Starting /dee2/code/volunteer_pipeline.sh SRR6958267 current disk space = 1550638243840 free memory = 1327538832 SRR6958267 SRAfilesize 6961d19b9de5642fb528a8fb4d20685f SRR6958267.sra SRR6958267.sra file validated SRR6958267 is paired end SRR6958267 is conventional basespace SRR6958267 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958267_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.9525 25.0 18.0 33.0 18.0 33.0 2 24.7845 25.0 18.0 29.0 18.0 33.0 3 28.3445 29.0 27.0 31.0 25.0 33.0 4 31.03425 31.0 30.0 33.0 29.0 33.0 5 32.5545 33.0 33.0 33.0 32.0 33.0 6 35.65475 37.0 35.0 38.0 31.0 38.0 7 37.00275 38.0 37.0 38.0 35.0 38.0 8 36.649 38.0 37.0 38.0 34.0 38.0 9 37.23125 38.0 38.0 38.0 36.0 38.0 10-14 37.53660000000001 38.0 38.0 38.0 37.2 38.0 15-19 37.497550000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.477799999999995 38.0 38.0 38.0 37.2 38.0 25-29 37.56965 38.0 38.0 38.0 37.8 38.0 30-34 37.66805000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.61195 38.0 38.0 38.0 37.8 38.0 40-44 37.5449 38.0 38.0 38.0 37.8 38.0 45-49 37.436249999999994 38.0 38.0 38.0 37.4 38.0 50-54 37.25855 38.0 38.0 38.0 36.6 38.0 55-59 37.1322 38.0 38.0 38.0 36.0 38.0 60-64 37.11775 38.0 38.0 38.0 36.2 38.0 65-69 36.9758 38.0 38.0 38.0 35.4 38.0 70-74 37.197199999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.09895 38.0 38.0 38.0 36.2 38.0 80-84 37.06699999999999 38.0 38.0 38.0 36.0 38.0 85-89 37.085300000000004 38.0 38.0 38.0 36.0 38.0 90-94 37.038850000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.7929 38.0 38.0 38.0 34.6 38.0 100-104 36.6841 38.0 38.0 38.0 34.4 38.0 105-109 36.6361 38.0 37.8 38.0 34.2 38.0 110-114 36.38605 38.0 37.6 38.0 33.8 38.0 115-119 36.20975 38.0 37.0 38.0 33.6 38.0 120-124 36.015550000000005 38.0 36.8 38.0 32.6 38.0 125-129 35.79215 38.0 36.0 38.0 32.2 38.0 130-134 35.71255 38.0 36.0 38.0 31.8 38.0 135-139 35.23765 38.0 35.2 38.0 29.8 38.0 140-144 34.8519 38.0 34.6 38.0 28.2 38.0 145-149 33.993900000000004 38.0 33.4 38.0 24.6 38.0 150-151 29.761625000000002 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 4.0 20 1.0 21 2.0 22 0.0 23 3.0 24 6.0 25 4.0 26 12.0 27 12.0 28 18.0 29 15.0 30 29.0 31 39.0 32 74.0 33 113.0 34 170.0 35 365.0 36 1010.0 37 2120.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.796747967479675 8.99390243902439 7.240853658536585 33.96849593495935 2 27.763881940970485 11.455727863931967 35.64282141070535 25.137568784392194 3 22.2 17.224999999999998 25.0 35.575 4 24.9 26.25 21.775 27.075 5 24.9 32.7 23.0 19.400000000000002 6 21.275 33.875 24.425 20.424999999999997 7 16.8 25.0 40.8 17.4 8 20.474999999999998 25.124999999999996 30.625000000000004 23.775 9 18.875 23.425 35.3 22.400000000000002 10-14 22.115000000000002 28.455000000000002 26.424999999999997 23.005 15-19 22.400000000000002 27.534999999999997 27.205000000000002 22.86 20-24 22.32 27.38 27.034999999999997 23.265 25-29 22.35 27.685 27.005000000000003 22.96 30-34 21.86 27.474999999999998 27.46 23.205000000000002 35-39 22.305 27.625 26.525 23.544999999999998 40-44 22.05 28.015 26.5 23.435 45-49 22.29 27.305 27.139999999999997 23.265 50-54 21.845 27.07 28.035 23.05 55-59 