Starting /dee2/code/volunteer_pipeline.sh SRR6958264 current disk space = 1550503297024 free memory = 1317780976 SRR6958264 SRAfilesize 8da09937c5e45ac24c46042c53200bb2 SRR6958264.sra SRR6958264.sra file validated SRR6958264 is paired end SRR6958264 is conventional basespace SRR6958264 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958264_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.49275 33.0 32.0 33.0 18.0 34.0 2 31.9575 33.0 31.0 34.0 28.0 34.0 3 31.11275 33.0 31.0 33.0 27.0 33.0 4 31.693 33.0 32.0 33.0 30.0 33.0 5 32.3985 33.0 33.0 33.0 31.0 34.0 6 36.72375 38.0 37.0 38.0 35.0 38.0 7 37.15675 38.0 38.0 38.0 36.0 38.0 8 37.2325 38.0 38.0 38.0 36.0 38.0 9 37.35525 38.0 38.0 38.0 37.0 38.0 10-14 37.422450000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.37245 38.0 38.0 38.0 37.0 38.0 20-24 37.48385 38.0 38.0 38.0 37.2 38.0 25-29 37.39635 38.0 38.0 38.0 37.0 38.0 30-34 37.3283 38.0 38.0 38.0 37.0 38.0 35-39 37.150850000000005 38.0 38.0 38.0 36.2 38.0 40-44 37.1235 38.0 38.0 38.0 36.2 38.0 45-49 37.2564 38.0 38.0 38.0 36.6 38.0 50-54 37.0946 38.0 38.0 38.0 36.0 38.0 55-59 36.948499999999996 38.0 38.0 38.0 35.6 38.0 60-64 36.97965 38.0 38.0 38.0 36.0 38.0 65-69 37.05975 38.0 38.0 38.0 36.0 38.0 70-74 37.03945 38.0 38.0 38.0 36.0 38.0 75-79 36.8972 38.0 38.0 38.0 35.0 38.0 80-84 36.70115 38.0 38.0 38.0 34.4 38.0 85-89 36.4705 38.0 38.0 38.0 33.8 38.0 90-94 36.6421 38.0 38.0 38.0 34.2 38.0 95-99 36.5906 38.0 38.0 38.0 34.2 38.0 100-104 36.4212 38.0 38.0 38.0 34.0 38.0 105-109 36.279900000000005 38.0 37.2 38.0 33.8 38.0 110-114 36.052200000000006 38.0 37.0 38.0 32.4 38.0 115-119 35.9613 38.0 36.6 38.0 32.2 38.0 120-124 35.751 38.0 36.2 38.0 31.2 38.0 125-129 35.5053 38.0 36.0 38.0 30.4 38.0 130-134 35.319900000000004 38.0 35.8 38.0 29.6 38.0 135-139 34.95029999999999 38.0 35.0 38.0 28.0 38.0 140-144 34.78505 38.0 35.0 38.0 27.6 38.0 145-149 33.94455 38.0 34.6 38.0 24.2 38.0 150-151 29.798125000000002 36.0 27.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 2.0 18 0.0 19 2.0 20 1.0 21 2.0 22 6.0 23 3.0 24 7.0 25 7.0 26 13.0 27 22.0 28 21.0 29 33.0 30 49.0 31 78.0 32 95.0 33 136.0 34 171.0 35 316.0 36 780.0 37 2255.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.93839835728953 9.933264887063654 8.03388090349076 42.09445585215606 2 21.925 12.75 36.375 28.95 3 19.900000000000002 15.35 26.775 37.974999999999994 4 24.85 23.3 22.875 28.975 5 26.700000000000003 26.75 24.0 22.55 6 22.6 32.75 22.925 21.725 7 17.825 24.375 37.8 20.0 8 20.175 24.875 29.65 25.3 9 20.25 22.0 33.275 24.474999999999998 10-14 22.325 26.810000000000002 26.035000000000004 24.83 15-19 21.84 26.125 26.36 25.674999999999997 20-24 22.35 25.874999999999996 26.479999999999997 25.295 25-29 21.935 26.435 26.115 25.515 30-34 22.225 26.119999999999997 25.95 25.705 35-39 22.515 25.8 26.700000000000003 24.985 40-44 22.215 26.43 26.045 25.31 45-49 21.955 26.805 25.785000000000004 25.455 50-54 22.48 25.5 26.665 25.355 55-59 23.06 25.650000000000002 26.295 24.995 60-64 22.36 25.775 26.484999999999996 25.380000000000003 65-69 22.375 26.685 25.775 25.165 70-74 22.195 26.27 26.479999999999997 25.055 75-79 