Starting /dee2/code/volunteer_pipeline.sh SRR6958266 current disk space = 1550649196544 free memory = 1595321676 SRR6958266 SRAfilesize 221d9b6cd8b95b9894e8e01f0a58cac6 SRR6958266.sra SRR6958266.sra file validated SRR6958266 is paired end SRR6958266 is conventional basespace SRR6958266 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958266_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.82075 33.0 32.0 33.0 2.0 34.0 2 31.0665 33.0 30.0 33.0 27.0 34.0 3 31.5155 33.0 31.0 33.0 27.0 34.0 4 30.85625 32.0 31.0 33.0 28.0 33.0 5 31.74125 33.0 32.0 33.0 30.0 33.0 6 31.08475 35.0 28.0 37.0 16.0 38.0 7 35.37825 37.0 34.0 38.0 30.0 38.0 8 36.77225 38.0 37.0 38.0 34.0 38.0 9 37.27975 38.0 38.0 38.0 36.0 38.0 10-14 37.34905 38.0 38.0 38.0 37.0 38.0 15-19 37.407 38.0 38.0 38.0 37.0 38.0 20-24 37.322 38.0 38.0 38.0 37.2 38.0 25-29 37.1154 38.0 38.0 38.0 36.4 38.0 30-34 37.03535 38.0 38.0 38.0 35.6 38.0 35-39 37.1092 38.0 38.0 38.0 36.0 38.0 40-44 37.44734999999999 38.0 38.0 38.0 37.4 38.0 45-49 37.3896 38.0 38.0 38.0 37.0 38.0 50-54 37.171549999999996 38.0 38.0 38.0 36.6 38.0 55-59 37.15645 38.0 38.0 38.0 36.4 38.0 60-64 37.342949999999995 38.0 38.0 38.0 37.0 38.0 65-69 36.61895 38.0 37.4 38.0 33.8 38.0 70-74 37.2078 38.0 38.0 38.0 36.4 38.0 75-79 37.1983 38.0 38.0 38.0 36.4 38.0 80-84 37.173950000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.8929 38.0 38.0 38.0 35.4 38.0 90-94 36.299400000000006 38.0 37.8 38.0 33.4 38.0 95-99 34.427800000000005 38.0 34.2 38.0 23.0 38.0 100-104 35.743900000000004 38.0 37.0 38.0 30.8 38.0 105-109 35.5965 38.0 36.8 38.0 30.2 38.0 110-114 35.75410000000001 38.0 37.0 38.0 30.8 38.0 115-119 36.248949999999994 38.0 37.6 38.0 33.6 38.0 120-124 36.402750000000005 38.0 38.0 38.0 34.0 38.0 125-129 36.3279 38.0 38.0 38.0 34.0 38.0 130-134 36.1493 38.0 37.4 38.0 33.2 38.0 135-139 35.615899999999996 38.0 36.0 38.0 31.4 38.0 140-144 35.23625 38.0 36.0 38.0 30.4 38.0 145-149 32.060050000000004 37.0 28.4 38.0 20.0 38.0 150-151 29.15625 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.0 20 0.0 21 2.0 22 2.0 23 7.0 24 7.0 25 11.0 26 18.0 27 17.0 28 38.0 29 36.0 30 56.0 31 74.0 32 87.0 33 138.0 34 181.0 35 330.0 36 871.0 37 2119.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.600896860986545 9.641255605381167 9.108744394618833 38.649103139013455 2 26.75 12.75 32.725 27.775 3 23.425 17.45 24.925 34.2 4 26.375 25.55 22.375 25.7 5 26.200000000000003 27.150000000000002 24.975 21.675 6 23.724999999999998 32.2 24.075 20.0 7 17.025000000000002 22.775000000000002 40.65 19.55 8 21.025 23.95 28.849999999999998 26.174999999999997 9 19.45 22.125 33.125 25.3 10-14 22.685 26.284999999999997 26.865 24.165 15-19 22.875 25.44 26.185000000000002 25.5 20-24 22.1 26.245 26.525 25.130000000000003 25-29 22.685 25.374999999999996 26.715 25.224999999999998 30-34 23.335 25.94 26.174999999999997 24.55 35-39 22.830000000000002 25.629999999999995 25.945 25.595000000000002 40-44 22.720000000000002 25.869999999999997 25.855 25.555 45-49 23.205000000000002 25.474999999999998 25.72 25.6 50-54 22.615 25.96 26.240000000000002 25.185000000000002 55-59 22.994999999999997 25.990000000000002 25.480000000000004 25.535000000000004 60-64 22.435 