Starting /dee2/code/volunteer_pipeline.sh SRR6958268 current disk space = 1550680633344 free memory = 1603840092 SRR6958268 SRAfilesize 698abf3db7df886ad4b900f294c506dd SRR6958268.sra SRR6958268.sra file validated SRR6958268 is paired end SRR6958268 is conventional basespace SRR6958268 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958268_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.26575 33.0 32.0 33.0 18.0 34.0 2 31.618 33.0 31.0 33.0 27.0 34.0 3 31.36225 33.0 31.0 33.0 27.0 34.0 4 32.0805 33.0 32.0 33.0 31.0 34.0 5 32.08825 33.0 32.0 33.0 31.0 34.0 6 36.26 38.0 37.0 38.0 33.0 38.0 7 36.53875 38.0 37.0 38.0 34.0 38.0 8 36.87275 38.0 38.0 38.0 35.0 38.0 9 37.12 38.0 38.0 38.0 36.0 38.0 10-14 37.274 38.0 38.0 38.0 36.6 38.0 15-19 37.387299999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.36385 38.0 38.0 38.0 37.0 38.0 25-29 37.2251 38.0 38.0 38.0 36.6 38.0 30-34 37.09485 38.0 38.0 38.0 36.0 38.0 35-39 37.019450000000006 38.0 38.0 38.0 36.0 38.0 40-44 37.057399999999994 38.0 38.0 38.0 36.0 38.0 45-49 36.8483 38.0 38.0 38.0 35.2 38.0 50-54 36.67355 38.0 38.0 38.0 34.4 38.0 55-59 36.6188 38.0 38.0 38.0 34.0 38.0 60-64 36.87535 38.0 38.0 38.0 35.0 38.0 65-69 36.84015 38.0 38.0 38.0 35.0 38.0 70-74 36.36985 38.0 37.4 38.0 33.8 38.0 75-79 36.27265 38.0 37.2 38.0 33.2 38.0 80-84 36.19735 38.0 37.4 38.0 33.4 38.0 85-89 36.4173 38.0 37.8 38.0 33.8 38.0 90-94 36.2139 38.0 37.6 38.0 33.0 38.0 95-99 35.906800000000004 38.0 36.6 38.0 32.0 38.0 100-104 35.30544999999999 38.0 35.8 38.0 28.8 38.0 105-109 34.9641 38.0 35.0 38.0 27.2 38.0 110-114 35.04345 38.0 35.2 38.0 27.6 38.0 115-119 35.223349999999996 38.0 35.6 38.0 28.6 38.0 120-124 34.8301 38.0 35.0 38.0 27.4 38.0 125-129 34.7855 38.0 35.0 38.0 27.2 38.0 130-134 34.2354 38.0 34.4 38.0 24.4 38.0 135-139 33.82645 38.0 34.0 38.0 22.8 38.0 140-144 32.72605 37.2 32.8 38.0 17.0 38.0 145-149 31.348150000000004 36.2 31.0 38.0 10.8 38.0 150-151 26.8365 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 1.0 14 2.0 15 0.0 16 1.0 17 1.0 18 4.0 19 1.0 20 7.0 21 4.0 22 6.0 23 13.0 24 14.0 25 15.0 26 28.0 27 34.0 28 48.0 29 68.0 30 61.0 31 93.0 32 113.0 33 160.0 34 269.0 35 444.0 36 972.0 37 1639.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.609220636663004 9.796926454445664 7.574094401756312 37.019758507135016 2 26.575 11.0 32.425 30.0 3 22.650000000000002 14.325 24.349999999999998 38.675 4 27.575 22.8 22.225 27.400000000000002 5 26.424999999999997 25.650000000000002 25.424999999999997 22.5 6 25.95 30.65 22.45 20.95 7 19.025 23.25 36.25 21.475 8 21.725 23.5 27.750000000000004 27.025 9 21.625 20.7 32.025 25.650000000000002 10-14 23.830000000000002 24.615000000000002 25.56 25.995 15-19 23.89 24.2 26.05 25.86 20-24 24.52 24.745 25.224999999999998 25.509999999999998 25-29 24.535 24.25 25.035 26.179999999999996 30-34 24.560000000000002 24.22 25.025 26.195 35-39 24.455 23.7 25.25 26.595000000000002 40-44 24.585 24.465 24.43 26.52 45-49 24.33 24.099999999999998 24.95 26.619999999999997 50-54 24.5 24.245 25.230000000000004 26.025 55-59 24.2 