Starting /dee2/code/volunteer_pipeline.sh SRR6958263 current disk space = 1550443659264 free memory = 1597193084 SRR6958263 SRAfilesize c3efc31e6d5eee60bc39b4e315eba1d5 SRR6958263.sra SRR6958263.sra file validated SRR6958263 is paired end SRR6958263 is conventional basespace SRR6958263 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958263_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.2825 18.0 18.0 28.0 2.0 32.0 2 27.3015 29.0 25.0 31.0 18.0 33.0 3 29.854 31.0 28.0 33.0 27.0 33.0 4 31.60925 33.0 32.0 33.0 28.0 33.0 5 32.56675 33.0 33.0 33.0 32.0 34.0 6 36.719 38.0 37.0 38.0 34.0 38.0 7 37.12625 38.0 38.0 38.0 36.0 38.0 8 37.3325 38.0 38.0 38.0 36.0 38.0 9 37.3635 38.0 38.0 38.0 37.0 38.0 10-14 37.313199999999995 38.0 38.0 38.0 36.6 38.0 15-19 37.344649999999994 38.0 38.0 38.0 36.8 38.0 20-24 36.6214 38.0 37.4 38.0 34.0 38.0 25-29 36.8094 38.0 38.0 38.0 35.0 38.0 30-34 37.18925 38.0 38.0 38.0 36.4 38.0 35-39 37.40945 38.0 38.0 38.0 37.0 38.0 40-44 37.309 38.0 38.0 38.0 37.0 38.0 45-49 37.28105000000001 38.0 38.0 38.0 36.8 38.0 50-54 37.03515 38.0 38.0 38.0 35.8 38.0 55-59 36.96810000000001 38.0 38.0 38.0 35.6 38.0 60-64 37.16315 38.0 38.0 38.0 36.0 38.0 65-69 37.182 38.0 38.0 38.0 36.0 38.0 70-74 37.200199999999995 38.0 38.0 38.0 36.2 38.0 75-79 37.164249999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.04775 38.0 38.0 38.0 36.0 38.0 85-89 36.55555 38.0 38.0 38.0 34.4 38.0 90-94 35.890100000000004 38.0 37.2 38.0 31.4 38.0 95-99 35.221050000000005 38.0 36.2 38.0 27.4 38.0 100-104 34.947 38.0 35.8 38.0 26.0 38.0 105-109 35.0486 38.0 35.6 38.0 26.2 38.0 110-114 35.561800000000005 38.0 36.2 38.0 29.8 38.0 115-119 35.940200000000004 38.0 36.8 38.0 32.2 38.0 120-124 36.1337 38.0 37.0 38.0 33.4 38.0 125-129 36.05065 38.0 37.0 38.0 33.2 38.0 130-134 35.8943 38.0 36.4 38.0 32.8 38.0 135-139 35.601150000000004 38.0 36.0 38.0 31.4 38.0 140-144 34.5981 38.0 34.4 38.0 28.0 38.0 145-149 32.4528 37.6 30.8 38.0 19.6 38.0 150-151 28.90975 35.5 25.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 5.0 17 1.0 18 4.0 19 0.0 20 2.0 21 1.0 22 1.0 23 5.0 24 3.0 25 15.0 26 21.0 27 28.0 28 36.0 29 44.0 30 52.0 31 80.0 32 103.0 33 160.0 34 239.0 35 351.0 36 851.0 37 1997.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.61608932150015 12.0526767821357 8.932150014314342 42.399083882049815 2 23.5 13.600000000000001 32.275 30.625000000000004 3 22.15 18.475 22.45 36.925000000000004 4 25.275 24.85 23.325000000000003 26.55 5 25.174999999999997 28.575 24.125 22.125 6 20.925 32.925 23.95 22.2 7 15.675 24.625 41.349999999999994 18.35 8 19.525000000000002 23.474999999999998 30.3 26.700000000000003 9 20.25 22.375 33.324999999999996 24.05 10-14 21.695 27.529999999999998 26.215 24.560000000000002 15-19 22.42172651795539 25.64769430829249 26.85305591677503 25.07752325697709 20-24 22.28 26.06 26.790000000000003 24.87 25-29 22.365 26.224999999999998 26.450000000000003 24.959999999999997 30-34 22.735 25.924999999999997 25.955000000000002 25.385 35-39 22.205 26.150000000000002 26.545 25.1 40-44 22.21 26.76 25.924999999999997 25.105 45-49 22.28 26.540000000000003 25.729999999999997 25.45 50-54 22.225 26.405 25.995 