22.42 26.265 25.775 25.540000000000003 80-84 22.45 25.380000000000003 26.445 25.724999999999998 85-89 23.13 25.69 25.874999999999996 25.305 90-94 23.195 25.435000000000002 26.150000000000002 25.22 95-99 22.625 25.985000000000003 26.3 25.09 100-104 22.82 25.89 26.009999999999998 25.28 105-109 22.64 25.46 26.655 25.245 110-114 22.735 25.924999999999997 26.125 25.215 115-119 22.88 26.145000000000003 25.580000000000002 25.395 120-124 22.755 25.605 25.91 25.729999999999997 125-129 22.62 25.3 26.479999999999997 25.6 130-134 22.68 25.72 26.169999999999998 25.430000000000003 135-139 22.58 25.775 26.165 25.480000000000004 140-144 22.71 25.75 26.33 25.21 145-149 23.189999999999998 25.655 25.569999999999997 25.585 150-151 22.650000000000002 25.674999999999997 25.775 25.900000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 2.5 29 3.5 30 6.5 31 12.0 32 14.5 33 20.0 34 24.5 35 32.5 36 56.5 37 82.0 38 101.0 39 119.5 40 134.0 41 160.0 42 186.0 43 205.5 44 223.5 45 216.0 46 222.5 47 232.5 48 207.0 49 184.0 50 177.0 51 160.0 52 135.5 53 112.5 54 100.5 55 93.5 56 82.0 57 73.0 58 68.0 59 68.0 60 63.0 61 55.0 62 51.5 63 43.0 64 41.5 65 41.5 66 29.5 67 24.5 68 27.5 69 26.5 70 23.0 71 15.0 72 11.0 73 11.0 74 6.0 75 6.0 76 4.5 77 1.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.325 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.5875000000000004 0.0 0.0 0.0 0.0 132-133 2.7875 0.0 0.0 0.0 0.0 134-135 3.1125 0.0 0.0 0.0 0.0 136-137 3.2874999999999996 0.0 0.0 0.0 0.0 138-139 3.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958264 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958264_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0095 33.0 33.0 34.0 32.0 34.0 2 32.921 33.0 33.0 34.0 32.0 34.0 3 32.9285 34.0 33.0 34.0 32.0 34.0 4 32.93925 34.0 33.0 34.0 32.0 34.0 5 32.86675 34.0 33.0 34.0 32.0 34.0 6 37.18925 38.0 38.0 38.0 36.0 38.0 7 36.9785 38.0 38.0 38.0 36.0 38.0 8 37.009 38.0 38.0 38.0 36.0 38.0 9 37.04475 38.0 38.0 38.0 36.0 38.0 10-14 36.953 38.0 38.0 38.0 35.8 38.0 15-19 36.89919999999999 38.0 38.0 38.0 36.0 38.0 20-24 36.943 38.0 38.0 38.0 35.8 38.0 25-29 37.049400000000006 38.0 38.0 38.0 36.0 38.0 30-34 37.074149999999996 38.0 38.0 38.0 36.2 38.0 35-39 37.0021 38.0 38.0 38.0 36.0 38.0 40-44 36.93185 38.0 38.0 38.0 35.8 38.0 45-49 36.84855 38.0 38.0 38.0 35.4 38.0 50-54 36.7731 38.0 38.0 38.0 34.8 38.0 55-59 36.8115 38.0 38.0 38.0 35.0 38.0 60-64 36.81955000000001 38.0 38.0 38.0 35.0 38.0 65-69 36.73845 38.0 38.0 38.0 34.6 38.0 70-74 36.542649999999995 38.0 38.0 38.0 34.2 38.0 75-79 36.3811 38.0 38.0 38.0 34.0 38.0 80-84 36.25575 38.0 38.0 38.0 33.4 38.0 85-89 36.10255000000001 38.0 37.8 38.0 33.0 38.0 90-94 36.09245 38.0 37.6 38.0 33.0 38.0 95-99 35.9932 38.0 37.0 38.0 33.0 38.0 100-104 35.7632 38.0 37.0 38.0 31.4 38.0 105-109 35.594350000000006 38.0 36.8 38.0 30.6 38.0 110-114 35.3972 38.0 36.0 38.0 29.2 38.0 115-119 35.24135 38.0 36.0 38.0 28.4 38.0 120-124 35.1217 38.0 35.6 38.0 28.2 38.0 125-129 34.9231 38.0 35.0 38.0 27.6 38.0 130-134 34.45305 38.0 35.0 38.0 25.2 38.0 135-139 33.9807 38.0 34.2 38.0 22.8 38.0 140-144 33.612700000000004 38.0 34.0 38.0 21.4 38.0 145-149 32.6769 38.0 33.4 38.0 16.4 38.0 150-151 27.538125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 2.0 13 2.0 14 0.0 15 5.0 16 2.0 17 1.0 18 4.0 19 3.0 20 6.0 21 7.0 22 8.0 23 16.0 24 15.0 25 14.0 26 24.0 27 36.0 28 45.0 29 45.0 30 77.0 31 83.0 32 81.0 33 139.0 34 191.0 35 335.0 36 703.0 37 2146.