Starting /dee2/code/volunteer_pipeline.sh SRR6958265 current disk space = 1550656880640 free memory = 1596505284 SRR6958265 SRAfilesize a9fb6879fdd4852073cd3eef1e24bbe5 SRR6958265.sra SRR6958265.sra file validated SRR6958265 is paired end SRR6958265 is conventional basespace SRR6958265 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958265_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.89625 33.0 31.0 33.0 18.0 33.0 2 31.06425 33.0 30.0 33.0 27.0 34.0 3 30.8595 33.0 30.0 33.0 27.0 34.0 4 31.13675 33.0 32.0 33.0 27.0 33.0 5 32.02025 33.0 32.0 33.0 31.0 34.0 6 36.26275 38.0 37.0 38.0 33.0 38.0 7 36.52325 38.0 37.0 38.0 34.0 38.0 8 36.75025 38.0 38.0 38.0 34.0 38.0 9 37.09975 38.0 38.0 38.0 36.0 38.0 10-14 37.228049999999996 38.0 38.0 38.0 36.4 38.0 15-19 37.301199999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.25555 38.0 38.0 38.0 36.6 38.0 25-29 37.097849999999994 38.0 38.0 38.0 36.0 38.0 30-34 36.9704 38.0 38.0 38.0 35.6 38.0 35-39 36.866150000000005 38.0 38.0 38.0 35.2 38.0 40-44 36.9601 38.0 38.0 38.0 35.6 38.0 45-49 36.807249999999996 38.0 38.0 38.0 34.8 38.0 50-54 36.56355 38.0 38.0 38.0 34.0 38.0 55-59 36.5261 38.0 38.0 38.0 34.0 38.0 60-64 36.682399999999994 38.0 38.0 38.0 34.6 38.0 65-69 36.7193 38.0 38.0 38.0 34.6 38.0 70-74 36.26735 38.0 37.4 38.0 33.0 38.0 75-79 36.1498 38.0 37.2 38.0 32.4 38.0 80-84 36.1154 38.0 37.0 38.0 32.4 38.0 85-89 36.264950000000006 38.0 37.4 38.0 33.2 38.0 90-94 36.102199999999996 38.0 36.8 38.0 32.8 38.0 95-99 35.6958 38.0 36.2 38.0 30.6 38.0 100-104 35.083099999999995 38.0 35.6 38.0 28.0 38.0 105-109 34.7787 38.0 35.0 38.0 26.0 38.0 110-114 34.90675 38.0 35.0 38.0 27.4 38.0 115-119 34.9799 38.0 35.0 38.0 27.8 38.0 120-124 34.65205 38.0 35.0 38.0 26.4 38.0 125-129 34.49025 38.0 34.8 38.0 25.6 38.0 130-134 33.924549999999996 38.0 34.0 38.0 22.6 38.0 135-139 33.346050000000005 38.0 33.4 38.0 20.2 38.0 140-144 32.38315 36.6 32.4 38.0 14.2 38.0 145-149 30.86155 36.0 30.4 38.0 8.6 38.0 150-151 26.302500000000002 34.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 5.0 16 1.0 17 2.0 18 2.0 19 5.0 20 3.0 21 3.0 22 10.0 23 9.0 24 8.0 25 25.0 26 27.0 27 48.0 28 48.0 29 65.0 30 77.0 31 98.0 32 142.0 33 201.0 34 263.0 35 449.0 36 1024.0 37 1480.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.56675749318801 9.673024523160763 8.147138964577657 35.61307901907357 2 23.925 10.75 34.475 30.85 3 20.674999999999997 16.35 25.5 37.475 4 26.974999999999998 21.825 21.975 29.225 5 25.124999999999996 28.849999999999998 23.575 22.45 6 23.599999999999998 29.65 24.05 22.7 7 18.875 23.849999999999998 37.8 19.475 8 20.674999999999997 23.674999999999997 29.825000000000003 25.825 9 20.875 21.425 32.9 24.8 10-14 23.75 26.105 25.16 24.985 15-19 23.89 24.165 26.200000000000003 25.745 20-24 23.385 24.635 26.179999999999996 25.8 25-29 23.29 24.63 25.979999999999997 26.1 30-34 24.0 25.119999999999997 24.990000000000002 25.89 35-39 23.235 24.73 25.745 26.290000000000003 40-44 23.765 24.474999999999998 25.905 25.855 45-49 