25.374999999999996 55-59 22.235 26.36 26.43 24.975 60-64 22.215 26.290000000000003 26.605 24.89 65-69 22.205 26.015 26.75 25.03 70-74 22.225 26.229999999999997 26.540000000000003 25.005 75-79 22.0 25.619999999999997 26.834999999999997 25.545 80-84 22.535 25.545 26.3 25.619999999999997 85-89 22.515 25.874999999999996 26.279999999999998 25.330000000000002 90-94 22.955000000000002 25.869999999999997 26.13 25.045 95-99 22.93 26.155 25.96 24.955 100-104 22.71 25.009999999999998 27.02 25.259999999999998 105-109 22.425 26.195 26.179999999999996 25.2 110-114 22.57 26.185000000000002 26.06 25.185000000000002 115-119 22.564999999999998 26.06 26.305 25.069999999999997 120-124 22.735 26.295 25.735000000000003 25.235000000000003 125-129 22.38 26.064999999999998 26.525 25.03 130-134 23.28 25.424999999999997 25.840000000000003 25.455 135-139 22.925 25.650000000000002 26.314999999999998 25.11 140-144 22.82 25.765 26.61 24.805 145-149 23.419999999999998 25.34 25.95 25.290000000000003 150-151 22.35 26.05 26.337500000000002 25.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 1.5 27 2.5 28 1.5 29 3.5 30 8.5 31 11.5 32 18.5 33 22.0 34 32.0 35 39.5 36 61.0 37 84.5 38 83.5 39 115.0 40 163.5 41 183.5 42 187.5 43 219.0 44 223.0 45 197.0 46 207.0 47 221.5 48 211.5 49 201.5 50 188.5 51 152.5 52 135.5 53 126.0 54 103.0 55 84.0 56 69.0 57 67.5 58 70.5 59 64.0 60 55.5 61 49.5 62 46.5 63 40.5 64 38.0 65 40.0 66 31.5 67 23.0 68 23.0 69 20.0 70 16.5 71 14.5 72 10.0 73 9.0 74 6.5 75 4.0 76 4.0 77 2.5 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.03 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.7374999999999998 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 2.0875 0.0 0.0 0.0 0.0 130-131 2.3375000000000004 0.0 0.0 0.0 0.0 132-133 2.6125 0.0 0.0 0.0 0.0 134-135 2.925 0.0 0.0 0.0 0.0 136-137 3.125 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958263 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958263_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72325 33.0 33.0 34.0 32.0 34.0 2 32.87 33.0 33.0 34.0 32.0 34.0 3 32.922 33.0 33.0 34.0 32.0 34.0 4 32.87125 34.0 33.0 34.0 32.0 34.0 5 32.94025 34.0 33.0 34.0 32.0 34.0 6 37.00475 38.0 38.0 38.0 36.0 38.0 7 36.934 38.0 38.0 38.0 36.0 38.0 8 36.913 38.0 38.0 38.0 36.0 38.0 9 36.777 38.0 38.0 38.0 35.0 38.0 10-14 36.60955 38.0 38.0 38.0 34.4 38.0 15-19 36.47825 38.0 38.0 38.0 34.4 38.0 20-24 36.61685 38.0 38.0 38.0 34.8 38.0 25-29 36.74159999999999 38.0 38.0 38.0 35.2 38.0 30-34 37.00285 38.0 38.0 38.0 36.0 38.0 35-39 37.093650000000004 38.0 38.0 38.0 36.6 38.0 40-44 36.96515 38.0 38.0 38.0 36.0 38.0 45-49 36.788349999999994 38.0 38.0 38.0 35.4 38.0 50-54 36.4043 38.0 38.0 38.0 34.0 38.0 55-59 36.38205000000001 38.0 38.0 38.0 33.8 38.0 60-64 36.62904999999999 38.0 38.0 38.0 35.0 38.0 65-69 36.1916 38.0 38.0 38.0 33.4 38.0 70-74 36.04685 38.0 38.0 38.0 32.4 38.0 75-79 35.83065 38.0 37.6 38.0 31.6 38.0 80-84 35.5113 38.0 37.2 38.0 29.4 38.0 85-89 35.443349999999995 38.0 37.0 38.0 29.2 38.0 90-94 35.9507 38.0 37.4 38.0 32.6 38.0 95-99 36.0771 38.0 37.8 38.0 33.4 38.0 100-104 36.01125 38.0 37.8 38.0 33.2 38.0 105-109 35.98715 38.0 37.6 38.0 32.8 38.0 110-114 35.64945 38.0 37.2 38.0 31.0 38.0 115-119 35.28515 38.0 36.2 38.0 29.6 38.0 120-124 33.756299999999996 37.8 34.0 38.0 20.2 38.0 125-129 33.414750000000005 38.0 32.8 38.0 19.0 38.0 130-134 28.653250000000003 31.8 21.2 37.6 13.8 38.0 135-139 33.5874 38.0 33.0 38.0 23.0 38.0 140-144 33.93085 38.0 33.2 38.0 24.0 38.0 145-149 33.21185 38.0 33.2 38.0 18.2 38.0 150-151 27.54475 33.