21.915000000000003 27.169999999999998 27.500000000000004 23.415 60-64 22.111105555277764 27.251362568128407 27.12635631781589 23.51117555877794 65-69 21.905 27.55 26.625 23.919999999999998 70-74 22.220000000000002 27.560000000000002 26.505000000000003 23.715 75-79 21.67 27.339999999999996 26.995 23.995 80-84 21.435000000000002 27.975 26.55 24.04 85-89 21.88 26.82 27.67 23.630000000000003 90-94 21.935 26.87 27.105 24.09 95-99 22.25 27.105 26.93 23.715 100-104 21.935 26.705000000000002 27.685 23.674999999999997 105-109 22.205 27.305 27.084999999999997 23.405 110-114 22.900000000000002 27.279999999999998 26.955000000000002 22.865 115-119 23.16 27.875 26.400000000000002 22.564999999999998 120-124 21.990000000000002 27.779999999999998 26.39 23.84 125-129 22.615 27.529999999999998 26.16 23.695 130-134 21.84 28.050000000000004 26.06 24.05 135-139 21.560000000000002 27.339999999999996 26.245 24.855 140-144 21.54 26.740000000000002 26.605 25.115 145-149 21.8 27.33 26.540000000000003 24.33 150-151 21.512500000000003 27.275 26.2875 24.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 3.0 29 8.0 30 13.0 31 16.5 32 24.5 33 35.5 34 43.0 35 57.0 36 86.0 37 99.0 38 116.0 39 145.5 40 177.0 41 209.0 42 222.5 43 229.5 44 250.0 45 261.0 46 249.5 47 227.0 48 198.5 49 172.0 50 152.5 51 144.5 52 123.5 53 104.0 54 96.0 55 71.0 56 52.5 57 59.0 58 54.5 59 41.5 60 32.0 61 29.0 62 29.5 63 29.0 64 25.5 65 19.0 66 14.0 67 18.0 68 17.5 69 10.0 70 7.5 71 6.5 72 6.5 73 2.5 74 2.0 75 3.5 76 2.0 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.8250000000000002 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.5374999999999996 0.0 0.0 0.0 0.0 114-115 2.85 0.0 0.0 0.0 0.0 116-117 3.4 0.0 0.0 0.0 0.0 118-119 3.95 0.0 0.0 0.0 0.0 120-121 4.425 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.9375 0.0 0.0 0.0 0.0 126-127 6.775 0.0 0.0 0.0 0.0 128-129 7.4625 0.0 0.0 0.0 0.0 130-131 8.175 0.0 0.0 0.0 0.0 132-133 8.8375 0.0 0.0 0.0 0.0 134-135 9.4875 0.0 0.0 0.0 0.0 136-137 10.1375 0.0 0.0 0.0 0.0 138-139 10.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACTAGT 10 0.006830828 145.0 6 >>END_MODULE SRR6958267 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958267_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.19725 33.0 33.0 34.0 33.0 34.0 2 33.3415 34.0 33.0 34.0 33.0 34.0 3 33.39325 34.0 33.0 34.0 33.0 34.0 4 33.3715 34.0 33.0 34.0 33.0 34.0 5 33.4 34.0 33.0 34.0 33.0 34.0 6 37.6105 38.0 38.0 38.0 38.0 38.0 7 37.61375 38.0 38.0 38.0 38.0 38.0 8 37.5875 38.0 38.0 38.0 38.0 38.0 9 37.53925 38.0 38.0 38.0 38.0 38.0 10-14 37.5309 38.0 38.0 38.0 38.0 38.0 15-19 37.5431 38.0 38.0 38.0 38.0 38.0 20-24 36.82770000000001 38.0 37.8 38.0 34.6 38.0 25-29 37.5746 38.0 38.0 38.0 38.0 38.0 30-34 37.62415 38.0 38.0 38.0 38.0 38.0 35-39 37.14020000000001 38.0 38.0 38.0 35.6 38.0 40-44 37.549549999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.57865 38.0 38.0 38.0 38.0 38.0 50-54 37.545100000000005 38.0 38.0 38.0 38.0 38.0 55-59 36.9474 38.0 38.0 38.0 35.2 38.0 60-64 37.47725 38.0 38.0 38.0 37.8 38.0 65-69 37.45235 38.0 38.0 38.0 38.0 38.0 70-74 37.4447 38.0 38.0 38.0 38.0 38.0 75-79 37.4057 38.0 38.0 38.0 37.6 