Starting /dee2/code/volunteer_pipeline.sh SRR6958269 current disk space = 1550680633344 free memory = 1603836940 SRR6958269 SRAfilesize 25a97580d47ece24a57040001d25f2b0 SRR6958269.sra SRR6958269.sra file validated SRR6958269 is paired end SRR6958269 is conventional basespace SRR6958269 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958269_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.6565 33.0 32.0 33.0 2.0 34.0 2 31.1405 33.0 31.0 33.0 27.0 34.0 3 31.529 33.0 31.0 33.0 27.0 34.0 4 32.404 33.0 33.0 33.0 32.0 34.0 5 33.00775 33.0 33.0 34.0 32.0 34.0 6 34.1855 38.0 35.0 38.0 16.0 38.0 7 36.654 38.0 37.0 38.0 34.0 38.0 8 37.27875 38.0 38.0 38.0 36.0 38.0 9 37.50325 38.0 38.0 38.0 37.0 38.0 10-14 37.5126 38.0 38.0 38.0 37.2 38.0 15-19 37.44465 38.0 38.0 38.0 37.2 38.0 20-24 37.3446 38.0 38.0 38.0 37.4 38.0 25-29 37.195299999999996 38.0 38.0 38.0 36.6 38.0 30-34 37.09415 38.0 38.0 38.0 36.0 38.0 35-39 37.181349999999995 38.0 38.0 38.0 36.0 38.0 40-44 37.50265 38.0 38.0 38.0 37.6 38.0 45-49 37.39395 38.0 38.0 38.0 37.0 38.0 50-54 37.241550000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.2289 38.0 38.0 38.0 36.6 38.0 60-64 37.3798 38.0 38.0 38.0 37.0 38.0 65-69 36.7108 38.0 37.4 38.0 34.0 38.0 70-74 37.257600000000004 38.0 38.0 38.0 36.4 38.0 75-79 37.3069 38.0 38.0 38.0 37.0 38.0 80-84 37.185199999999995 38.0 38.0 38.0 36.2 38.0 85-89 36.93785 38.0 38.0 38.0 35.6 38.0 90-94 36.413399999999996 38.0 38.0 38.0 33.8 38.0 95-99 34.51495 38.0 34.6 38.0 24.6 38.0 100-104 35.914049999999996 38.0 37.2 38.0 31.6 38.0 105-109 35.763400000000004 38.0 36.8 38.0 30.8 38.0 110-114 35.774150000000006 38.0 37.0 38.0 31.4 38.0 115-119 36.37845 38.0 37.6 38.0 33.6 38.0 120-124 36.5432 38.0 38.0 38.0 34.0 38.0 125-129 36.493950000000005 38.0 38.0 38.0 34.0 38.0 130-134 36.32245 38.0 37.8 38.0 33.6 38.0 135-139 35.84225 38.0 36.0 38.0 32.6 38.0 140-144 35.406949999999995 38.0 36.0 38.0 31.0 38.0 145-149 32.300149999999995 37.0 28.8 38.0 22.8 38.0 150-151 29.4525 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 0.0 20 0.0 21 0.0 22 2.0 23 2.0 24 3.0 25 10.0 26 18.0 27 20.0 28 26.0 29 33.0 30 57.0 31 44.0 32 105.0 33 114.0 34 155.0 35 349.0 36 815.0 37 2240.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.12393887945671 10.21505376344086 8.80022637238257 37.86078098471987 2 23.599999999999998 13.15 33.5 29.75 3 21.725 16.925 24.725 36.625 4 25.656414103525883 25.35633908477119 21.530382595648913 27.45686421605401 5 27.825 27.85 21.8 22.525000000000002 6 21.15 32.375 23.05 23.425 7 16.5 23.849999999999998 40.849999999999994 18.8 8 19.75 24.25 29.299999999999997 26.700000000000003 9 19.950000000000003 21.575 33.275 25.2 10-14 23.24 26.495 25.275 24.990000000000002 15-19 23.01 25.15 26.3 25.540000000000003 20-24 22.75 25.124999999999996 26.5 25.624999999999996 25-29 23.31 25.540000000000003 25.674999999999997 25.474999999999998 30-34 22.775000000000002 25.319999999999997 26.205000000000002 25.7 35-39 22.805 25.575 25.95 25.669999999999998 40-44 22.975 25.355 25.75 25.919999999999998 45-49 22.84 25.21 26.040000000000003 25.91 50-54 23.169999999999998 25.205 26.02 25.605 55-59 23.235 25.624999999999996 25.56 25.580000000000002 60-64 22.665 25.085 25.900000000000002 26.35 65-69 23.044999999999998 25.430000000000003 