Starting /dee2/code/volunteer_pipeline.sh SRR6958270 current disk space = 1550638731264 free memory = 1601410732 SRR6958270 SRAfilesize d2ea5fb56ceff98cc6e712e83ca465f3 SRR6958270.sra SRR6958270.sra file validated SRR6958270 is paired end SRR6958270 is conventional basespace SRR6958270 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958270_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.07175 25.0 18.0 32.0 18.0 33.0 2 22.4315 18.0 18.0 27.0 18.0 31.0 3 24.933 27.0 18.0 29.0 18.0 31.0 4 27.902 29.0 27.0 31.0 25.0 33.0 5 28.79525 32.0 27.0 32.0 15.0 33.0 6 33.228 35.0 31.0 37.0 26.0 38.0 7 35.5685 37.0 35.0 38.0 31.0 38.0 8 36.4945 38.0 37.0 38.0 34.0 38.0 9 36.954 38.0 38.0 38.0 35.0 38.0 10-14 37.19135 38.0 38.0 38.0 36.0 38.0 15-19 37.23115 38.0 38.0 38.0 36.2 38.0 20-24 37.26989999999999 38.0 38.0 38.0 36.6 38.0 25-29 37.34605 38.0 38.0 38.0 37.0 38.0 30-34 37.30165 38.0 38.0 38.0 36.8 38.0 35-39 37.238350000000004 38.0 38.0 38.0 36.6 38.0 40-44 37.14565 38.0 38.0 38.0 36.0 38.0 45-49 37.117450000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.987199999999994 38.0 38.0 38.0 35.4 38.0 55-59 36.6304 38.0 37.8 38.0 34.0 38.0 60-64 36.18635 38.0 37.0 38.0 32.8 38.0 65-69 35.715050000000005 38.0 36.2 38.0 29.8 38.0 70-74 35.76905 38.0 36.4 38.0 30.0 38.0 75-79 36.397299999999994 38.0 37.0 38.0 34.0 38.0 80-84 36.4605 38.0 37.2 38.0 34.0 38.0 85-89 36.251850000000005 38.0 37.0 38.0 33.4 38.0 90-94 36.13290000000001 38.0 37.0 38.0 33.0 38.0 95-99 35.770900000000005 38.0 36.6 38.0 31.0 38.0 100-104 35.37885 38.0 35.8 38.0 29.6 38.0 105-109 34.898900000000005 38.0 34.8 38.0 27.6 38.0 110-114 34.18805 38.0 34.0 38.0 23.2 38.0 115-119 33.7667 37.8 34.0 38.0 22.6 38.0 120-124 33.678200000000004 37.8 34.0 38.0 21.6 38.0 125-129 34.288799999999995 38.0 34.0 38.0 24.4 38.0 130-134 34.10765000000001 38.0 34.0 38.0 23.0 38.0 135-139 33.85095 38.0 34.0 38.0 22.2 38.0 140-144 33.32685 38.0 33.6 38.0 19.0 38.0 145-149 32.16175 37.2 32.6 38.0 11.8 38.0 150-151 26.89125 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 2.0 18 1.0 19 3.0 20 2.0 21 6.0 22 5.0 23 6.0 24 11.0 25 16.0 26 20.0 27 35.0 28 47.0 29 55.0 30 73.0 31 108.0 32 179.0 33 261.0 34 354.0 35 638.0 36 1284.0 37 892.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.219249934434824 18.856543404143718 6.504065040650407 46.42014162077104 2 18.925 21.525 25.5 34.050000000000004 3 24.2 18.475 25.3 32.025 4 28.4 23.75 21.15 26.700000000000003 5 24.2 30.55 22.1 23.150000000000002 6 21.85 33.375 24.3 20.474999999999998 7 15.9 24.099999999999998 40.875 19.125 8 19.6 25.374999999999996 28.15 26.875 9 20.175 21.575 33.7 24.55 10-14 22.134999999999998 27.16 25.915 24.79 15-19 22.31 25.540000000000003 26.695 25.455 20-24 22.12 26.419999999999998 27.05 24.41 25-29 22.125 26.265 26.66 24.95 30-34 22.93 26.16 26.44 24.47 35-39 22.18 26.384999999999998 26.52 24.915000000000003 40-44 22.41 26.22 26.405 24.965 45-49 22.465 25.95 26.090000000000003 25.495 50-54 22.175 25.865 26.33 25.629999999999995 55-59 22.384999999999998 26.174999999999997 26.295 25.145 60-64 22.455 25.785000000000004 26.605 25.155 65-69 22.57 