23.849999999999998 26.075 25.874999999999996 60-64 24.945 23.25 24.75 27.055 65-69 24.83 23.915 25.119999999999997 26.135 70-74 24.64 23.865 24.815 26.68 75-79 24.84 23.985 24.490000000000002 26.685 80-84 24.959999999999997 24.09 24.8 26.150000000000002 85-89 24.935 23.75 24.959999999999997 26.355 90-94 25.035 23.990000000000002 24.044999999999998 26.93 95-99 24.735 23.52 25.080000000000002 26.665 100-104 24.59 23.9 25.27 26.240000000000002 105-109 24.965 24.125 24.63 26.279999999999998 110-114 25.040000000000003 24.18 24.765 26.015 115-119 25.165 24.675 23.9 26.26 120-124 25.045 24.25 24.115000000000002 26.590000000000003 125-129 25.335 24.935 23.815 25.915 130-134 24.990000000000002 25.130000000000003 23.845 26.035000000000004 135-139 24.615000000000002 24.615000000000002 24.485 26.284999999999997 140-144 25.36 24.52 23.82 26.3 145-149 25.4 25.495 23.515 25.590000000000003 150-151 24.875 24.762500000000003 23.5875 26.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.0 27 0.5 28 0.5 29 1.0 30 4.0 31 7.5 32 9.5 33 11.0 34 15.0 35 19.5 36 32.0 37 45.0 38 52.0 39 76.0 40 107.5 41 135.5 42 151.5 43 156.5 44 168.0 45 181.0 46 203.0 47 202.5 48 177.0 49 170.5 50 161.5 51 140.0 52 126.0 53 124.0 54 114.5 55 114.5 56 117.5 57 106.5 58 95.0 59 91.5 60 91.5 61 82.0 62 75.5 63 74.0 64 75.5 65 70.0 66 62.5 67 68.0 68 58.5 69 42.0 70 41.5 71 37.5 72 30.0 73 20.0 74 14.0 75 10.5 76 8.0 77 7.5 78 5.0 79 4.0 80 2.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0499999999999998 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.45 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.3499999999999996 0.0 0.0 0.0 0.0 110-111 2.775 0.0 0.0 0.0 0.0 112-113 3.25 0.0 0.0 0.0 0.0 114-115 3.825 0.0 0.0 0.0 0.0 116-117 4.3875 0.0 0.0 0.0 0.0 118-119 5.025 0.0 0.0 0.0 0.0 120-121 5.65 0.0 0.0 0.0 0.0 122-123 6.1 0.0 0.0 0.0 0.0 124-125 6.824999999999999 0.0 0.0 0.0 0.0 126-127 7.449999999999999 0.0 0.0 0.0 0.0 128-129 8.0375 0.0 0.0 0.0 0.0 130-131 8.7875 0.0 0.0 0.0 0.0 132-133 9.4 0.0 0.0 0.0 0.0 134-135 9.9375 0.0 0.0 0.0 0.0 136-137 10.662500000000001 0.0 0.0 0.0 0.0 138-139 11.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGTCT 10 0.0054020355 156.67567 1 GTGAGAT 10 0.006841402 144.925 145 >>END_MODULE SRR6958268 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958268_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.23725 33.0 33.0 34.0 31.0 34.0 2 32.33925 33.0 33.0 34.0 31.0 34.0 3 32.34175 33.0 33.0 34.0 31.0 34.0 4 32.41625 33.0 33.0 34.0 31.0 34.0 5 32.312 33.0 33.0 34.0 31.0 34.0 6 36.2395 38.0 38.0 38.0 33.0 38.0 7 35.7555 38.0 37.0 38.0 31.0 38.0 8 36.3905 38.0 38.0 38.0 34.0 38.0 9 36.31225 38.0 38.0 38.0 33.0 38.0 10-14 36.39919999999999 38.0 38.0 38.0 34.0 38.0 15-19 36.58245 38.0 38.0 38.0 34.6 38.0 20-24 36.57305 38.0 38.0 38.0 34.4 38.0 25-29 36.740750000000006 38.0 38.0 38.0 35.0 38.0 30-34 36.6974 38.0 38.0 38.0 35.4 38.0 35-39 36.51895 38.0 38.0 38.0 34.4 38.0 40-44 36.486200000000004 38.0 38.0 38.0 34.2 38.0 45-49 36.259499999999996 38.0 38.0 38.0 33.8 38.0 50-54 36.33295 