23.745 25.105 25.014999999999997 26.135 50-54 23.565 24.85 25.615 25.97 55-59 24.205 24.675 25.47 25.650000000000002 60-64 23.895 24.745 25.36 26.0 65-69 23.625 25.03 25.5 25.845000000000002 70-74 23.76 24.255 25.755 26.229999999999997 75-79 24.005000000000003 24.834999999999997 25.074999999999996 26.085 80-84 24.07 24.605 25.53 25.795 85-89 23.89 24.98 25.540000000000003 25.590000000000003 90-94 24.035 24.175 25.965 25.825 95-99 23.87 23.765 26.314999999999998 26.05 100-104 23.91 24.265 25.369999999999997 26.455000000000002 105-109 24.265 24.375 25.75 25.61 110-114 24.22 24.325 25.52 25.935000000000002 115-119 24.15 25.105 25.055 25.69 120-124 23.835 24.46 25.525 26.179999999999996 125-129 23.87 24.85 25.130000000000003 26.150000000000002 130-134 24.45 24.435000000000002 24.785 26.33 135-139 24.11 25.11 25.064999999999998 25.715 140-144 24.044999999999998 24.38 25.28 26.295 145-149 23.985 24.89 25.455 25.669999999999998 150-151 24.0625 24.4 25.45 26.087500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 2.5 28 3.5 29 2.5 30 2.5 31 3.5 32 8.5 33 13.0 34 20.0 35 25.5 36 31.0 37 45.5 38 59.0 39 78.5 40 111.5 41 140.0 42 164.5 43 192.0 44 212.5 45 213.5 46 208.0 47 204.0 48 188.5 49 182.5 50 171.0 51 155.0 52 145.5 53 130.5 54 112.5 55 106.0 56 108.0 57 100.0 58 93.5 59 92.5 60 79.5 61 71.5 62 71.5 63 63.0 64 62.0 65 54.5 66 45.0 67 35.0 68 29.5 69 34.5 70 28.5 71 23.0 72 20.5 73 14.5 74 13.0 75 10.0 76 4.5 77 4.0 78 4.0 79 1.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21776431995963 98.3 2 0.7065354529396921 1.4000000000000001 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025233409033560434 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0125 0.0 86-87 0.075 0.0 0.0 0.025 0.0 88-89 0.075 0.0 0.0 0.025 0.0 90-91 0.075 0.0 0.0 0.025 0.0 92-93 0.1 0.0 0.0 0.025 0.0 94-95 0.125 0.0 0.0 0.025 0.0 96-97 0.1375 0.0 0.0 0.025 0.0 98-99 0.15 0.0 0.0 0.025 0.0 100-101 0.15 0.0 0.0 0.025 0.0 102-103 0.16249999999999998 0.0 0.0 0.025 0.0 104-105 0.225 0.0 0.0 0.025 0.0 106-107 0.2875 0.0 0.0 0.025 0.0 108-109 0.35 0.0 0.0 0.025 0.0 110-111 0.44999999999999996 0.0 0.0 0.025 0.0 112-113 0.4875 0.0 0.0 0.025 0.0 114-115 0.5625 0.0 0.0 0.025 0.0 116-117 0.675 0.0 0.0 0.025 0.0 118-119 0.725 0.0 0.0 0.025 0.025 120-121 0.8125 0.0 0.0 0.025 0.025 122-123 1.025 0.0 0.0 0.025 0.025 124-125 1.1875 0.0 0.0 0.025 0.025 126-127 1.2875 0.0 0.0 0.025 0.025 128-129 1.6875 0.0 0.0 0.025 0.025 130-131 1.9375 0.0 0.0 0.025 0.025 132-133 2.1625 0.0 0.0 0.025 0.025 134-135 2.5250000000000004 0.0 0.0 0.025 0.025 136-137 2.7249999999999996 0.0 0.0 0.025 0.025 138-139 2.9125 0.0 0.0 0.025 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATCTG 10 0.0068396386 144.9375 9 >>END_MODULE SRR6958265 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958265_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.037 33.0 33.0 34.0 30.0 34.0 2 32.00775 33.0 33.0 34.0 28.0 34.0 3 32.0585 33.0 33.0 34.0 28.0 34.0 4 31.98625 33.0 33.0 34.0 30.0 34.0 5 31.9345 33.0 33.0 