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 3.0 5 1.0 6 2.0 7 2.0 8 1.0 9 1.0 10 2.0 11 3.0 12 1.0 13 3.0 14 3.0 15 1.0 16 6.0 17 2.0 18 5.0 19 8.0 20 6.0 21 9.0 22 14.0 23 13.0 24 20.0 25 21.0 26 31.0 27 38.0 28 44.0 29 43.0 30 67.0 31 101.0 32 127.0 33 142.0 34 234.0 35 365.0 36 870.0 37 1800.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.875 18.3 12.7 34.125 2 29.2 25.5 28.050000000000004 17.25 3 22.45 26.85 27.55 23.150000000000002 4 25.1 33.0 19.55 22.35 5 27.1 34.0 20.3 18.6 6 22.7 35.825 20.375 21.099999999999998 7 21.675 20.175 35.5 22.650000000000002 8 23.825 23.65 24.775 27.750000000000004 9 22.6 24.099999999999998 28.549999999999997 24.75 10-14 25.145 26.729999999999997 23.849999999999998 24.275 15-19 25.5 25.765 25.569999999999997 23.165 20-24 24.725 26.6 25.145 23.53 25-29 24.92 26.66 25.014999999999997 23.405 30-34 25.290000000000003 25.81 25.419999999999998 23.48 35-39 25.53 25.679999999999996 25.14 23.65 40-44 25.45 26.305 25.119999999999997 23.125 45-49 25.074999999999996 25.85 25.795 23.28 50-54 25.955000000000002 25.835 25.014999999999997 23.195 55-59 25.480000000000004 25.790000000000003 25.319999999999997 23.41 60-64 25.16 25.495 25.945 23.400000000000002 65-69 25.555 26.215 25.055 23.175 70-74 25.480000000000004 26.415 25.215 22.89 75-79 25.014999999999997 25.979999999999997 25.96 23.044999999999998 80-84 25.759999999999998 26.235000000000003 25.569999999999997 22.435 85-89 25.8 25.935000000000002 25.2 23.064999999999998 90-94 25.535000000000004 26.345000000000002 25.515 22.605 95-99 25.31 27.095000000000002 24.925 22.67 100-104 25.55 25.865 25.515 23.07 105-109 25.465 25.965 25.715 22.855 110-114 25.61 26.3 25.635 22.455 115-119 25.645 25.855 25.305 23.195 120-124 25.755 25.825 25.435000000000002 22.985 125-129 25.605 26.840000000000003 25.019999999999996 22.535 130-134 25.66 26.224999999999998 25.855 22.259999999999998 135-139 24.965 26.240000000000002 25.89 22.905 140-144 26.314999999999998 26.32 25.255 22.11 145-149 26.064999999999998 26.125 25.445 22.365 150-151 27.0 25.3 26.0 21.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 2.0 28 3.5 29 5.0 30 10.0 31 13.5 32 14.0 33 19.0 34 27.5 35 36.5 36 49.0 37 76.0 38 90.0 39 104.0 40 130.5 41 154.5 42 181.5 43 199.5 44 206.0 45 210.5 46 220.5 47 214.5 48 191.0 49 185.5 50 166.5 51 140.0 52 138.0 53 124.5 54 106.0 55 102.0 56 87.5 57 77.0 58 82.0 59 76.0 60 68.5 61 60.0 62 53.5 63 43.5 64 42.5 65 42.0 66 40.5 67 43.5 68 34.0 69 24.5 70 22.0 71 18.5 72 14.5 73 14.5 74 10.0 75 7.0 76 5.0 77 3.0 78 2.0 79 0.5 80 0.5 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.5499999999999998 0.0 0.0 0.0 0.0 126-127 1.6124999999999998 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.2625 0.0 0.0 0.0 0.0 134-135 2.575 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTGT 10 0.006830828 145.0 1 AAGCTAA 10 0.006830828 145.0 5 GGCCAAG 20 0.00593511 29.0 85-89 >>END_MODULE Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622026 spots for SRR6958263.sra Written 1622026 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra Read 1622018 spots for SRR6958263.sra Written 1622018 spots for SRR6958263.sra SRR ids: ['SRR6958263.