25.319999999999997 26.205000000000002 70-74 23.189999999999998 25.165 26.05 25.595000000000002 75-79 23.39 25.119999999999997 25.56 25.929999999999996 80-84 23.705000000000002 24.740000000000002 25.77 25.785000000000004 85-89 24.03 24.51 25.509999999999998 25.95 90-94 23.169999999999998 25.074999999999996 25.869999999999997 25.885 95-99 23.93 24.67 25.53 25.869999999999997 100-104 23.51 24.975 25.929999999999996 25.585 105-109 23.985 25.055 25.130000000000003 25.83 110-114 23.830000000000002 25.115 25.825 25.230000000000004 115-119 23.674999999999997 24.595 25.455 26.275 120-124 23.746187309365467 24.706235311765585 25.51127556377819 26.036301815090756 125-129 23.674999999999997 24.959999999999997 25.080000000000002 26.284999999999997 130-134 24.195 24.59 25.635 25.580000000000002 135-139 24.021201060053002 24.26621331066553 25.441272063603183 26.271313565678284 140-144 23.845 25.169999999999998 25.085 25.900000000000002 145-149 24.01 24.97 25.53 25.490000000000002 150-151 23.768442110527634 24.243560890222557 25.618904726181547 26.36909227306827 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.5 27 2.0 28 1.0 29 3.5 30 4.5 31 4.5 32 8.5 33 14.0 34 16.5 35 25.5 36 45.5 37 59.0 38 77.0 39 112.5 40 134.5 41 149.0 42 180.0 43 202.5 44 212.5 45 212.0 46 209.0 47 192.0 48 187.5 49 193.5 50 173.5 51 155.0 52 138.5 53 115.5 54 107.5 55 116.0 56 109.5 57 92.0 58 75.0 59 71.0 60 73.5 61 62.0 62 53.0 63 54.5 64 55.5 65 49.5 66 45.0 67 47.5 68 36.0 69 21.5 70 17.5 71 20.0 72 19.5 73 10.5 74 6.5 75 6.0 76 5.0 77 4.0 78 3.0 79 2.0 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.65 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14271306101867 98.3 2 0.8572869389813415 1.7000000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8999999999999999 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.425 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 1.975 0.0 0.0 0.0 0.0 126-127 2.2375 0.0 0.0 0.0 0.0 128-129 2.6125 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.1625 0.0 0.0 0.0 0.0 134-135 3.45 0.0 0.0 0.0 0.0 136-137 3.7875 0.0 0.0 0.0 0.0 138-139 4.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958269 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958269_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.886 33.0 33.0 34.0 32.0 34.0 2 33.08175 34.0 33.0 34.0 32.0 34.0 3 33.10875 34.0 33.0 34.0 32.0 34.0 4 32.90175 34.0 33.0 34.0 32.0 34.0 5 32.9425 34.0 33.0 34.0 32.0 34.0 6 37.19325 38.0 38.0 38.0 37.0 38.0 7 37.148 38.0 38.0 38.0 37.0 38.0 8 37.08575 38.0 38.0 38.0 36.0 38.0 9 37.0245 38.0 38.0 38.0 36.0 38.0 10-14 36.892199999999995 38.0 38.0 38.0 35.8 38.0 15-19 36.6044 38.0 38.0 38.0 34.8 38.0 20-24 36.74545 38.0 38.0 38.0 35.6 38.0 25-29 36.92745 38.0 38.0 38.0 36.4 38.0 30-34 37.1179 38.0 38.0 38.0 36.8 38.0 35-39 37.0959 38.0 38.0 38.0 37.0 38.0 40-44 35.4565 37.8 35.2 38.0 29.8 38.0 45-49 36.8483 38.0 38.0 38.0 35.8 38.0 50-54 36.39325 38.0 38.0 38.0 34.0 38.0 55-59 36.69539999999999 38.0 38.0 38.0 35.2 38.0 60-64 36.592349999999996 38.0 38.0 38.0 34.8 38.0 65-69 36.606700000000004 38.0 38.0 38.0 34.6 38.0 70-74 36.2921 38.0 38.0 38.0 34.0 38.0 75-79 36.092650000000006 38.0 37.8 38.0 32.6 38.0 80-84 36.1708 38.0 38.0 38.0 33.0 38.0 85-89 35.8996 38.0 37.8 38.0 32.4 