26.015 26.165 25.25 70-74 22.935 25.705 25.790000000000003 25.569999999999997 75-79 23.09 25.915 25.874999999999996 25.119999999999997 80-84 22.400000000000002 26.534999999999997 25.790000000000003 25.275 85-89 22.21 25.259999999999998 26.82 25.71 90-94 22.675 26.484999999999996 25.685000000000002 25.155 95-99 22.175 26.05 26.61 25.165 100-104 23.28 26.245 25.53 24.945 105-109 23.064999999999998 25.27 26.415 25.25 110-114 23.385 25.240000000000002 26.340000000000003 25.035 115-119 23.515 25.759999999999998 25.735000000000003 24.990000000000002 120-124 22.915 25.755 26.125 25.205 125-129 22.89 25.205 26.634999999999998 25.27 130-134 23.24 24.865000000000002 26.240000000000002 25.655 135-139 22.78 25.955000000000002 26.0 25.264999999999997 140-144 23.135 25.34 26.52 25.005 145-149 23.235 25.724999999999998 25.509999999999998 25.53 150-151 23.225 24.887500000000003 26.437500000000004 25.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 1.0 27 2.5 28 3.0 29 4.0 30 6.0 31 11.5 32 14.0 33 20.0 34 30.0 35 38.0 36 50.0 37 71.5 38 95.5 39 115.5 40 153.0 41 181.0 42 189.0 43 197.5 44 222.5 45 233.0 46 230.0 47 225.5 48 210.5 49 196.0 50 166.0 51 154.0 52 145.0 53 116.5 54 98.5 55 91.5 56 81.5 57 76.0 58 66.5 59 60.0 60 59.0 61 44.5 62 42.0 63 49.0 64 45.0 65 33.5 66 32.0 67 29.5 68 17.5 69 14.5 70 17.5 71 16.0 72 10.5 73 10.0 74 7.5 75 3.5 76 3.5 77 3.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 0.9625 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.25 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.8875 0.0 0.0 0.0 0.0 128-129 2.0875 0.0 0.0 0.0 0.0 130-131 2.275 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.725 0.0 0.0 0.0 0.0 136-137 3.0625 0.0 0.0 0.0 0.0 138-139 3.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAGAG 10 0.0060887975 150.61038 1 TCACTTG 10 0.006836113 144.9625 8 >>END_MODULE SRR6958270 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958270_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98975 33.0 33.0 34.0 32.0 34.0 2 33.0035 34.0 33.0 34.0 32.0 34.0 3 33.0095 34.0 33.0 34.0 32.0 34.0 4 33.01925 34.0 33.0 34.0 32.0 34.0 5 33.00225 34.0 33.0 34.0 32.0 34.0 6 36.963 38.0 38.0 38.0 36.0 38.0 7 36.9205 38.0 38.0 38.0 36.0 38.0 8 36.8285 38.0 38.0 38.0 36.0 38.0 9 36.895 38.0 38.0 38.0 36.0 38.0 10-14 36.85215 38.0 38.0 38.0 36.0 38.0 15-19 37.0053 38.0 38.0 38.0 36.2 38.0 20-24 37.05409999999999 38.0 38.0 38.0 36.4 38.0 25-29 37.0366 38.0 38.0 38.0 36.0 38.0 30-34 36.92445 38.0 38.0 38.0 36.0 38.0 35-39 36.8155 38.0 38.0 38.0 35.8 38.0 40-44 36.7774 38.0 38.0 38.0 35.2 38.0 45-49 36.762299999999996 38.0 38.0 38.0 35.2 38.0 50-54 36.71939999999999 38.0 38.0 38.0 35.0 38.0 55-59 36.7043 38.0 38.0 38.0 35.0 38.0 60-64 36.678000000000004 38.0 38.0 38.0 35.0 38.0 65-69 36.6002 38.0 38.0 38.0 34.6 38.0 70-74 36.574799999999996 38.0 38.0 38.0 34.2 38.0 75-79 36.502950000000006 38.0 38.0 38.0 34.0 38.0 80-84 36.29665000000001 38.0 38.0 38.0 33.8 38.0 85-89 36.192099999999996 38.0 38.0 38.0 33.6 38.0 90-94 36.123900000000006 38.0 37.8 38.0 33.0 38.0 95-99 36.003 38.0 37.2 38.0 33.0 38.0 100-104 35.87245 38.0 37.0 38.0 32.6 