38.0 38.0 38.0 33.6 38.0 55-59 36.24705 38.0 38.0 38.0 33.4 38.0 60-64 36.038799999999995 38.0 38.0 38.0 32.6 38.0 65-69 36.05785000000001 38.0 38.0 38.0 32.8 38.0 70-74 36.0107 38.0 37.6 38.0 32.4 38.0 75-79 35.8688 38.0 37.0 38.0 32.0 38.0 80-84 35.9404 38.0 37.4 38.0 32.6 38.0 85-89 35.8865 38.0 37.4 38.0 32.2 38.0 90-94 35.49835 38.0 36.8 38.0 30.2 38.0 95-99 35.0347 38.0 35.8 38.0 28.0 38.0 100-104 34.606300000000005 38.0 35.2 38.0 25.4 38.0 105-109 34.48109999999999 38.0 35.0 38.0 24.2 38.0 110-114 34.2438 38.0 34.6 38.0 22.8 38.0 115-119 34.1974 38.0 34.4 38.0 23.6 38.0 120-124 34.080799999999996 38.0 34.6 38.0 23.0 38.0 125-129 33.4757 38.0 34.0 38.0 20.2 38.0 130-134 32.76435 38.0 33.2 38.0 14.4 38.0 135-139 32.3305 37.6 31.6 38.0 14.0 38.0 140-144 31.379550000000002 36.4 30.8 38.0 13.0 38.0 145-149 29.627850000000002 36.0 28.4 38.0 4.2 38.0 150-151 23.888875 31.0 12.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 5.0 4 2.0 5 2.0 6 1.0 7 2.0 8 2.0 9 0.0 10 3.0 11 1.0 12 1.0 13 1.0 14 8.0 15 3.0 16 1.0 17 6.0 18 10.0 19 6.0 20 10.0 21 12.0 22 17.0 23 20.0 24 30.0 25 33.0 26 48.0 27 43.0 28 49.0 29 75.0 30 87.0 31 106.0 32 137.0 33 176.0 34 237.0 35 420.0 36 843.0 37 1589.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.074999999999996 17.724999999999998 11.5 32.7 2 29.7 24.224999999999998 24.925 21.15 3 23.474999999999998 26.35 26.575 23.599999999999998 4 26.75 31.7 18.875 22.675 5 27.35 31.874999999999996 19.925 20.849999999999998 6 23.66183091545773 35.29264632316158 19.85992996498249 21.1855927963982 7 23.36168084042021 19.959979989995 32.191095547773884 24.487243621810904 8 25.01876407305479 24.36827620715537 21.641230923192396 28.971728796597446 9 24.10602650662666 23.605901475368842 25.581395348837212 26.70667666916729 10-14 26.636659164791197 25.7664416104026 21.885471367841962 25.711427856964242 15-19 25.6965634535541 25.391426141763795 23.035365914661597 25.87664449002051 20-24 26.144150452658433 25.90906817386085 22.632921522532886 25.313859850947836 25-29 26.27919771920172 24.44855699494823 23.60326114139949 25.668984144450558 30-34 25.52138034508627 24.956239059764943 24.171042760690174 25.351337834458615 35-39 26.506626656664167 24.731182795698924 22.840710177544384 25.921480370092524 40-44 25.95648912228057 24.36609152288072 23.615903975993998 26.061515378844714 45-49 26.531632908227053 25.15128782195549 23.5008752188047 24.816204051012754 50-54 26.704346521282453 25.21882658930626 23.563247136497775 24.513579752913518 55-59 27.04176044011003 24.651162790697676 22.91072768192048 25.39634908727182 60-64 26.81938678537488 24.408542990046517 23.478217376081627 25.29385284849697 65-69 26.646661665416353 24.59114778694674 23.045761440360092 25.716429107276817 70-74 26.211552888222055 24.786196549137284 23.410852713178297 25.591397849462368 75-79 26.501625406351586 24.551137784446112 23.600900225056265 25.346336584146034 80-84 26.34158539634909 24.186046511627907 23.710927731932983 25.76144036009002 85-89 26.176544136034007 24.861215303825958 23.640910227556887 