Starting /dee2/code/volunteer_pipeline.sh SRR6958271 current disk space = 1550518251520 free memory = 1599920004 SRR6958271 SRAfilesize 90fac58da9a247aac046c115b413bcee SRR6958271.sra SRR6958271.sra file validated SRR6958271 is paired end SRR6958271 is conventional basespace SRR6958271 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958271_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.50525 33.0 32.0 33.0 2.0 33.0 2 29.809 31.0 28.0 33.0 25.0 33.0 3 30.84525 33.0 29.0 33.0 27.0 33.0 4 31.76675 33.0 32.0 33.0 30.0 33.0 5 32.45125 33.0 33.0 33.0 32.0 34.0 6 36.65075 38.0 37.0 38.0 34.0 38.0 7 37.11775 38.0 38.0 38.0 36.0 38.0 8 37.352 38.0 38.0 38.0 37.0 38.0 9 37.3895 38.0 38.0 38.0 37.0 38.0 10-14 37.28605 38.0 38.0 38.0 36.6 38.0 15-19 37.2465 38.0 38.0 38.0 36.6 38.0 20-24 36.6882 38.0 37.8 38.0 34.0 38.0 25-29 36.74025 38.0 38.0 38.0 34.8 38.0 30-34 37.1482 38.0 38.0 38.0 36.4 38.0 35-39 37.310249999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.25765 38.0 38.0 38.0 36.8 38.0 45-49 37.21065 38.0 38.0 38.0 36.6 38.0 50-54 37.0356 38.0 38.0 38.0 36.2 38.0 55-59 36.92059999999999 38.0 38.0 38.0 35.2 38.0 60-64 37.00315 38.0 38.0 38.0 35.8 38.0 65-69 37.06205 38.0 38.0 38.0 36.0 38.0 70-74 37.0886 38.0 38.0 38.0 36.0 38.0 75-79 37.04325 38.0 38.0 38.0 35.8 38.0 80-84 37.0028 38.0 38.0 38.0 35.4 38.0 85-89 36.44975000000001 38.0 38.0 38.0 34.0 38.0 90-94 35.980650000000004 38.0 37.4 38.0 32.2 38.0 95-99 35.0423 38.0 36.0 38.0 26.4 38.0 100-104 34.85675 38.0 35.6 38.0 25.4 38.0 105-109 34.80265 38.0 35.4 38.0 25.4 38.0 110-114 35.34075 38.0 36.0 38.0 28.4 38.0 115-119 35.71105 38.0 36.4 38.0 31.0 38.0 120-124 36.014300000000006 38.0 37.0 38.0 33.0 38.0 125-129 35.973699999999994 38.0 36.6 38.0 33.2 38.0 130-134 35.810900000000004 38.0 36.4 38.0 32.2 38.0 135-139 35.37075 38.0 36.0 38.0 31.0 38.0 140-144 34.547349999999994 38.0 34.4 38.0 27.2 38.0 145-149 32.44785 38.0 31.8 38.0 18.2 38.0 150-151 28.32175 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 2.0 13 0.0 14 2.0 15 2.0 16 2.0 17 0.0 18 2.0 19 0.0 20 2.0 21 0.0 22 2.0 23 5.0 24 8.0 25 13.0 26 24.0 27 19.0 28 38.0 29 62.0 30 66.0 31 94.0 32 123.0 33 146.0 34 198.0 35 321.0 36 777.0 37 2090.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.29113218070273 9.676519799219186 8.282208588957054 35.75013943112103 2 26.125 13.450000000000001 31.7 28.725 3 22.6 19.0 24.95 33.45 4 28.025 24.975 22.575 24.425 5 25.074999999999996 29.425 24.224999999999998 21.275 6 22.575 32.0 23.724999999999998 21.7 7 17.325 23.175 39.825 19.675 8 19.725 23.05 29.299999999999997 27.925 9 19.975 22.0 33.6 24.425 10-14 23.57 26.365 25.44 24.625 15-19 23.49469893978796 24.889977995599118 26.16023204640928 25.45509101820364 20-24 21.84 26.105 26.195 25.86 25-29 23.330000000000002 25.374999999999996 25.915 25.380000000000003 30-34 23.02 25.445 26.529999999999998 25.005 35-39 23.18 25.45 25.919999999999998 25.45 40-44 22.445 25.674999999999997 25.88 26.0 45-49 22.415 25.165 26.395000000000003 26.025 50-54 23.485 25.8 25.369999999999997 25.345000000000002 55-59 23.195 25.779999999999998 25.95 25.074999999999996 60-64 23.07 25.03 25.465 26.435 65-69 23.25 25.380000000000003 25.790000000000003 25.580000000000002 70-74 23.39 25.290000000000003 26.13 25.19 75-79 23.23 25.224999999999998 25.81 25.735000000000003 80-84 23.505000000000003 25.355 25.255 25.885 85-89 23.345 25.275 25.590000000000003 25.790000000000003 90-94 23.29 25.455 25.835 25.419999999999998 95-99 23.189999999999998 24.825 25.83 26.155 100-104 24.085 24.605 25.66 25.650000000000002 105-109 23.885 24.635 26.095000000000002 25.385 110-114 23.235 24.93 25.735000000000003 26.1 115-119 23.165 25.035 25.72 26.08 120-124 23.86 24.560000000000002 26.135 25.445 125-129 23.43 24.7 26.540000000000003 25.330000000000002 130-134 23.41 24.905 25.46 26.224999999999998 135-139 24.3 24.395 25.785000000000004 25.52 140-144 24.15 25.009999999999998 25.380000000000003 25.46 145-149 24.060000000000002 24.505 25.905 25.53 150-151 23.275000000000002 24.275 25.9875 26.