38.0 105-109 35.470000000000006 38.0 36.4 38.0 30.2 38.0 110-114 35.231100000000005 38.0 36.0 38.0 29.0 38.0 115-119 34.924249999999994 38.0 35.2 38.0 27.8 38.0 120-124 34.5644 38.0 35.0 38.0 25.8 38.0 125-129 34.166999999999994 38.0 34.6 38.0 23.2 38.0 130-134 33.294399999999996 37.8 33.6 38.0 18.6 38.0 135-139 32.034 36.4 31.4 38.0 14.2 38.0 140-144 31.751849999999997 36.0 31.0 38.0 13.8 38.0 145-149 31.652499999999996 37.2 31.6 38.0 11.2 38.0 150-151 27.1305 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 7.0 4 2.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 2.0 13 1.0 14 4.0 15 2.0 16 1.0 17 3.0 18 6.0 19 3.0 20 10.0 21 11.0 22 8.0 23 9.0 24 11.0 25 17.0 26 23.0 27 29.0 28 39.0 29 43.0 30 67.0 31 90.0 32 118.0 33 157.0 34 260.0 35 424.0 36 893.0 37 1749.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.9 19.6 13.475000000000001 30.025000000000002 2 30.475 24.025 26.650000000000002 18.85 3 24.375 26.775 26.724999999999998 22.125 4 25.6 31.624999999999996 20.825 21.95 5 26.200000000000003 33.900000000000006 20.8 19.1 6 22.525000000000002 35.0 21.25 21.224999999999998 7 21.875 20.925 36.075 21.125 8 24.075 24.175 23.400000000000002 28.349999999999998 9 23.025000000000002 23.775 27.950000000000003 25.25 10-14 25.16 26.61 24.27 23.96 15-19 25.295 26.165 24.959999999999997 23.580000000000002 20-24 25.259999999999998 25.885 25.165 23.69 25-29 25.119999999999997 26.305 24.585 23.990000000000002 30-34 25.669999999999998 26.700000000000003 24.745 22.884999999999998 35-39 25.645 25.71 25.255 23.39 40-44 25.540000000000003 26.200000000000003 24.93 23.330000000000002 45-49 25.39 26.375 24.68 23.555 50-54 25.52 26.36 24.834999999999997 23.285 55-59 25.53 25.555 25.509999999999998 23.405 60-64 25.180000000000003 26.229999999999997 24.75 23.84 65-69 25.47 25.869999999999997 25.31 23.35 70-74 25.595000000000002 25.81 25.295 23.3 75-79 25.555 26.56 24.935 22.95 80-84 25.674999999999997 25.655 25.369999999999997 23.3 85-89 25.585 25.430000000000003 25.5 23.485 90-94 24.765 25.580000000000002 26.075 23.580000000000002 95-99 25.585 25.874999999999996 25.669999999999998 22.869999999999997 100-104 25.8 25.990000000000002 25.25 22.96 105-109 24.865000000000002 26.200000000000003 25.455 23.48 110-114 25.785000000000004 26.179999999999996 24.85 23.185 115-119 25.679999999999996 25.86 24.855 23.605 120-124 25.674999999999997 26.68 25.195 22.45 125-129 25.535000000000004 25.629999999999995 25.6 23.235 130-134 26.119999999999997 26.245 25.729999999999997 21.905 135-139 25.759999999999998 26.474999999999998 24.735 23.03 140-144 25.637563756375638 27.102710271027103 24.64246424642464 22.617261726172615 145-149 26.655 26.284999999999997 24.709999999999997 22.35 150-151 25.7125 26.424999999999997 25.3125 22.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.5 25 0.5 26 1.0 27 2.5 28 3.0 29 5.0 30 7.5 31 10.5 32 12.0 33 14.5 34 22.0 35 28.5 36 41.0 37 60.0 38 77.0 39 107.0 40 135.5 41 150.5 42 179.5 43 205.5 44 204.5 45 216.0 46 219.5 47 205.5 48 209.0 49 198.5 50 168.0 51 160.0 52 142.0 53 106.0 54 94.0 55 98.5 56 104.0 57 87.5 58 72.0 59 69.5 60 63.0 61 64.0 62 60.5 63 46.5 64 44.0 65 43.0 66 43.5 67 44.0 68 38.0 69 32.5 70 25.0 71 18.0 72 14.5 73 14.0 74 12.0 75 7.5 76 3.5 77 1.5 78 1.