38.0 80-84 37.29055 38.0 38.0 38.0 37.0 38.0 85-89 37.266099999999994 38.0 38.0 38.0 37.0 38.0 90-94 37.16564999999999 38.0 38.0 38.0 36.8 38.0 95-99 37.17405 38.0 38.0 38.0 37.0 38.0 100-104 36.332049999999995 38.0 37.6 38.0 32.4 38.0 105-109 36.3462 38.0 37.4 38.0 31.4 38.0 110-114 36.380399999999995 38.0 37.8 38.0 33.0 38.0 115-119 36.76265 38.0 38.0 38.0 35.0 38.0 120-124 34.7207 38.0 35.4 38.0 25.0 38.0 125-129 35.8639 38.0 36.8 38.0 32.0 38.0 130-134 34.4983 38.0 34.4 38.0 25.4 38.0 135-139 33.5063 37.6 31.6 38.0 21.8 38.0 140-144 34.3779 38.0 34.0 38.0 25.8 38.0 145-149 34.6336 38.0 35.8 38.0 28.4 38.0 150-151 29.07425 35.5 19.0 38.0 10.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 4.0 20 2.0 21 3.0 22 2.0 23 9.0 24 4.0 25 5.0 26 9.0 27 17.0 28 14.0 29 22.0 30 26.0 31 36.0 32 38.0 33 85.0 34 123.0 35 305.0 36 948.0 37 2336.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.2 19.625 10.925 31.25 2 28.65 25.525 29.9 15.925 3 22.375 26.125 29.45 22.05 4 25.05 34.825 20.1 20.025000000000002 5 27.575 34.575 21.425 16.425 6 21.75 38.324999999999996 21.5 18.425 7 20.424999999999997 21.65 37.55 20.375 8 23.025000000000002 23.5 26.924999999999997 26.55 9 22.225 23.525 29.675 24.575 10-14 24.535 27.755000000000003 25.785000000000004 21.925 15-19 23.895 26.919999999999998 26.490000000000002 22.695 20-24 24.46 27.250000000000004 26.215 22.075 25-29 24.63 26.889999999999997 25.895000000000003 22.585 30-34 24.67 27.095000000000002 26.35 21.884999999999998 35-39 23.74 27.575 26.540000000000003 22.145 40-44 23.865 27.04 26.790000000000003 22.305 45-49 23.674999999999997 27.47 26.484999999999996 22.37 50-54 24.38 27.48 26.41 21.73 55-59 24.19 27.375 26.515 21.92 60-64 24.145 26.545 26.905 22.405 65-69 23.96 27.584999999999997 26.865 21.59 70-74 23.875 27.215 26.99 21.92 75-79 23.75 26.615 26.995 22.64 80-84 23.875 26.86 27.325 21.94 85-89 23.945 27.76 26.39 21.905 90-94 23.880000000000003 27.52 27.060000000000002 21.54 95-99 23.94 27.639999999999997 26.43 21.990000000000002 100-104 24.03 27.644999999999996 26.745 21.58 105-109 24.09 27.36 26.484999999999996 22.065 110-114 23.905 27.625 27.075 21.395 115-119 24.52 27.13 26.375 21.975 120-124 24.47 27.045 26.645000000000003 21.84 125-129 24.79 26.985 26.845000000000002 21.38 130-134 24.9 27.105 26.840000000000003 21.154999999999998 135-139 24.855 27.975 25.94 21.23 140-144 25.34 27.465 26.674999999999997 20.52 145-149 25.52 27.115000000000002 26.69 20.674999999999997 150-151 26.5875 27.1125 26.900000000000002 19.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.5 26 1.5 27 3.5 28 7.0 29 10.5 30 13.0 31 23.0 32 30.0 33 29.5 34 37.5 35 50.0 36 61.5 37 86.0 38 108.5 39 136.5 40 170.5 41 195.0 42 223.5 43 258.0 44 259.5 45 245.5 46 223.0 47 205.0 48 207.5 49 189.0 50 168.5 51 137.5 52 115.0 53 100.5 54 94.0 55 86.0 56 55.5 57 51.5 58 59.5 59 49.5 60 44.0 61 45.0 62 39.0 63 30.5 64 24.0 65 24.0 66 21.0 67 13.0 68 18.5 69 16.5 70 8.5 71 7.0 72 3.5 73 1.5 74 2.0 75 2.5 76 1.5 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.0625 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 4.1375 0.0 0.0 0.0 0.0 122-123 4.5375 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 6.0625 0.0 0.0 0.0 0.0 128-129 6.6625 0.0 0.0 0.0 0.0 130-131 7.0875 0.0 0.0 0.0 0.0 132-133 7.7 0.0 0.0 0.0 0.0 134-135 8.2625 0.0 0.0 0.0 0.0 136-137 8.7625 0.0 0.0 0.0 0.0 138-139 9.