34.0 30.0 34.0 6 35.88475 38.0 38.0 38.0 31.0 38.0 7 35.18875 38.0 37.0 38.0 28.0 38.0 8 36.06225 38.0 38.0 38.0 31.0 38.0 9 35.9165 38.0 38.0 38.0 31.0 38.0 10-14 35.951449999999994 38.0 38.0 38.0 31.8 38.0 15-19 36.1644 38.0 38.0 38.0 33.4 38.0 20-24 36.14585 38.0 38.0 38.0 33.2 38.0 25-29 36.223749999999995 38.0 38.0 38.0 34.0 38.0 30-34 36.2068 38.0 38.0 38.0 33.8 38.0 35-39 36.036150000000006 38.0 38.0 38.0 33.0 38.0 40-44 35.8787 38.0 38.0 38.0 32.4 38.0 45-49 35.7806 38.0 37.8 38.0 31.4 38.0 50-54 35.8998 38.0 38.0 38.0 32.6 38.0 55-59 35.683 38.0 37.4 38.0 31.0 38.0 60-64 35.52195 38.0 37.0 38.0 30.0 38.0 65-69 35.5193 38.0 37.0 38.0 29.8 38.0 70-74 35.37295 38.0 36.8 38.0 29.4 38.0 75-79 35.26795 38.0 37.0 38.0 28.8 38.0 80-84 35.2663 38.0 37.0 38.0 29.0 38.0 85-89 35.3238 38.0 37.0 38.0 29.8 38.0 90-94 34.845349999999996 38.0 36.2 38.0 27.4 38.0 95-99 34.39084999999999 38.0 35.2 38.0 24.6 38.0 100-104 33.96835 38.0 34.6 38.0 21.0 38.0 105-109 33.7838 38.0 34.6 38.0 19.0 38.0 110-114 33.404700000000005 38.0 34.0 38.0 17.4 38.0 115-119 33.40075 38.0 34.0 38.0 16.2 38.0 120-124 33.271249999999995 38.0 34.0 38.0 17.4 38.0 125-129 32.7055 38.0 33.2 38.0 14.8 38.0 130-134 32.0514 37.6 32.0 38.0 14.0 38.0 135-139 31.43195 36.6 31.4 38.0 13.2 38.0 140-144 30.686500000000002 36.0 30.4 38.0 12.6 38.0 145-149 29.2327 35.8 27.6 38.0 2.0 38.0 150-151 23.7605 31.0 11.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 13.0 4 3.0 5 2.0 6 4.0 7 3.0 8 3.0 9 0.0 10 4.0 11 7.0 12 5.0 13 7.0 14 8.0 15 8.0 16 12.0 17 13.0 18 14.0 19 10.0 20 12.0 21 15.0 22 14.0 23 28.0 24 41.0 25 28.0 26 37.0 27 49.0 28 57.0 29 81.0 30 70.0 31 119.0 32 144.0 33 162.0 34 248.0 35 429.0 36 883.0 37 1438.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.5 19.1 10.775 28.625 2 29.175 21.3 26.700000000000003 22.825 3 23.125 26.275 26.6 24.0 4 26.724999999999998 30.95 20.599999999999998 21.725 5 26.8 32.725 19.575 20.9 6 24.006001500375092 34.25856464116029 19.904976244061015 21.8304576144036 7 21.255313828457115 20.78019504876219 33.25831457864466 24.706176544136035 8 24.33108277069267 23.355838959739934 23.330832708177045 28.982245561390346 9 24.33108277069267 21.880470117529384 26.806701675418854 26.981745436359088 10-14 25.481370342585645 25.911477869467365 23.13078269567392 25.476369092273067 15-19 25.46636659164791 25.381345336334082 24.316079019754937 24.836209052263065 20-24 25.67141785446362 25.191297824456115 23.925981495373843 25.211302825706426 25-29 26.131532883220803 25.216304076019004 24.01100275068767 24.641160290072516 30-34 25.936484121030258 25.021255313828455 24.326081520380093 24.71617904476119 35-39 26.151537884471114 25.036259064766192 24.316079019754937 24.496124031007753 40-44 25.966491622905725 25.20130032508127 23.550887721930483 25.28132033008252 45-49 26.336584146036508 25.461365341335334 23.905976494123532 24.296074018504626 50-54 25.571392848212053 25.076269067266814 24.456114028507127 24.896224056014006 55-59 25.751437859464865 25.34133533383346 