25.32133033258315 90-94 26.30657664416104 24.646161540385098 24.18104526131533 24.866216554138536 95-99 26.65666416604151 24.691172793198298 23.740935233808454 24.91122780695174 100-104 26.536634158539634 25.26631657914479 23.010752688172044 25.186296574143537 105-109 26.536634158539634 25.176294073518378 23.20580145036259 25.081270317579396 110-114 26.6816704176044 25.03125781445361 23.575893973493372 24.711177794448613 115-119 27.301825456364092 25.206301575393848 22.890722680670166 24.601150287571894 120-124 27.786946736684172 25.381345336334082 22.69567391847962 24.136034008502126 125-129 27.49187296824206 25.70642660665166 22.59064766191548 24.2110527631908 130-134 28.49212303075769 25.371342835708926 22.745686421605402 23.390847711927982 135-139 27.966991747936987 25.381345336334082 23.66591647911978 22.98574643660915 140-144 28.22705676419105 26.41660415103776 22.360590147536886 22.99574893723431 145-149 28.857214303575894 26.42160540135034 22.29557389347337 22.4256064016004 150-151 28.744686171542888 26.406601650412604 22.280570142535634 22.568142035508878 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 2.0 28 3.0 29 2.5 30 3.5 31 4.0 32 4.5 33 8.0 34 8.5 35 14.0 36 24.5 37 33.5 38 45.5 39 72.0 40 99.0 41 115.0 42 132.5 43 157.5 44 178.0 45 188.0 46 183.0 47 169.0 48 180.0 49 188.5 50 171.5 51 154.5 52 142.0 53 118.0 54 110.0 55 115.0 56 108.0 57 100.5 58 100.0 59 101.5 60 103.5 61 95.0 62 90.0 63 84.0 64 72.0 65 78.5 66 71.0 67 47.5 68 53.5 69 62.5 70 45.5 71 32.0 72 32.5 73 30.5 74 20.5 75 13.5 76 9.0 77 7.5 78 4.0 79 1.5 80 1.0 81 1.0 82 2.0 83 1.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.075 9 0.025 10-14 0.025 15-19 0.045 20-24 0.034999999999999996 25-29 0.034999999999999996 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.025 50-54 0.034999999999999996 55-59 0.025 60-64 0.034999999999999996 65-69 0.025 70-74 0.025 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.025 95-99 0.025 100-104 0.025 105-109 0.025 110-114 0.025 115-119 0.025 120-124 0.025 125-129 0.025 130-134 0.025 135-139 0.025 140-144 0.025 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80740928698299 97.35000000000001 2 1.0149708195889366 2.0 3 0.07612281146917026 0.22499999999999998 4 0.07612281146917026 0.3 5 0.025374270489723422 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0499999999999998 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.45 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.3375 0.0 0.0 0.0 0.0 110-111 2.775 0.0 0.0 0.0 0.0 112-113 3.2375 0.0 0.0 0.0 0.0 114-115 3.8 0.0 0.0 0.0 0.0 116-117 4.35 0.0 0.0 0.0 0.0 118-119 4.9625 0.0 0.0 0.0 0.0 120-121 5.550000000000001 0.0 0.0 0.0 0.0 122-123 6.025 0.0 0.0 0.0 0.0 124-125 6.725 0.0 0.0 0.0 0.0 126-127 7.324999999999999 0.0 0.0 0.0 0.0 128-129 7.862500000000001 0.0 0.0 0.0 0.0 130-131 8.625 0.0 0.0 0.0 0.0 132-133 9.275 0.0 0.0 0.0 0.0 134-135 9.8 0.0 0.0 0.0 0.0 136-137 10.5625 0.0 0.0 0.0 0.0 138-139 11.