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.55 18.3 12.65 34.5 2 29.099999999999998 23.9 29.099999999999998 17.9 3 23.125 25.124999999999996 28.375 23.375 4 25.95 29.525000000000002 21.6 22.925 5 27.975 32.15 20.75 19.125 6 22.275 36.8 21.15 19.775000000000002 7 21.4 19.6 36.275 22.725 8 22.05 23.425 26.424999999999997 28.1 9 24.575 22.1 28.375 24.95 10-14 25.845000000000002 26.784999999999997 23.805 23.565 15-19 25.395 25.790000000000003 24.995 23.82 20-24 26.009999999999998 26.16 24.36 23.47 25-29 25.165 26.029999999999998 24.865000000000002 23.94 30-34 25.865 25.8 24.915000000000003 23.419999999999998 35-39 24.925 26.32 25.53 23.225 40-44 25.979999999999997 25.745 25.119999999999997 23.155 45-49 25.669999999999998 25.540000000000003 25.35 23.44 50-54 25.919999999999998 25.785000000000004 25.645 22.650000000000002 55-59 25.759999999999998 26.040000000000003 25.0 23.200000000000003 60-64 25.365 26.14 25.31 23.185 65-69 25.635 26.115 25.064999999999998 23.185 70-74 25.805 25.885 25.505 22.805 75-79 25.345000000000002 25.595000000000002 26.0 23.06 80-84 25.874999999999996 25.624999999999996 25.335 23.165 85-89 25.47 25.724999999999998 25.555 23.25 90-94 25.86 26.345000000000002 25.255 22.54 95-99 25.874999999999996 25.330000000000002 25.19 23.605 100-104 25.53 26.07 25.5 22.900000000000002 105-109 25.745 26.150000000000002 25.465 22.64 110-114 25.89 25.82 25.755 22.535 115-119 26.44 26.26 25.1 22.2 120-124 25.46 26.305 25.5 22.735 125-129 25.915 26.155 24.855 23.075000000000003 130-134 26.305 26.700000000000003 25.15 21.845 135-139 26.55 26.540000000000003 25.255 21.654999999999998 140-144 26.08 26.640000000000004 25.169999999999998 22.11 145-149 26.275 26.275 25.130000000000003 22.32 150-151 26.0625 26.325 24.675 22.9375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 1.0 24 1.0 25 0.5 26 3.5 27 4.5 28 3.5 29 4.0 30 8.5 31 11.5 32 11.0 33 17.0 34 28.5 35 36.5 36 47.0 37 69.5 38 92.5 39 114.0 40 128.0 41 146.0 42 169.0 43 180.0 44 194.0 45 218.0 46 216.5 47 191.5 48 192.0 49 192.5 50 172.0 51 153.0 52 134.5 53 121.0 54 115.5 55 97.5 56 85.0 57 84.0 58 71.0 59 68.0 60 64.0 61 56.5 62 70.0 63 65.0 64 49.0 65 49.5 66 48.5 67 37.0 68 30.0 69 35.0 70 28.5 71 19.0 72 18.0 73 12.5 74 9.5 75 7.5 76 4.5 77 4.5 78 3.0 79 1.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.7125 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.325 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.5875000000000004 0.0 0.0 0.0 0.0 132-133 2.7875 0.0 0.0 0.0 0.0 134-135 3.0875 0.0 0.0 0.0 0.0 136-137 3.2625 0.0 0.0 0.0 0.0 138-139 3.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGATC 10 0.006830828 145.0 2 TGATAAC 10 0.006830828 145.0 5 >>END_MODULE Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960412 spots for SRR6958264.sra Written 960412 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra Read 960410 spots for SRR6958264.sra Written 960410 spots for SRR6958264.sra SRR ids: ['SRR6958264.