25.665 26.279999999999998 25.619999999999997 65-69 23.095 25.455 25.81 25.64 70-74 22.97 25.89 25.724999999999998 25.415 75-79 23.015 25.180000000000003 26.295 25.509999999999998 80-84 22.585 25.97 26.155 25.290000000000003 85-89 22.900000000000002 25.064999999999998 26.174999999999997 25.86 90-94 22.96 25.650000000000002 26.16 25.230000000000004 95-99 23.11 25.085 26.6 25.205 100-104 23.47 25.495 25.569999999999997 25.465 105-109 23.799999999999997 25.729999999999997 25.495 24.975 110-114 23.155 25.34 25.96 25.545 115-119 23.665 25.669999999999998 26.075 24.59 120-124 23.265 25.445 25.935000000000002 25.355 125-129 23.185 25.94 25.22 25.655 130-134 23.294999999999998 25.245 26.075 25.385 135-139 23.415 25.44 25.55 25.595000000000002 140-144 23.665 25.619999999999997 25.095 25.619999999999997 145-149 23.315 25.83 25.174999999999997 25.679999999999996 150-151 23.425 25.35 26.4625 24.762500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 2.0 29 6.5 30 9.0 31 12.5 32 14.0 33 17.5 34 29.0 35 44.5 36 60.5 37 67.5 38 82.0 39 105.5 40 124.5 41 149.0 42 171.0 43 213.5 44 243.0 45 241.0 46 229.5 47 197.0 48 188.0 49 183.0 50 163.5 51 153.5 52 137.0 53 113.0 54 99.5 55 87.5 56 83.5 57 85.0 58 72.5 59 65.5 60 71.0 61 64.5 62 61.5 63 54.0 64 43.5 65 45.5 66 41.5 67 33.0 68 23.0 69 24.0 70 24.5 71 17.0 72 15.0 73 11.0 74 7.5 75 6.0 76 2.5 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21875 98.425 2 0.7560483870967742 1.5 3 0.025201612903225805 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.0375 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.5250000000000004 0.0 0.0 0.0 0.0 130-131 3.7125 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.425 0.0 0.0 0.0 0.0 136-137 4.762499999999999 0.0 0.0 0.0 0.0 138-139 5.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTGGCA 10 0.0068449317 144.90001 2 GTGGCAA 10 0.0068449317 144.90001 3 >>END_MODULE SRR6958266 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958266_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.897 33.0 33.0 34.0 32.0 34.0 2 33.08775 34.0 33.0 34.0 32.0 34.0 3 33.051 34.0 33.0 34.0 32.0 34.0 4 32.82825 34.0 33.0 34.0 32.0 34.0 5 33.02375 34.0 33.0 34.0 32.0 34.0 6 37.14175 38.0 38.0 38.0 37.0 38.0 7 37.1415 38.0 38.0 38.0 37.0 38.0 8 36.96175 38.0 38.0 38.0 36.0 38.0 9 37.0345 38.0 38.0 38.0 36.0 38.0 10-14 36.8913 38.0 38.0 38.0 36.2 38.0 15-19 36.497299999999996 38.0 38.0 38.0 34.2 38.0 20-24 36.72995000000001 38.0 38.0 38.0 35.2 38.0 25-29 36.941950000000006 38.0 38.0 38.0 36.4 38.0 30-34 37.1109 38.0 38.0 38.0 36.8 38.0 35-39 37.2036 38.0 38.0 38.0 37.0 38.0 40-44 35.30325 37.8 35.2 38.0 29.8 38.0 45-49 36.783 38.0 38.0 38.0 35.4 38.0 50-54 36.368849999999995 38.0 38.0 38.0 34.2 38.0 55-59 36.6541 38.0 38.0 38.0 35.0 38.0 60-64 36.6145 38.0 38.0 38.0 35.0 38.0 65-69 36.612249999999996 38.0 38.0 38.0 34.6 38.0 70-74 36.3008 38.0 38.0 38.0 33.8 38.0 75-79 36.062999999999995 38.0 38.0 38.0 32.8 38.0 80-84 36.10125000000001 38.0 38.0 38.0 32.4 38.0 85-89 35.89405000000001 38.0 37.8 38.0 31.8 38.0 90-94 36.243 38.0 38.0 38.0 33.6 38.0 95-99 36.4063 38.0 38.0 38.0 34.0 38.0 100-104 36.28495 38.0 38.0 38.0 34.0 38.0 105-109 36.23375 38.0 38.0 38.0 33.8 38.0 110-114 35.97325 38.0 37.8 38.0 33.0 38.0 115-119 35.53745000000001 38.0 36.8 38.0 30.6 38.0 120-124 34.610400000000006 38.0 35.4 38.0 24.4 38.0 125-129 32.9405 37.2 30.6 38.0 20.6 38.0 130-134 30.87095 35.2 26.2 38.0 18.4 38.0 135-139 34.60705 38.0 35.0 38.0 27.4 38.0 140-144 34.19655 38.0 34.4 38.0 25.2 38.0 145-149 34.0683 38.0 35.4 38.0 26.2 38.0 150-151 29.023 35.5 25.