23.91097774443611 24.996249062265566 60-64 26.486621655413856 24.74118529632408 24.511127781945486 24.261065266316578 65-69 25.786446611652913 25.386346586646663 23.675918979744935 25.15128782195549 70-74 26.76669167291823 24.98624656164041 23.835958989747436 24.411102775693923 75-79 25.626406601650416 25.401350337584393 24.31107776944236 24.66116529132283 80-84 26.296574143535885 25.786446611652913 23.735933983495876 24.18104526131533 85-89 26.056514128532132 24.846211552888224 24.58614653663416 24.511127781945486 90-94 26.55163790947737 24.846211552888224 24.31107776944236 24.29107276819205 95-99 25.9964991247812 25.08627156789197 24.59114778694674 24.326081520380093 100-104 26.18154538634659 25.06626656664166 24.246061515378845 24.50612653163291 105-109 26.226556639159792 24.756189047261813 24.656164041010253 24.36109027256814 110-114 26.536634158539634 25.621405351337835 24.441110277569393 23.400850212553138 115-119 26.426606651662915 25.14628657164291 24.346086521630408 24.081020255063766 120-124 26.411602900725185 25.191297824456115 24.06101525381345 24.336084021005252 125-129 26.916729182295573 25.386346586646663 23.68592148037009 24.01100275068767 130-134 26.70667666916729 25.261315328832207 24.066016504126033 23.96599149787447 135-139 26.36659164791198 25.34133533383346 24.511127781945486 23.78094523630908 140-144 26.556639159789945 25.076269067266814 24.511127781945486 23.85596399099775 145-149 27.11177794448612 25.26631657914479 24.20605151287822 23.415853963490875 150-151 26.831707926981746 26.081520380095025 23.78094523630908 23.305826456614152 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 0.5 27 1.0 28 1.0 29 0.5 30 2.5 31 3.0 32 6.5 33 15.5 34 18.0 35 26.5 36 38.0 37 42.0 38 58.5 39 97.5 40 118.5 41 131.5 42 145.0 43 158.0 44 184.0 45 196.0 46 194.0 47 186.0 48 177.0 49 171.0 50 165.5 51 145.5 52 130.0 53 130.0 54 119.5 55 105.0 56 92.0 57 88.0 58 93.5 59 95.0 60 101.0 61 97.5 62 88.0 63 79.5 64 76.0 65 73.0 66 53.5 67 42.5 68 41.0 69 44.0 70 45.0 71 32.5 72 24.5 73 22.0 74 16.0 75 11.0 76 6.0 77 1.0 78 2.0 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.025 25-29 0.025 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.025 50-54 0.025 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.025 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.025 95-99 0.025 100-104 0.025 105-109 0.025 110-114 0.025 115-119 0.025 120-124 0.025 125-129 0.025 130-134 0.025 135-139 0.025 140-144 0.025 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98682877406281 97.7 2 0.8105369807497468 1.6 3 0.1519756838905775 0.44999999999999996 4 0.025329280648429587 0.1 5 0.0 0.0 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1875 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.6375 0.0 0.0 0.0 0.0 130-131 1.8875 0.0 0.0 0.0 0.0 132-133 2.1125 0.0 0.0 0.0 0.0 134-135 2.4749999999999996 0.0 0.0 0.0 0.0 136-137 2.6500000000000004 0.0 0.0 0.0 0.0 138-139 2.