107619 0.42% 144 125026 0.49% 145 150438 0.59% 146 190743 0.75% 147 278066 1.09% 148 383504 1.51% 149 831053 3.26% 150 6080708 23.87% 151 15711190 61.68% 25470350 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=5.81 fanout-score-rank=14 prefix-density=0.63 prefix-fanout=3.9 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=14 fanout-score=35.75 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=9.0 sequence=GGCGGCGGCGGCCTCGAAGCCTGACTTGGTCGCCGGCGGCGCGACGCCCATGACGAGTGTCTGGGAAGAAGTCGCCTCCTCGGCCATCATCTCTGGGTACAT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.84 fanout-score-rank=12 prefix-density=0.34 prefix-fanout=3.9 sequence=AAGATGTACCCAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=145.76 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=21.0 sequence=CAAGAAGAAGGT SRR6958262 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:04:42 Started mapping on | Dec 06 18:04:42 Finished on | Dec 06 18:07:24 Mapping speed, Million of reads per hour | 566.01 Number of input reads | 25470350 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 24105563 Uniquely mapped reads % | 94.64% Average mapped length | 296.92 Number of splices: Total | 28655998 Number of splices: Annotated (sjdb) | 27023558 Number of splices: GT/AG | 28270258 Number of splices: GC/AG | 321012 Number of splices: AT/AC | 11382 Number of splices: Non-canonical | 53346 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280866 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 13074 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.86% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1108436 1108436 1108436 N_multimapping 280866 280866 280866 N_noFeature 764845 23486934 923781 N_ambiguous 542905 3494 84279 UnstrandedReadsAssigned:22797813 PositiveStrandReadsAssigned:615135 NegativeStrandReadsAssigned:23097503 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958262 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958262-trimmed-pair1.fastq SRR6958262-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,470,350 reads, 23,038,015 reads pseudoaligned [quant] estimated average fragment length: 275.156 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR6958262.ke.tsv 35125 SRR6958262.se.tsv 88098 total ==> SRR6958262.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 662.281 54.2725 5.21264 PNS24247 1044 769.844 61.235 5.05962 PNS24249 1928 1653.84 97.31 3.74269 PNS24246 1044 769.844 61.235 5.05962 PNS24248 1044 769.844 61.235 5.05962 PNS24244 1471 1196.84 53.7124 2.85468 PNS24243 293 81.664 0 0 KQK14069 1603 1328.84 1281.83 61.359 KQK14071 474 218.31 19.5003 5.68182 ==> SRR6958262.se.tsv <== BRADI_1g14170v3 1417 BRADI_1g53295v3 1517 BRADI_1g59795v3 91 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 957 BRADI_1g74790v3 532 BRADI_1g09890v3 1 BRADI_1g77505v3 253 BRADI_1g48960v3 0 SRR6958262 completed mapping pipeline successfully