38.0 90-94 36.27645 38.0 38.0 38.0 34.0 38.0 95-99 36.439049999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.366 38.0 38.0 38.0 34.0 38.0 105-109 36.3827 38.0 38.0 38.0 34.0 38.0 110-114 36.16895 38.0 38.0 38.0 33.8 38.0 115-119 35.777150000000006 38.0 37.6 38.0 32.6 38.0 120-124 34.8998 38.0 35.8 38.0 27.2 38.0 125-129 33.23625 37.2 32.0 38.0 21.0 38.0 130-134 31.2714 35.2 27.0 38.0 19.0 38.0 135-139 34.83005000000001 38.0 35.4 38.0 29.4 38.0 140-144 34.32105 38.0 34.6 38.0 25.0 38.0 145-149 34.282300000000006 38.0 35.6 38.0 27.6 38.0 150-151 29.326500000000003 35.5 26.5 38.0 7.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 1.0 5 4.0 6 1.0 7 0.0 8 1.0 9 1.0 10 1.0 11 4.0 12 2.0 13 3.0 14 0.0 15 0.0 16 4.0 17 4.0 18 6.0 19 7.0 20 3.0 21 8.0 22 8.0 23 11.0 24 14.0 25 27.0 26 31.0 27 32.0 28 37.0 29 41.0 30 39.0 31 73.0 32 75.0 33 121.0 34 186.0 35 314.0 36 822.0 37 2108.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.95 18.275 12.0 32.775 2 29.799999999999997 23.45 27.35 19.400000000000002 3 23.45 25.124999999999996 28.050000000000004 23.375 4 26.275 30.65 20.724999999999998 22.35 5 27.950000000000003 32.125 19.575 20.349999999999998 6 24.15 35.15 19.375 21.325 7 22.275 20.3 34.725 22.7 8 24.4 23.175 23.7 28.725 9 25.6 23.375 26.3 24.725 10-14 26.064999999999998 26.61 22.855 24.47 15-19 26.07 25.509999999999998 24.490000000000002 23.93 20-24 25.885 25.825 24.224999999999998 24.065 25-29 25.06 25.374999999999996 24.779999999999998 24.785 30-34 25.165 25.845000000000002 24.675 24.315 35-39 25.97 25.635 24.075 24.32 40-44 25.745 25.605 24.610000000000003 24.04 45-49 26.155 25.88 24.345 23.62 50-54 26.33 25.685000000000002 24.14 23.845 55-59 26.0 25.655 24.385 23.96 60-64 26.405 25.415 24.745 23.435 65-69 25.669999999999998 25.81 24.285 24.235 70-74 26.415 25.41 24.37 23.805 75-79 25.790000000000003 25.525 24.59 24.095 80-84 26.224999999999998 25.580000000000002 24.34 23.855 85-89 26.224999999999998 24.985 24.32 24.47 90-94 25.8 25.885 24.740000000000002 23.575 95-99 25.974999999999998 25.16 25.174999999999997 23.69 100-104 25.779999999999998 25.935000000000002 24.585 23.7 105-109 25.91 26.040000000000003 24.925 23.125 110-114 26.33 25.835 24.205 23.630000000000003 115-119 26.355 25.465 24.48 23.7 120-124 26.445 25.805 24.29 23.46 125-129 25.94 26.064999999999998 24.529999999999998 23.465 130-134 26.735 25.485000000000003 24.595 23.185 135-139 26.105 26.19 24.46 23.244999999999997 140-144 26.490000000000002 25.759999999999998 24.884999999999998 22.865 145-149 26.85 26.640000000000004 23.895 22.615 150-151 26.3625 26.650000000000002 24.55 22.4375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 1.0 25 1.0 26 2.0 27 2.5 28 2.5 29 1.5 30 2.5 31 5.0 32 8.5 33 14.0 34 18.0 35 23.5 36 38.0 37 53.0 38 63.0 39 88.5 40 124.5 41 144.0 42 156.0 43 176.5 44 197.0 45 200.5 46 197.5 47 190.5 48 188.5 49 196.5 50 180.0 51 155.0 52 143.5 53 134.0 54 115.0 55 94.0 56 98.0 57 102.0 58 85.5 59 70.0 60 62.5 61 69.0 62 78.0 63 66.5 64 55.5 65 60.5 66 56.5 67 48.5 68 49.0 69 40.5 70 28.5 71 24.0 72 19.5 73 19.5 74 16.0 75 10.5 76 9.5 77 5.5 78 1.5 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88551165146909 97.6 2 0.9878419452887538 1.95 3 0.10131712259371835 0.3 4 0.0 0.0 5 0.0 0.0 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.1375000000000002 0.0 0.0 0.0 0.0 118-119 1.1875 0.0 0.0 0.0 0.0 120-121 1.4249999999999998 0.0 0.0 0.0 0.0 122-123 1.7 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 2.05 0.0 0.0 0.0 0.0 128-129 2.3625 0.0 0.0 0.0 0.0 130-131 2.6500000000000004 0.0 0.0 0.0 0.0 132-133 2.8375 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.5125 0.0 0.0 0.0 0.0 138-139 3.