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATTAC 10 0.006830828 145.0 1 >>END_MODULE Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046767 spots for SRR6958265.sra Written 1046767 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra Read 1046758 spots for SRR6958265.sra Written 1046758 spots for SRR6958265.sra SRR ids: ['SRR6958265.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nlx3v5gc SRR6958265.sra spots: 20935169 blocks: [[1, 1046758], [1046759, 2093516], [2093517, 3140274], [3140275, 4187032], [4187033, 5233790], [5233791, 6280548], [6280549, 7327306], [7327307, 8374064], [8374065, 9420822], [9420823, 10467580], [10467581, 11514338], [11514339, 12561096], [12561097, 13607854], [13607855, 14654612], [14654613, 15701370], [15701371, 16748128], [16748129, 17794886], [17794887, 18841644], [18841645, 19888402], [19888403, 20935169]] SRR6958265 file size 7072541 SRR6958265 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958265 SRR6958265_1.fastq SRR6958265_2.fastq Input file: SRR6958265_1.fastq Paired file: SRR6958265_2.fastq trimmed: SRR6958265-trimmed-pair1.fastq, SRR6958265-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:10:38 2024 >> started Fri Dec 6 18:11:02 2024 >> done (23.567s) 20935169 read pairs processed; of these: 56878 ( 0.27%) short read pairs filtered out after trimming by size control 43363 ( 0.21%) empty read pairs filtered out after trimming by size control 20834928 (99.52%) read pairs available; of these: 9030473 (43.34%) trimmed read pairs available after processing 11804455 (56.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 4 0.00% 21 3 0.00% 22 4 0.00% 23 3 0.00% 24 4 0.00% 25 7 0.00% 26 9 0.00% 27 6 0.00% 28 12 0.00% 29 8 0.00% 30 7 0.00% 31 10 0.00% 32 10 0.00% 33 7 0.00% 34 11 0.00% 35 9 0.00% 36 15 0.00% 37 8 0.00% 38 13 0.00% 39 8 0.00% 40 19 0.00% 41 14 0.00% 42 23 0.00% 43 26 0.00% 44 22 0.00% 45 30 0.00% 46 30 0.00% 47 33 0.00% 48 34 0.00% 49 48 0.00% 50 48 0.00% 51 46 0.00% 52 58 0.00% 53 69 0.00% 54 74 0.00% 55 86 0.00% 56 74 0.00% 57 106 0.00% 58 97 0.00% 59 139 0.00% 60 149 0.00% 61 176 0.00% 62 165 0.00% 63 185 0.00% 64 195 0.00% 65 239 0.00% 66 230 0.00% 67 284 0.00% 68 325 0.00% 69 299 0.00% 70 363 0.00% 71 403 0.00% 72 461 0.00% 73 516 0.00% 74 567 0.00% 75 637 0.00% 76 656 0.00% 77 788 0.00% 78 883 0.00% 79 969 0.00% 80 1133 0.01% 81 1194 0.01% 82 1568 0.01% 83 1858 0.01% 84 4131 0.02% 85 5151 0.02% 86 4708 0.02% 87 4974 0.02% 88 4816 0.02% 89 4665 0.02% 90 4941 0.02% 91 5518 0.03% 92 5319 0.03% 93 5561 0.03% 94 5863 0.03% 95 6329 0.03% 96 6557 0.03% 97 6819 0.03% 98 7268 0.03% 99 7931 0.04% 100 7967 0.04% 101 8732 0.04% 102 9452 0.05% 103 9946 0.05% 104 10445 0.05% 105 10978 0.05% 106 11724 0.06% 107 12181 0.06% 108 13060 0.06% 109 13859 0.07% 110 14322 0.07% 111 15366 0.07% 112 16631 0.08% 113 17630 0.08% 114 18610 0.09% 115 19929 0.10% 116 21281 0.10% 117 22200 0.11% 118 23086 0.11% 119 24373 0.12% 120 25772 0.12% 121 26648 0.13% 122 27998 0.13% 123 29902 0.14% 124 32063 0.15% 125 34021 0.16% 126 36147 0.17% 127 38146 0.18% 128 40042 0.19% 