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCAAA 10 0.006830828 145.0 9 TGGACAA 10 0.006830828 145.0 145 >>END_MODULE Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597968 spots for SRR6958267.sra Written 597968 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra Read 597961 spots for SRR6958267.sra Written 597961 spots for SRR6958267.sra SRR ids: ['SRR6958267.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k97uu5ho SRR6958267.sra spots: 11959227 blocks: [[1, 597961], [597962, 1195922], [1195923, 1793883], [1793884, 2391844], [2391845, 2989805], [2989806, 3587766], [3587767, 4185727], [4185728, 4783688], [4783689, 5381649], [5381650, 5979610], [5979611, 6577571], [6577572, 7175532], [7175533, 7773493], [7773494, 8371454], [8371455, 8969415], [8969416, 9567376], [9567377, 10165337], [10165338, 10763298], [10763299, 11361259], [11361260, 11959227]] SRR6958267 file size 4030889 SRR6958267 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958267 SRR6958267_1.fastq SRR6958267_2.fastq Input file: SRR6958267_1.fastq Paired file: SRR6958267_2.fastq trimmed: SRR6958267-trimmed-pair1.fastq, SRR6958267-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:09:50 2024 >> started Fri Dec 6 18:10:05 2024 >> done (14.627s) 11959227 read pairs processed; of these: 3612 ( 0.03%) short read pairs filtered out after trimming by size control 3999 ( 0.03%) empty read pairs filtered out after trimming by size control 11951616 (99.94%) read pairs available; of these: 6845377 (57.28%) trimmed read pairs available after processing 5106239 (42.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 2 0.00% 21 3 0.00% 22 5 0.00% 23 8 0.00% 24 6 0.00% 25 8 0.00% 26 9 0.00% 27 7 0.00% 28 6 0.00% 29 5 0.00% 30 13 0.00% 31 13 0.00% 32 7 0.00% 33 13 0.00% 34 10 0.00% 35 8 0.00% 36 18 0.00% 37 17 0.00% 38 14 0.00% 39 19 0.00% 40 27 0.00% 41 27 0.00% 42 27 0.00% 43 24 0.00% 44 30 0.00% 45 32 0.00% 46 33 0.00% 47 28 0.00% 48 41 0.00% 49 50 0.00% 50 62 0.00% 51 60 0.00% 52 77 0.00% 53 69 0.00% 54 89 0.00% 55 88 0.00% 56 126 0.00% 57 105 0.00% 58 126 0.00% 59 145 0.00% 60 191 0.00% 61 184 0.00% 62 219 0.00% 63 246 0.00% 64 264 0.00% 65 302 0.00% 66 314 0.00% 67 341 0.00% 68 437 0.00% 69 469 0.00% 70 494 0.00% 71 593 0.00% 72 695 0.01% 73 756 0.01% 74 854 0.01% 75 1026 0.01% 76 1056 0.01% 77 1263 0.01% 78 1399 0.01% 79 1555 0.01% 80 1673 0.01% 81 1924 0.02% 82 2274 0.02% 83 2526 0.02% 84 2852 0.02% 85 3184 0.03% 86 3581 0.03% 87 3944 0.03% 88 4318 0.04% 89 4714 0.04% 90 4984 0.04% 91 5555 0.05% 92 6099 0.05% 93 6752 0.06% 94 7441 0.06% 95 7902 0.07% 96 8612 0.07% 97 9188 0.08% 98 9656 0.08% 99 10629 0.09% 100 11725 0.10% 101 12981 0.11% 102 13013 0.11% 103 13952 0.12% 104 14941 0.13% 105 15641 0.13% 106 16904 0.14% 107 17780 0.15% 108 18434 0.15% 109 19433 0.16% 110 20622 0.17% 111 21438 0.18% 112 22693 0.19% 113 23273 0.19% 114 24886 0.21% 115 26280 0.22% 116 27201 0.23% 117 28465 0.24% 118 