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_68h75q21 SRR6958264.sra spots: 19208202 blocks: [[1, 960410], [960411, 1920820], [1920821, 2881230], [2881231, 3841640], [3841641, 4802050], [4802051, 5762460], [5762461, 6722870], [6722871, 7683280], [7683281, 8643690], [8643691, 9604100], [9604101, 10564510], [10564511, 11524920], [11524921, 12485330], [12485331, 13445740], [13445741, 14406150], [14406151, 15366560], [15366561, 16326970], [16326971, 17287380], [17287381, 18247790], [18247791, 19208202]] SRR6958264 file size 6487329 SRR6958264 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958264 SRR6958264_1.fastq SRR6958264_2.fastq Input file: SRR6958264_1.fastq Paired file: SRR6958264_2.fastq trimmed: SRR6958264-trimmed-pair1.fastq, SRR6958264-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:09:05 2024 >> started Fri Dec 6 18:09:30 2024 >> done (24.498s) 19208202 read pairs processed; of these: 10546 ( 0.05%) short read pairs filtered out after trimming by size control 8774 ( 0.05%) empty read pairs filtered out after trimming by size control 19188882 (99.90%) read pairs available; of these: 6913034 (36.03%) trimmed read pairs available after processing 12275848 (63.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 5 0.00% 22 4 0.00% 23 7 0.00% 24 8 0.00% 25 5 0.00% 26 7 0.00% 27 7 0.00% 28 4 0.00% 29 8 0.00% 30 10 0.00% 31 5 0.00% 32 7 0.00% 33 6 0.00% 34 4 0.00% 35 7 0.00% 36 11 0.00% 37 3 0.00% 38 8 0.00% 39 9 0.00% 40 6 0.00% 41 11 0.00% 42 14 0.00% 43 12 0.00% 44 14 0.00% 45 13 0.00% 46 25 0.00% 47 16 0.00% 48 11 0.00% 49 18 0.00% 50 28 0.00% 51 44 0.00% 52 42 0.00% 53 31 0.00% 54 33 0.00% 55 33 0.00% 56 48 0.00% 57 56 0.00% 58 59 0.00% 59 81 0.00% 60 88 0.00% 61 93 0.00% 62 99 0.00% 63 129 0.00% 64 148 0.00% 65 159 0.00% 66 181 0.00% 67 184 0.00% 68 230 0.00% 69 244 0.00% 70 274 0.00% 71 326 0.00% 72 361 0.00% 73 390 0.00% 74 508 0.00% 75 509 0.00% 76 608 0.00% 77 694 0.00% 78 734 0.00% 79 842 0.00% 80 964 0.01% 81 1109 0.01% 82 1215 0.01% 83 1465 0.01% 84 1967 0.01% 85 2485 0.01% 86 2616 0.01% 87 2751 0.01% 88 3035 0.02% 89 3077 0.02% 90 3191 0.02% 91 3531 0.02% 92 3696 0.02% 93 4103 0.02% 94 4258 0.02% 95 4506 0.02% 96 4883 0.03% 97 5341 0.03% 98 5742 0.03% 99 5927 0.03% 100 6475 0.03% 101 6679 0.03% 102 7292 0.04% 103 7736 0.04% 104 8083 0.04% 105 8496 0.04% 106 9212 0.05% 107 9871 0.05% 108 10014 0.05% 109 10704 0.06% 110 11231 0.06% 111 11592 0.06% 112 12705 0.07% 113 13450 0.07% 114 14177 0.07% 115 14740 0.08% 116 15739 0.08% 117 16409 0.09% 118 17625 0.09% 119 18117 0.09% 120 19244 0.10% 121 19929 0.10% 122 20948 0.11% 123 21837 0.11% 124 23042 0.12% 125 24160 0.13% 126 25668 0.13% 127 27374 0.14% 128 28533 0.15% 129 29992 0.16% 130 31408 0.16% 131 33080 0.17% 132 35195 0.18% 133 37632 0.20% 134 39658 0.21% 135 42125 0.22% 136 45129 0.24% 137 48140 0.25% 138 51437 0.27% 139 55830 0.29% 140 60796 0.32% 141 65891 0.34% 142 74626 0.39% 143 83518 0.44% 144 97492 0.51% 145 120114 0.63% 146 149789 0.78% 147 205448 1.07% 148 