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_glrq0wum SRR6958263.sra spots: 32440368 blocks: [[1, 1622018], [1622019, 3244036], [3244037, 4866054], [4866055, 6488072], [6488073, 8110090], [8110091, 9732108], [9732109, 11354126], [11354127, 12976144], [12976145, 14598162], [14598163, 16220180], [16220181, 17842198], [17842199, 19464216], [19464217, 21086234], [21086235, 22708252], [22708253, 24330270], [24330271, 25952288], [25952289, 27574306], [27574307, 29196324], [29196325, 30818342], [30818343, 32440368]] SRR6958263 file size 10971275 SRR6958263 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958263 SRR6958263_1.fastq SRR6958263_2.fastq Input file: SRR6958263_1.fastq Paired file: SRR6958263_2.fastq trimmed: SRR6958263-trimmed-pair1.fastq, SRR6958263-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:08:11 2024 >> started Fri Dec 6 18:08:50 2024 >> done (38.632s) 32440368 read pairs processed; of these: 28096 ( 0.09%) short read pairs filtered out after trimming by size control 25854 ( 0.08%) empty read pairs filtered out after trimming by size control 32386418 (99.83%) read pairs available; of these: 11837737 (36.55%) trimmed read pairs available after processing 20548681 (63.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 4 0.00% 23 2 0.00% 24 5 0.00% 25 9 0.00% 26 3 0.00% 27 9 0.00% 28 7 0.00% 29 5 0.00% 30 7 0.00% 31 11 0.00% 32 9 0.00% 33 11 0.00% 34 6 0.00% 35 10 0.00% 36 10 0.00% 37 10 0.00% 38 15 0.00% 39 12 0.00% 40 9 0.00% 41 16 0.00% 42 11 0.00% 43 20 0.00% 44 26 0.00% 45 20 0.00% 46 16 0.00% 47 23 0.00% 48 45 0.00% 49 26 0.00% 50 34 0.00% 51 34 0.00% 52 47 0.00% 53 50 0.00% 54 60 0.00% 55 46 0.00% 56 72 0.00% 57 75 0.00% 58 78 0.00% 59 101 0.00% 60 118 0.00% 61 111 0.00% 62 134 0.00% 63 154 0.00% 64 181 0.00% 65 187 0.00% 66 218 0.00% 67 238 0.00% 68 285 0.00% 69 308 0.00% 70 359 0.00% 71 398 0.00% 72 484 0.00% 73 547 0.00% 74 575 0.00% 75 728 0.00% 76 785 0.00% 77 824 0.00% 78 915 0.00% 79 1068 0.00% 80 1293 0.00% 81 1424 0.00% 82 1668 0.01% 83 1921 0.01% 84 3210 0.01% 85 4123 0.01% 86 4250 0.01% 87 4454 0.01% 88 4938 0.02% 89 4881 0.02% 90 5269 0.02% 91 5714 0.02% 92 6112 0.02% 93 6714 0.02% 94 6890 0.02% 95 7396 0.02% 96 8072 0.02% 97 8616 0.03% 98 8996 0.03% 99 9582 0.03% 100 10434 0.03% 101 10980 0.03% 102 11730 0.04% 103 13059 0.04% 104 13885 0.04% 105 15117 0.05% 106 15838 0.05% 107 16595 0.05% 108 17474 0.05% 109 18738 0.06% 110 19358 0.06% 111 20945 0.06% 112 22170 0.07% 113 23469 0.07% 114 25180 0.08% 115 26832 0.08% 116 28110 0.09% 117 29583 0.09% 118 31008 0.10% 119 32197 0.10% 120 33898 0.10% 121 35510 0.11% 122 37243 0.11% 123 39695 0.12% 124 42128 0.13% 125 44521 0.14% 126 46694 0.14% 127 49291 0.15% 128 51420 0.16% 129 53888 0.17% 130 56055 0.17% 131 59775 0.18% 