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAAAC 10 0.006830828 145.0 1 GAAACAA 10 0.006830828 145.0 3 AGAAACA 10 0.006830828 145.0 2 >>END_MODULE Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138296 spots for SRR6958268.sra Written 1138296 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra Read 1138282 spots for SRR6958268.sra Written 1138282 spots for SRR6958268.sra SRR ids: ['SRR6958268.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ff_3nwat SRR6958268.sra spots: 22765654 blocks: [[1, 1138282], [1138283, 2276564], [2276565, 3414846], [3414847, 4553128], [4553129, 5691410], [5691411, 6829692], [6829693, 7967974], [7967975, 9106256], [9106257, 10244538], [10244539, 11382820], [11382821, 12521102], [12521103, 13659384], [13659385, 14797666], [14797667, 15935948], [15935949, 17074230], [17074231, 18212512], [18212513, 19350794], [19350795, 20489076], [20489077, 21627358], [21627359, 22765654]] SRR6958268 file size 7692832 SRR6958268 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958268 SRR6958268_1.fastq SRR6958268_2.fastq Input file: SRR6958268_1.fastq Paired file: SRR6958268_2.fastq trimmed: SRR6958268-trimmed-pair1.fastq, SRR6958268-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:12:48 2024 >> started Fri Dec 6 18:13:10 2024 >> done (22.643s) 22765654 read pairs processed; of these: 43598 ( 0.19%) short read pairs filtered out after trimming by size control 27458 ( 0.12%) empty read pairs filtered out after trimming by size control 22694598 (99.69%) read pairs available; of these: 11346658 (50.00%) trimmed read pairs available after processing 11347940 (50.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 4 0.00% 21 10 0.00% 22 4 0.00% 23 7 0.00% 24 6 0.00% 25 4 0.00% 26 7 0.00% 27 9 0.00% 28 12 0.00% 29 8 0.00% 30 11 0.00% 31 9 0.00% 32 10 0.00% 33 17 0.00% 34 12 0.00% 35 12 0.00% 36 16 0.00% 37 21 0.00% 38 16 0.00% 39 14 0.00% 40 16 0.00% 41 37 0.00% 42 19 0.00% 43 32 0.00% 44 38 0.00% 45 34 0.00% 46 38 0.00% 47 52 0.00% 48 48 0.00% 49 86 0.00% 50 76 0.00% 51 90 0.00% 52 124 0.00% 53 120 0.00% 54 125 0.00% 55 150 0.00% 56 174 0.00% 57 175 0.00% 58 233 0.00% 59 240 0.00% 60 282 0.00% 61 340 0.00% 62 415 0.00% 63 459 0.00% 64 510 0.00% 65 560 0.00% 66 629 0.00% 67 756 0.00% 68 871 0.00% 69 951 0.00% 70 1057 0.00% 71 1255 0.01% 72 1462 0.01% 73 1665 0.01% 74 1943 0.01% 75 2198 0.01% 76 2446 0.01% 77 2756 0.01% 78 3088 0.01% 79 3504 0.02% 80 4001 0.02% 81 4740 0.02% 82 5482 0.02% 83 6320 0.03% 84 8862 0.04% 85 10249 0.05% 86 10383 0.05% 87 11199 0.05% 88 11911 0.05% 89 13068 0.06% 90 14113 0.06% 91 15843 0.07% 92 16646 0.07% 93 18379 0.08% 94 20332 0.09% 95 21772 0.10% 96 22774 0.10% 97 24630 0.11% 98 26500 0.12% 99 28169 0.12% 100 30154 0.13% 101 32365 0.14% 102 34871 0.15% 103 37305 0.16% 104 39912 0.18% 105 41768 0.18% 106 44349 0.20% 107 45515 0.20% 108 48051 0.21% 109 50636 0.22% 110 51680 0.23% 111 54765 0.24% 112 57809 0.25% 113 60918 0.27% 114 64040 0.28% 115 67090 0.30% 116 69854 0.31% 117 71311 0.31% 118 73480 0.32% 119 75360 0.33% 120 77762 0.34% 121 79684 0.35% 122 82294 0.36% 123 85650 0.38% 124 89794 0.40% 125 93032 0.41% 126 95976 0.42% 127 