129 42691 0.20% 130 44758 0.21% 131 46975 0.23% 132 50903 0.24% 133 54017 0.26% 134 57066 0.27% 135 60870 0.29% 136 65066 0.31% 137 69629 0.33% 138 75740 0.36% 139 82077 0.39% 140 89544 0.43% 141 98427 0.47% 142 111607 0.54% 143 124948 0.60% 144 145844 0.70% 145 177867 0.85% 146 227098 1.09% 147 311660 1.50% 148 480643 2.31% 149 973180 4.67% 150 4941317 23.72% 151 11804455 56.66% 20834928 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=21 prefix-density=0.84 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=43.65 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=20 prefix-density=0.58 prefix-fanout=2.9 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=52.00 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.0 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958265 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:11:46 Started mapping on | Dec 06 18:11:46 Finished on | Dec 06 18:13:59 Mapping speed, Million of reads per hour | 563.95 Number of input reads | 20834928 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20244614 Uniquely mapped reads % | 97.17% Average mapped length | 296.45 Number of splices: Total | 23646038 Number of splices: Annotated (sjdb) | 22260977 Number of splices: GT/AG | 23334375 Number of splices: GC/AG | 275391 Number of splices: AT/AC | 8981 Number of splices: Non-canonical | 27291 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.57 Insertion rate per base | 0.01% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 166356 % of reads mapped to multiple loci | 0.80% Number of reads mapped to too many loci | 10809 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.64% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 454971 454971 454971 N_multimapping 166356 166356 166356 N_noFeature 525620 19713630 655102 N_ambiguous 477885 2694 77286 UnstrandedReadsAssigned:19241109 PositiveStrandReadsAssigned:528290 NegativeStrandReadsAssigned:19512226 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958265 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958265-trimmed-pair1.fastq SRR6958265-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,834,928 reads, 19,525,160 reads pseudoaligned [quant] estimated average fragment length: 273.303 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52973 SRR6958265.ke.tsv 35125 SRR6958265.se.tsv 88098 total ==> SRR6958265.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.212 0.00107151 0.000121126 PNS24247 1044 771.697 73.033 7.10589 PNS24249 1928 1655.7 63.1826 2.86525 PNS24246 1044 771.697 73.033 7.10589 PNS24248 1044 771.697 73.033 7.10589 PNS24244 1471 1198.7 26.7174 1.67352 PNS24243 293 79.2166 0 0 KQK14069 1603 1330.7 4378.36 247.046 KQK14071 474 218.155 30.2899 10.4251 ==> SRR6958265.se.tsv <== BRADI_1g14170v3 4695 BRADI_1g53295v3 116 BRADI_1g59795v3 235 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 253 BRADI_1g74790v3 87 BRADI_1g09890v3 0 BRADI_1g77505v3 230 BRADI_1g48960v3 0 SRR6958265 completed mapping pipeline successfully