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 1.0 5 0.0 6 1.0 7 0.0 8 3.0 9 1.0 10 0.0 11 0.0 12 2.0 13 3.0 14 1.0 15 2.0 16 3.0 17 3.0 18 6.0 19 6.0 20 8.0 21 10.0 22 9.0 23 15.0 24 20.0 25 22.0 26 32.0 27 39.0 28 33.0 29 46.0 30 58.0 31 85.0 32 102.0 33 118.0 34 161.0 35 314.0 36 841.0 37 2045.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.9 19.425 12.4 33.275 2 30.349999999999998 23.95 25.874999999999996 19.825 3 21.65 27.325 27.925 23.1 4 25.074999999999996 30.425 21.8 22.7 5 27.400000000000002 33.324999999999996 19.45 19.825 6 23.724999999999998 34.949999999999996 21.375 19.950000000000003 7 23.625 19.3 35.099999999999994 21.975 8 24.55 23.875 23.599999999999998 27.975 9 24.224999999999998 22.6 27.825 25.35 10-14 25.555 26.21 23.9 24.335 15-19 24.990000000000002 25.674999999999997 24.995 24.34 20-24 25.635 26.235000000000003 24.595 23.535 25-29 25.165 25.695 24.990000000000002 24.15 30-34 25.319999999999997 25.91 24.525 24.245 35-39 25.595000000000002 25.88 24.135 24.39 40-44 25.105 25.290000000000003 24.925 24.68 45-49 25.230000000000004 25.44 25.055 24.275 50-54 25.515 26.0 24.545 23.94 55-59 25.685000000000002 25.740000000000002 24.75 23.825 60-64 25.11 25.685000000000002 25.130000000000003 24.075 65-69 25.515 25.805 25.15 23.53 70-74 26.02 25.224999999999998 24.81 23.945 75-79 25.324999999999996 25.645 25.285000000000004 23.745 80-84 25.740000000000002 25.990000000000002 24.990000000000002 23.28 85-89 24.85 26.58 24.240000000000002 24.33 90-94 25.82 25.615 25.130000000000003 23.435 95-99 25.295 25.924999999999997 25.119999999999997 23.66 100-104 25.319999999999997 25.215 25.645 23.82 105-109 25.729999999999997 25.81 24.895 23.565 110-114 25.56 26.1 24.97 23.369999999999997 115-119 26.5 25.740000000000002 24.585 23.175 120-124 25.419999999999998 26.695 24.46 23.425 125-129 26.36 26.05 24.88 22.71 130-134 26.22 25.915 25.06 22.805 135-139 26.08 26.169999999999998 25.040000000000003 22.71 140-144 26.345000000000002 26.450000000000003 24.529999999999998 22.675 145-149 26.125 26.435 24.615000000000002 22.825 150-151 25.837500000000002 27.1375 23.875 23.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 1.0 26 1.5 27 3.0 28 5.0 29 6.0 30 8.0 31 11.5 32 10.5 33 14.0 34 22.0 35 32.0 36 48.5 37 57.5 38 70.0 39 98.5 40 129.5 41 154.0 42 170.5 43 183.0 44 192.5 45 197.0 46 190.0 47 194.5 48 196.0 49 168.5 50 159.0 51 155.5 52 136.0 53 127.0 54 112.5 55 104.5 56 104.5 57 101.0 58 94.0 59 84.5 60 71.5 61 65.0 62 72.0 63 64.0 64 62.0 65 53.0 66 40.5 67 50.0 68 45.5 69 31.0 70 24.5 71 21.0 72 19.0 73 14.5 74 7.5 75 4.0 76 4.5 77 3.