99000 0.44% 128 100162 0.44% 129 103012 0.45% 130 105226 0.46% 131 107956 0.48% 132 112685 0.50% 133 116774 0.51% 134 119721 0.53% 135 124890 0.55% 136 128157 0.56% 137 132493 0.58% 138 136112 0.60% 139 142973 0.63% 140 148495 0.65% 141 155551 0.69% 142 169395 0.75% 143 180188 0.79% 144 199162 0.88% 145 227997 1.00% 146 270114 1.19% 147 343178 1.51% 148 492396 2.17% 149 934346 4.12% 150 4716605 20.78% 151 11347940 50.00% 22694598 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=20 prefix-density=0.78 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.21 sequence-density-rank=12 fanout-score=32.96 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=8.9 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=23 prefix-density=0.60 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.16 sequence-density-rank=19 fanout-score=61.97 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=11.8 sequence=GCCGCCGCCGCC SRR6958268 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:13:54 Started mapping on | Dec 06 18:13:54 Finished on | Dec 06 18:15:40 Mapping speed, Million of reads per hour | 770.76 Number of input reads | 22694598 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 22139688 Uniquely mapped reads % | 97.55% Average mapped length | 290.72 Number of splices: Total | 24523256 Number of splices: Annotated (sjdb) | 22992727 Number of splices: GT/AG | 24205643 Number of splices: GC/AG | 289097 Number of splices: AT/AC | 9456 Number of splices: Non-canonical | 19060 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 146803 % of reads mapped to multiple loci | 0.65% Number of reads mapped to too many loci | 19365 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.29% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 430168 430168 430168 N_multimapping 146803 146803 146803 N_noFeature 579157 21543817 744489 N_ambiguous 506320 2657 76729 UnstrandedReadsAssigned:21054211 PositiveStrandReadsAssigned:593214 NegativeStrandReadsAssigned:21318470 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR6958268 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958268-trimmed-pair1.fastq SRR6958268-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,694,598 reads, 21,357,529 reads pseudoaligned [quant] estimated average fragment length: 230.612 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52973 SRR6958268.ke.tsv 35125 SRR6958268.se.tsv 88098 total ==> SRR6958268.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 706.8 0 0 PNS24247 1044 814.388 58.211 4.93246 PNS24249 1928 1698.39 67.7244 2.75168 PNS24246 1044 814.388 58.211 4.93246 PNS24248 1044 814.388 58.211 4.93246 PNS24244 1471 1241.39 54.6427 3.03749 PNS24243 293 104.653 0 0 KQK14069 1603 1373.39 4290.46 215.576 KQK14071 474 255.192 45.9268 12.4191 ==> SRR6958268.se.tsv <== BRADI_1g14170v3 4656 BRADI_1g53295v3 225 BRADI_1g59795v3 178 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 353 BRADI_1g74790v3 141 BRADI_1g09890v3 0 BRADI_1g77505v3 266 BRADI_1g48960v3 0 SRR6958268 completed mapping pipeline successfully