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.1125 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.4500000000000002 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.125 0.0 0.0 0.0 0.0 130-131 2.3 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.7375 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753776 spots for SRR6958270.sra Written 753776 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra Read 753771 spots for SRR6958270.sra Written 753771 spots for SRR6958270.sra SRR ids: ['SRR6958270.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vnbkuzvl SRR6958270.sra spots: 15075425 blocks: [[1, 753771], [753772, 1507542], [1507543, 2261313], [2261314, 3015084], [3015085, 3768855], [3768856, 4522626], [4522627, 5276397], [5276398, 6030168], [6030169, 6783939], [6783940, 7537710], [7537711, 8291481], [8291482, 9045252], [9045253, 9799023], [9799024, 10552794], [10552795, 11306565], [11306566, 12060336], [12060337, 12814107], [12814108, 13567878], [13567879, 14321649], [14321650, 15075425]] SRR6958270 file size 5086866 SRR6958270 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958270 SRR6958270_1.fastq SRR6958270_2.fastq Input file: SRR6958270_1.fastq Paired file: SRR6958270_2.fastq trimmed: SRR6958270-trimmed-pair1.fastq, SRR6958270-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:15:46 2024 >> started Fri Dec 6 18:16:08 2024 >> done (21.506s) 15075425 read pairs processed; of these: 12040 ( 0.08%) short read pairs filtered out after trimming by size control 8950 ( 0.06%) empty read pairs filtered out after trimming by size control 15054435 (99.86%) read pairs available; of these: 6057293 (40.24%) trimmed read pairs available after processing 8997142 (59.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 7 0.00% 23 6 0.00% 24 8 0.00% 25 2 0.00% 26 6 0.00% 27 4 0.00% 28 3 0.00% 29 3 0.00% 30 3 0.00% 31 5 0.00% 32 3 0.00% 33 4 0.00% 34 4 0.00% 35 5 0.00% 36 3 0.00% 37 5 0.00% 38 8 0.00% 39 10 0.00% 40 4 0.00% 41 9 0.00% 42 9 0.00% 43 12 0.00% 44 8 0.00% 45 12 0.00% 46 16 0.00% 47 12 0.00% 48 4 0.00% 49 27 0.00% 50 19 0.00% 51 17 0.00% 52 28 0.00% 53 27 0.00% 54 35 0.00% 55 30 0.00% 56 33 0.00% 57 40 0.00% 58 43 0.00% 59 58 0.00% 60 62 0.00% 61 53 0.00% 62 64 0.00% 63 93 0.00% 64 113 0.00% 65 133 0.00% 66 147 0.00% 67 123 0.00% 68 163 0.00% 69 169 0.00% 70 196 0.00% 71 227 0.00% 72 262 0.00% 73 289 0.00% 74 317 0.00% 75 414 0.00% 76 423 0.00% 77 514 0.00% 78 528 0.00% 79 628 0.00% 80 663 0.00% 81 825 0.01% 82 924 0.01% 83 1076 0.01% 84 1749 0.01% 85 2071 0.01% 86 2139 0.01% 87 2370 0.02% 88 2427 0.02% 89 2498 0.02% 90 2702 0.02% 91 2862 0.02% 92 3120 0.02% 93 3359 0.02% 94 3652 0.02% 95 3853 0.03% 96 4060 0.03% 97 4465 0.03% 98 4769 0.03% 99 4883 0.03% 100 5432 0.04% 101 5861 0.04% 102 6258 0.04% 103 6785 0.05% 104 7443 0.05% 105 7620 0.05% 106 8223 0.05% 107 8435 0.06% 108 9006 0.06% 109 9667 0.06% 110 10091 0.07% 111 10909 0.07% 112 11469 0.08% 113 12330 0.08% 114 13147 0.09% 115 13970 0.09% 116 14715 0.10% 