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.73096446700508 97.25 2 1.0913705583756346 2.15 3 0.10152284263959391 0.3 4 0.07614213197969542 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.8624999999999998 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.5625 0.0 0.0 0.0 0.0 124-125 2.7125 0.0 0.0 0.0 0.0 126-127 2.9000000000000004 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.2875 0.0 0.0 0.0 0.0 132-133 3.6125 0.0 0.0 0.0 0.0 134-135 3.9375 0.0 0.0 0.0 0.0 136-137 4.262499999999999 0.0 0.0 0.0 0.0 138-139 4.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTATTG 10 0.006830828 145.0 5 GTGGGAA 10 0.006830828 145.0 7 >>END_MODULE Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125628 spots for SRR6958266.sra Written 1125628 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra Read 1125610 spots for SRR6958266.sra Written 1125610 spots for SRR6958266.sra SRR ids: ['SRR6958266.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a05bum56 SRR6958266.sra spots: 22512218 blocks: [[1, 1125610], [1125611, 2251220], [2251221, 3376830], [3376831, 4502440], [4502441, 5628050], [5628051, 6753660], [6753661, 7879270], [7879271, 9004880], [9004881, 10130490], [10130491, 11256100], [11256101, 12381710], [12381711, 13507320], [13507321, 14632930], [14632931, 15758540], [15758541, 16884150], [16884151, 18009760], [18009761, 19135370], [19135371, 20260980], [20260981, 21386590], [21386591, 22512218]] SRR6958266 file size 7606951 SRR6958266 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958266 SRR6958266_1.fastq SRR6958266_2.fastq Input file: SRR6958266_1.fastq Paired file: SRR6958266_2.fastq trimmed: SRR6958266-trimmed-pair1.fastq, SRR6958266-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:12:06 2024 >> started Fri Dec 6 18:12:28 2024 >> done (21.920s) 22512218 read pairs processed; of these: 16159 ( 0.07%) short read pairs filtered out after trimming by size control 14204 ( 0.06%) empty read pairs filtered out after trimming by size control 22481855 (99.87%) read pairs available; of these: 7792931 (34.66%) trimmed read pairs available after processing 14688924 (65.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 3 0.00% 21 9 0.00% 22 3 0.00% 23 7 0.00% 24 8 0.00% 25 8 0.00% 26 9 0.00% 27 4 0.00% 28 8 0.00% 29 13 0.00% 30 10 0.00% 31 11 0.00% 32 12 0.00% 33 9 0.00% 34 12 0.00% 35 18 0.00% 36 20 0.00% 37 20 0.00% 38 20 0.00% 39 20 0.00% 40 15 0.00% 41 22 0.00% 42 21 0.00% 43 23 0.00% 44 15 0.00% 45 27 0.00% 46 37 0.00% 47 40 0.00% 48 34 0.00% 49 56 0.00% 50 60 0.00% 51 66 0.00% 52 70 0.00% 53 67 0.00% 54 85 0.00% 55 101 0.00% 56 115 0.00% 57 90 0.00% 58 141 0.00% 59 157 0.00% 60 183 0.00% 61 246 0.00% 62 267 0.00% 63 273 0.00% 64 311 0.00% 65 335 0.00% 66 381 0.00% 67 426 0.00% 68 433 0.00% 69 490 0.00% 70 648 0.00% 71 752 0.00% 72 910 0.00% 73 1106 0.00% 74 1150 0.01% 75 1186 0.01% 76 1364 0.01% 77 1500 0.01% 78 1708 0.01% 79 1905 0.01% 80 2189 0.01% 81 2550 0.01% 82 2842 0.01% 83 3270 0.01% 84 4230 0.02% 85 5022 0.02% 86 5344 0.02% 87 5679 0.03% 88 6041 0.03% 89 6248 0.03% 90 6748 0.03% 91 7364 0.03% 92 8188 0.04% 93 8572 0.04% 94 9409 0.04% 95 9973 0.04% 96 10468 0.05% 97 11125 0.05% 98 11331 0.05% 99 12259 0.05% 100 12643 0.06% 101 13602 0.06% 102 14439 0.06% 103 15887 0.07% 104 16688 0.07% 105 17559 0.08% 106 18466 0.08% 107 19200 0.09% 108 19799 0.09% 109 20645 0.09% 110 21223 0.09% 111 22495 0.10% 112 23975 