29539 0.25% 119 30204 0.25% 120 31569 0.26% 121 32622 0.27% 122 34636 0.29% 123 36511 0.31% 124 37844 0.32% 125 39582 0.33% 126 40830 0.34% 127 42459 0.36% 128 43877 0.37% 129 46017 0.39% 130 48381 0.40% 131 50163 0.42% 132 51988 0.43% 133 55273 0.46% 134 58178 0.49% 135 61304 0.51% 136 65185 0.55% 137 68286 0.57% 138 72470 0.61% 139 77976 0.65% 140 82006 0.69% 141 90648 0.76% 142 100166 0.84% 143 112001 0.94% 144 126383 1.06% 145 153017 1.28% 146 189276 1.58% 147 248441 2.08% 148 368437 3.08% 149 719048 6.02% 150 3129465 26.18% 151 5106239 42.72% 11951616 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=26 prefix-density=0.18 prefix-fanout=3.1 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=262.49 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=27.2 sequence=TTCTTCTTGTCCA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.41 fanout-score-rank=24 prefix-density=0.21 prefix-fanout=3.5 sequence=CCTTCGCCGGCGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=73.45 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.9 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958267 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:10:58 Started mapping on | Dec 06 18:10:59 Finished on | Dec 06 18:11:54 Mapping speed, Million of reads per hour | 782.29 Number of input reads | 11951616 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11742198 Uniquely mapped reads % | 98.25% Average mapped length | 292.46 Number of splices: Total | 13444970 Number of splices: Annotated (sjdb) | 12684323 Number of splices: GT/AG | 13273959 Number of splices: GC/AG | 151829 Number of splices: AT/AC | 6578 Number of splices: Non-canonical | 12604 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 100469 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 6892 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 111104 111104 111104 N_multimapping 100469 100469 100469 N_noFeature 601047 11440081 711490 N_ambiguous 228097 1416 36875 UnstrandedReadsAssigned:10913054 PositiveStrandReadsAssigned:300701 NegativeStrandReadsAssigned:10993833 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6958267 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958267-trimmed-pair1.fastq SRR6958267-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,951,616 reads, 11,033,403 reads pseudoaligned [quant] estimated average fragment length: 217.587 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52973 SRR6958267.ke.tsv 35125 SRR6958267.se.tsv 88098 total ==> SRR6958267.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 719.713 0.0222743 0.00456875 PNS24247 1044 827.413 42.3056 7.54795 PNS24249 1928 1711.41 43.4847 3.7509 PNS24246 1044 827.413 42.3056 7.54795 PNS24248 1044 827.413 42.3056 7.54795 PNS24244 1471 1254.41 29.5763 3.48063 PNS24243 293 100.959 0 0 KQK14069 1603 1386.41 195.778 20.8461 KQK14071 474 261.11 1.62802 0.920428 ==> SRR6958267.se.tsv <== BRADI_1g14170v3 211 BRADI_1g53295v3 530 BRADI_1g59795v3 308 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 241 BRADI_1g74790v3 266 BRADI_1g09890v3 0 BRADI_1g77505v3 162 BRADI_1g48960v3 0 SRR6958267 completed mapping pipeline successfully