132 63263 0.20% 133 67110 0.21% 134 71463 0.22% 135 76234 0.24% 136 81235 0.25% 137 87283 0.27% 138 92798 0.29% 139 99567 0.31% 140 107879 0.33% 141 119213 0.37% 142 135561 0.42% 143 151921 0.47% 144 176112 0.54% 145 211644 0.65% 146 268725 0.83% 147 366817 1.13% 148 561336 1.73% 149 1100500 3.40% 150 6931154 21.40% 151 20548681 63.45% 32386418 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=4.54 fanout-score-rank=23 prefix-density=0.32 prefix-fanout=3.8 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=184.46 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.6 sequence=GCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTGTCCTGAGAGATGGCAGCGTAACGGGCAAGACCCCATGCAGCTTCCTTGACAGCAAGCTCAGATGGGCCGTTGGGGATGCTGACGA criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=23 prefix-density=0.34 prefix-fanout=2.9 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.15 sequence-density-rank=12 fanout-score=57.74 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=10.8 sequence=AAGGAGAAGCTCCCTGGTGGTGGC SRR6958263 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:09:37 Started mapping on | Dec 06 18:09:37 Finished on | Dec 06 18:12:42 Mapping speed, Million of reads per hour | 630.22 Number of input reads | 32386418 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 31607317 Uniquely mapped reads % | 97.59% Average mapped length | 297.67 Number of splices: Total | 36664972 Number of splices: Annotated (sjdb) | 34699897 Number of splices: GT/AG | 36233496 Number of splices: GC/AG | 387335 Number of splices: AT/AC | 14469 Number of splices: Non-canonical | 29672 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 235664 % of reads mapped to multiple loci | 0.73% Number of reads mapped to too many loci | 17171 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.26% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 560982 560982 560982 N_multimapping 235664 235664 235664 N_noFeature 1234289 30839163 1448682 N_ambiguous 646386 3579 94651 UnstrandedReadsAssigned:29726642 PositiveStrandReadsAssigned:764575 NegativeStrandReadsAssigned:30063984 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958263 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958263-trimmed-pair1.fastq SRR6958263-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,386,418 reads, 30,121,562 reads pseudoaligned [quant] estimated average fragment length: 268.714 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,234 rounds 52973 SRR6958263.ke.tsv 35125 SRR6958263.se.tsv 88098 total ==> SRR6958263.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.76 0 0 PNS24247 1044 776.286 106.672 6.98798 PNS24249 1928 1660.29 93.3705 2.85991 PNS24246 1044 776.286 106.672 6.98798 PNS24248 1044 776.286 106.672 6.98798 PNS24244 1471 1203.29 79.6148 3.36473 PNS24243 293 80.7211 0 0 KQK14069 1603 1335.29 2018.97 76.8918 KQK14071 474 220.685 26.4849 6.1031 ==> SRR6958263.se.tsv <== BRADI_1g14170v3 2239 BRADI_1g53295v3 865 BRADI_1g59795v3 521 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 1024 BRADI_1g74790v3 601 BRADI_1g09890v3 0 BRADI_1g77505v3 333 BRADI_1g48960v3 0 SRR6958263 completed mapping pipeline successfully