0.11% 113 25335 0.11% 114 26720 0.12% 115 28130 0.13% 116 29517 0.13% 117 30101 0.13% 118 31042 0.14% 119 31832 0.14% 120 33110 0.15% 121 34330 0.15% 122 35883 0.16% 123 38238 0.17% 124 40155 0.18% 125 41683 0.19% 126 43059 0.19% 127 44862 0.20% 128 46004 0.20% 129 46931 0.21% 130 48713 0.22% 131 50414 0.22% 132 53152 0.24% 133 56026 0.25% 134 58685 0.26% 135 62082 0.28% 136 64680 0.29% 137 67969 0.30% 138 71365 0.32% 139 75765 0.34% 140 78963 0.35% 141 85824 0.38% 142 93358 0.42% 143 103862 0.46% 144 116725 0.52% 145 136247 0.61% 146 164521 0.73% 147 213535 0.95% 148 315048 1.40% 149 618110 2.75% 150 4258433 18.94% 151 14688924 65.34% 22481855 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=22 prefix-density=0.89 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=53.72 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=17 prefix-density=0.60 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=65.58 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.4 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958266 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:13:16 Started mapping on | Dec 06 18:13:17 Finished on | Dec 06 18:15:34 Mapping speed, Million of reads per hour | 590.76 Number of input reads | 22481855 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21794242 Uniquely mapped reads % | 96.94% Average mapped length | 296.17 Number of splices: Total | 25887569 Number of splices: Annotated (sjdb) | 24384069 Number of splices: GT/AG | 25545801 Number of splices: GC/AG | 302543 Number of splices: AT/AC | 10107 Number of splices: Non-canonical | 29118 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.47 Insertion rate per base | 0.01% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 197360 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 14680 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.73% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 501156 501156 501156 N_multimapping 197360 197360 197360 N_noFeature 719808 21168157 894209 N_ambiguous 538127 3121 88208 UnstrandedReadsAssigned:20536307 PositiveStrandReadsAssigned:622964 NegativeStrandReadsAssigned:20811825 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958266 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958266-trimmed-pair1.fastq SRR6958266-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,481,855 reads, 20,832,312 reads pseudoaligned [quant] estimated average fragment length: 266.604 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR6958266.ke.tsv 35125 SRR6958266.se.tsv 88098 total ==> SRR6958266.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.939 0 0 PNS24247 1044 778.396 57.4375 5.3385 PNS24249 1928 1662.4 32.3655 1.40855 PNS24246 1044 778.396 57.4375 5.3385 PNS24248 1044 778.396 57.4375 5.3385 PNS24244 1471 1205.4 34.3221 2.06001 PNS24243 293 88.4285 0 0 KQK14069 1603 1337.4 3247.65 175.685 KQK14071 474 227.251 59.8578 19.0564 ==> SRR6958266.se.tsv <== BRADI_1g14170v3 3824 BRADI_1g53295v3 341 BRADI_1g59795v3 297 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 291 BRADI_1g74790v3 91 BRADI_1g09890v3 1 BRADI_1g77505v3 278 BRADI_1g48960v3 0 SRR6958266 completed mapping pipeline successfully