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGTTT 10 0.006830828 145.0 8 >>END_MODULE Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138206 spots for SRR6958269.sra Written 1138206 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra Read 1138188 spots for SRR6958269.sra Written 1138188 spots for SRR6958269.sra SRR ids: ['SRR6958269.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uao6wyqx SRR6958269.sra spots: 22763778 blocks: [[1, 1138188], [1138189, 2276376], [2276377, 3414564], [3414565, 4552752], [4552753, 5690940], [5690941, 6829128], [6829129, 7967316], [7967317, 9105504], [9105505, 10243692], [10243693, 11381880], [11381881, 12520068], [12520069, 13658256], [13658257, 14796444], [14796445, 15934632], [15934633, 17072820], [17072821, 18211008], [18211009, 19349196], [19349197, 20487384], [20487385, 21625572], [21625573, 22763778]] SRR6958269 file size 7692197 SRR6958269 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958269 SRR6958269_1.fastq SRR6958269_2.fastq Input file: SRR6958269_1.fastq Paired file: SRR6958269_2.fastq trimmed: SRR6958269-trimmed-pair1.fastq, SRR6958269-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:11:45 2024 >> started Fri Dec 6 18:12:10 2024 >> done (24.975s) 22763778 read pairs processed; of these: 19995 ( 0.09%) short read pairs filtered out after trimming by size control 14372 ( 0.06%) empty read pairs filtered out after trimming by size control 22729411 (99.85%) read pairs available; of these: 7396817 (32.54%) trimmed read pairs available after processing 15332594 (67.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 3 0.00% 21 1 0.00% 22 5 0.00% 23 5 0.00% 24 4 0.00% 25 4 0.00% 26 11 0.00% 27 9 0.00% 28 9 0.00% 29 3 0.00% 30 12 0.00% 31 6 0.00% 32 7 0.00% 33 4 0.00% 34 6 0.00% 35 11 0.00% 36 7 0.00% 37 11 0.00% 38 4 0.00% 39 9 0.00% 40 11 0.00% 41 14 0.00% 42 10 0.00% 43 9 0.00% 44 8 0.00% 45 10 0.00% 46 13 0.00% 47 14 0.00% 48 16 0.00% 49 31 0.00% 50 27 0.00% 51 29 0.00% 52 26 0.00% 53 42 0.00% 54 40 0.00% 55 46 0.00% 56 39 0.00% 57 41 0.00% 58 58 0.00% 59 73 0.00% 60 81 0.00% 61 72 0.00% 62 103 0.00% 63 115 0.00% 64 129 0.00% 65 139 0.00% 66 168 0.00% 67 182 0.00% 68 191 0.00% 69 235 0.00% 70 278 0.00% 71 309 0.00% 72 377 0.00% 73 438 0.00% 74 468 0.00% 75 447 0.00% 76 560 0.00% 77 716 0.00% 78 742 0.00% 79 844 0.00% 80 963 0.00% 81 1125 0.00% 82 1357 0.01% 83 1529 0.01% 84 2564 0.01% 85 3205 0.01% 86 3366 0.01% 87 3588 0.02% 88 3676 0.02% 89 3773 0.02% 90 4089 0.02% 91 4425 0.02% 92 4744 0.02% 93 5113 0.02% 94 5472 0.02% 95 5819 0.03% 96 6445 0.03% 97 6841 0.03% 98 7011 0.03% 99 7620 0.03% 100 8091 0.04% 101 8741 0.04% 102 9548 0.04% 103 10380 0.05% 104 10952 0.05% 105 11885 0.05% 106 12830 0.06% 107 13042 0.06% 108 13610 0.06% 109 14515 0.06% 110 15086 0.07% 111 16310 0.07% 112 17369 0.08% 113 18636 0.08% 114 19750 0.09% 115 20880 0.09% 116 21971 