117 15639 0.10% 118 15937 0.11% 119 16678 0.11% 120 17743 0.12% 121 18501 0.12% 122 19901 0.13% 123 20816 0.14% 124 22224 0.15% 125 23148 0.15% 126 24913 0.17% 127 25944 0.17% 128 26811 0.18% 129 28658 0.19% 130 30215 0.20% 131 31921 0.21% 132 34656 0.23% 133 37298 0.25% 134 39431 0.26% 135 43103 0.29% 136 46779 0.31% 137 50436 0.34% 138 54739 0.36% 139 60708 0.40% 140 66404 0.44% 141 73176 0.49% 142 80931 0.54% 143 88004 0.58% 144 96191 0.64% 145 108270 0.72% 146 130826 0.87% 147 182768 1.21% 148 297628 1.98% 149 634449 4.21% 150 3371161 22.39% 151 8997142 59.76% 15054435 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=23 prefix-density=0.52 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=160.14 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.3 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=25 prefix-density=0.44 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=564.19 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=17.6 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958270 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:16:51 Started mapping on | Dec 06 18:16:54 Finished on | Dec 06 18:18:20 Mapping speed, Million of reads per hour | 630.19 Number of input reads | 15054435 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14574669 Uniquely mapped reads % | 96.81% Average mapped length | 297.05 Number of splices: Total | 16994632 Number of splices: Annotated (sjdb) | 16013309 Number of splices: GT/AG | 16778343 Number of splices: GC/AG | 198405 Number of splices: AT/AC | 6796 Number of splices: Non-canonical | 11088 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 107341 % of reads mapped to multiple loci | 0.71% Number of reads mapped to too many loci | 14648 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.77% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 380430 380430 380430 N_multimapping 107341 107341 107341 N_noFeature 509635 14173303 619178 N_ambiguous 344306 1856 53280 UnstrandedReadsAssigned:13720728 PositiveStrandReadsAssigned:399510 NegativeStrandReadsAssigned:13902211 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958270 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958270-trimmed-pair1.fastq SRR6958270-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,054,435 reads, 13,926,672 reads pseudoaligned [quant] estimated average fragment length: 267.044 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR6958270.ke.tsv 35125 SRR6958270.se.tsv 88098 total ==> SRR6958270.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.364 0 0 PNS24247 1044 777.956 43.567 6.23888 PNS24249 1928 1661.96 44.5244 2.98457 PNS24246 1044 777.956 43.567 6.23888 PNS24248 1044 777.956 43.567 6.23888 PNS24244 1471 1204.96 22.7746 2.10563 PNS24243 293 81.5415 0 0 KQK14069 1603 1336.96 2876.73 239.71 KQK14071 474 221.876 54.9476 27.5893 ==> SRR6958270.se.tsv <== BRADI_1g14170v3 3342 BRADI_1g53295v3 318 BRADI_1g59795v3 193 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 226 BRADI_1g74790v3 59 BRADI_1g09890v3 0 BRADI_1g77505v3 173 BRADI_1g48960v3 0 SRR6958270 completed mapping pipeline successfully