321148 1.67% 149 669617 3.49% 150 4100494 21.37% 151 12275848 63.97% 19188882 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=6.62 fanout-score-rank=19 prefix-density=0.44 prefix-fanout=4.2 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=80.03 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=13.8 sequence=AGCTTCTTCCCAAGGAAGCTGGTTGGCGTAGAAGCCGGAGCTCCGACGGTGGAGGAGAAGGTAGCAGACATCTCTGCTCTGCTTGGTCTGATCTGGATTAAG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=33.14 fanout-score-rank=4 prefix-density=0.91 prefix-fanout=7.9 sequence=AAGGAGAAGCTGCCTGGCCAGCACTGAGCGCCTCGCAGTCGCAGGTTGCCTAGCTCGACTTGTGAGAGTTGAGCTACGTATAGTACCAGCTGGCCACCCTCTGAGAATACTATACTGTAATAAGATGAAGAAGAATAAAATTCCCACGATCACATGTACTGTTATACTGAGAGTAGAGTCTGTACCGTGGGATTTATACCGTACGTCGTTGTGTAAATTTCCTTTTAATTTGTTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=74.10 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.4 sequence=TGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAG SRR6958264 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:10:31 Started mapping on | Dec 06 18:10:31 Finished on | Dec 06 18:12:13 Mapping speed, Million of reads per hour | 677.25 Number of input reads | 19188882 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18751968 Uniquely mapped reads % | 97.72% Average mapped length | 297.60 Number of splices: Total | 21435364 Number of splices: Annotated (sjdb) | 20240398 Number of splices: GT/AG | 21160766 Number of splices: GC/AG | 233501 Number of splices: AT/AC | 9069 Number of splices: Non-canonical | 32028 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.47 Insertion rate per base | 0.01% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 164884 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 12348 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.87% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 278378 278378 278378 N_multimapping 164884 164884 164884 N_noFeature 800234 18240538 958269 N_ambiguous 419323 2358 67384 UnstrandedReadsAssigned:17532411 PositiveStrandReadsAssigned:509072 NegativeStrandReadsAssigned:17726315 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958264 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958264-trimmed-pair1.fastq SRR6958264-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,188,882 reads, 17,709,217 reads pseudoaligned [quant] estimated average fragment length: 272.866 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 SRR6958264.ke.tsv 35125 SRR6958264.se.tsv 88098 total ==> SRR6958264.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.51 0 0 PNS24247 1044 772.134 66.4173 7.21972 PNS24249 1928 1656.13 49.468 2.50704 PNS24246 1044 772.134 66.4173 7.21972 PNS24248 1044 772.134 66.4173 7.21972 PNS24244 1471 1199.13 84.2802 5.89916 PNS24243 293 79.0192 0 0 KQK14069 1603 1331.13 986.008 62.1714 KQK14071 474 218.116 42.6182 16.3999 ==> SRR6958264.se.tsv <== BRADI_1g14170v3 1313 BRADI_1g53295v3 653 BRADI_1g59795v3 323 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 450 BRADI_1g74790v3 393 BRADI_1g09890v3 0 BRADI_1g77505v3 267 BRADI_1g48960v3 0 SRR6958264 completed mapping pipeline successfully