0.10% 117 23113 0.10% 118 23817 0.10% 119 24741 0.11% 120 26015 0.11% 121 26959 0.12% 122 28801 0.13% 123 30306 0.13% 124 32674 0.14% 125 33934 0.15% 126 35527 0.16% 127 36767 0.16% 128 38700 0.17% 129 39925 0.18% 130 41284 0.18% 131 43023 0.19% 132 45179 0.20% 133 48399 0.21% 134 50938 0.22% 135 53917 0.24% 136 56756 0.25% 137 59630 0.26% 138 62970 0.28% 139 67128 0.30% 140 71796 0.32% 141 77199 0.34% 142 84950 0.37% 143 94789 0.42% 144 106902 0.47% 145 125087 0.55% 146 152787 0.67% 147 199921 0.88% 148 296342 1.30% 149 591921 2.60% 150 4331007 19.05% 151 15332594 67.46% 22729411 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=4.44 fanout-score-rank=18 prefix-density=0.77 prefix-fanout=3.3 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=52.15 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.8 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=5.85 fanout-score-rank=16 prefix-density=0.57 prefix-fanout=4.0 sequence=TGCAAGTGCGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=63.39 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.6 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958269 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:13:08 Started mapping on | Dec 06 18:13:08 Finished on | Dec 06 18:14:57 Mapping speed, Million of reads per hour | 750.70 Number of input reads | 22729411 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21579001 Uniquely mapped reads % | 94.94% Average mapped length | 297.38 Number of splices: Total | 25506290 Number of splices: Annotated (sjdb) | 24096642 Number of splices: GT/AG | 25159953 Number of splices: GC/AG | 305952 Number of splices: AT/AC | 10533 Number of splices: Non-canonical | 29852 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 335584 % of reads mapped to multiple loci | 1.48% Number of reads mapped to too many loci | 64792 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.32% % of reads unmapped: other | 1.98% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 828325 828325 828325 N_multimapping 335584 335584 335584 N_noFeature 721948 21007493 865318 N_ambiguous 513996 2618 87662 UnstrandedReadsAssigned:20343057 PositiveStrandReadsAssigned:568890 NegativeStrandReadsAssigned:20626021 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958269 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958269-trimmed-pair1.fastq SRR6958269-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,729,411 reads, 20,691,403 reads pseudoaligned [quant] estimated average fragment length: 263.512 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR6958269.ke.tsv 35125 SRR6958269.se.tsv 88098 total ==> SRR6958269.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 673.969 0 0 PNS24247 1044 781.488 72.8488 6.43922 PNS24249 1928 1665.49 90.3086 3.74559 PNS24246 1044 781.488 72.8488 6.43922 PNS24248 1044 781.488 72.8488 6.43922 PNS24244 1471 1208.49 40.1449 2.29468 PNS24243 293 83.7079 0 0 KQK14069 1603 1340.49 4679.12 241.121 KQK14071 474 225.55 91.4231 27.9992 ==> SRR6958269.se.tsv <== BRADI_1g14170v3 5282 BRADI_1g53295v3 180 BRADI_1g59795v3 339 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 413 BRADI_1g74790v3 142 BRADI_1g09890v3 0 BRADI_1g77505v3 427 BRADI_1g48960v3 0 SRR6958269 completed mapping pipeline successfully