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 0.5 24 0.0 25 0.5 26 1.0 27 3.0 28 2.5 29 4.0 30 8.5 31 10.5 32 13.0 33 19.0 34 29.5 35 32.0 36 45.5 37 63.5 38 81.0 39 103.0 40 125.5 41 150.5 42 173.5 43 197.5 44 209.0 45 212.5 46 218.5 47 218.0 48 193.0 49 165.5 50 155.5 51 157.5 52 147.5 53 124.0 54 110.0 55 97.0 56 90.5 57 83.5 58 74.5 59 74.5 60 77.5 61 60.0 62 48.0 63 58.0 64 61.0 65 53.5 66 41.5 67 35.5 68 34.5 69 32.5 70 24.5 71 16.5 72 16.0 73 16.5 74 11.0 75 6.0 76 2.5 77 2.0 78 1.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.02 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.2625 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 2.025 0.0 0.0 0.0 0.0 128-129 2.2750000000000004 0.0 0.0 0.0 0.0 130-131 2.5374999999999996 0.0 0.0 0.0 0.0 132-133 2.9625 0.0 0.0 0.0 0.0 134-135 3.2750000000000004 0.0 0.0 0.0 0.0 136-137 3.5125 0.0 0.0 0.0 0.0 138-139 3.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958271 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958271_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.64375 33.0 33.0 34.0 32.0 34.0 2 32.8145 33.0 33.0 34.0 32.0 34.0 3 32.8445 33.0 33.0 34.0 32.0 34.0 4 32.78725 34.0 33.0 34.0 32.0 34.0 5 32.88525 34.0 33.0 34.0 32.0 34.0 6 36.88075 38.0 38.0 38.0 36.0 38.0 7 36.83825 38.0 38.0 38.0 36.0 38.0 8 36.7055 38.0 38.0 38.0 35.0 38.0 9 36.69725 38.0 38.0 38.0 35.0 38.0 10-14 36.4561 38.0 38.0 38.0 34.2 38.0 15-19 36.32430000000001 38.0 38.0 38.0 33.4 38.0 20-24 36.47234999999999 38.0 38.0 38.0 34.2 38.0 25-29 36.60685 38.0 38.0 38.0 34.8 38.0 30-34 36.8581 38.0 38.0 38.0 36.0 38.0 35-39 36.92065 38.0 38.0 38.0 36.0 38.0 40-44 36.8959 38.0 38.0 38.0 35.8 38.0 45-49 36.7129 38.0 38.0 38.0 35.0 38.0 50-54 36.3275 38.0 38.0 38.0 33.6 38.0 55-59 36.26525 38.0 38.0 38.0 33.4 38.0 60-64 36.597449999999995 38.0 38.0 38.0 34.8 38.0 65-69 36.25605 38.0 38.0 38.0 33.6 38.0 70-74 36.015950000000004 38.0 37.8 38.0 32.2 38.0 75-79 35.83815 38.0 37.8 38.0 32.2 38.0 80-84 35.5271 38.0 37.0 38.0 30.0 38.0 85-89 35.3654 38.0 37.0 38.0 29.2 38.0 90-94 35.904199999999996 38.0 37.6 38.0 32.6 38.0 95-99 36.011199999999995 38.0 38.0 38.0 33.0 38.0 100-104 36.031400000000005 38.0 38.0 38.0 33.4 38.0 105-109 36.0338 38.0 37.8 38.0 33.4 38.0 110-114 35.736050000000006 38.0 37.0 38.0 32.0 38.0 115-119 35.32025 38.0 36.4 38.0 29.8 38.0 120-124 33.74545 37.8 34.0 38.0 21.2 38.0 125-129 33.475049999999996 38.0 33.0 38.0 19.0 38.0 130-134 27.964999999999996 31.0 19.8 36.8 13.6 38.0 135-139 33.5116 37.8 32.6 38.0 22.2 38.0 140-144 33.856 38.0 33.2 38.0 23.8 38.0 145-149 33.15575 38.0 33.0 38.0 17.2 38.0 150-151 27.82675 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 1.0 4 1.0 5 1.0 6 0.0 7 1.0 8 1.0 9 1.0 10 1.0 11 3.0 12 2.0 13 2.0 14 5.0 15 3.0 16 2.0 17 1.0 18 6.0 19 6.0 20 7.0 21 10.0 22 12.0 23 12.0 24 29.0 25 22.0 26 36.0 27 40.0 28 57.0 29 72.0 30 61.0 31 102.0 32 116.0 33 147.0 34 213.0 35 338.0 36 839.0 37 1836.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.35 18.775 10.875 30.0 2 29.425 23.724999999999998 27.700000000000003 19.15 3 21.8 25.650000000000002 27.125 25.424999999999997 4 25.674999999999997 32.074999999999996 20.025000000000002 22.225 5 26.5 33.85 19.775000000000002 19.875 6 23.575 35.125 20.325 20.974999999999998 7 22.375 19.15 34.275 24.2 8 23.25 22.675 23.974999999999998 30.099999999999998 9 22.825 22.875 26.75 27.55 10-14 25.679999999999996 25.929999999999996 23.71 24.68 15-19 25.89 25.4 24.245 24.465 20-24 25.924999999999997 25.56 24.46 24.055 25-29 25.645 26.035000000000004 24.13 24.19 30-34 24.85 25.990000000000002 24.345 24.815 35-39 25.895000000000003 25.650000000000002 24.015 24.44 40-44 26.025 25.36 23.599999999999998 25.014999999999997 45-49 25.729999999999997 25.845000000000002 24.315 24.11 50-54 26.375 25.635 24.09 23.9 55-59 26.05 25.624999999999996 24.275 24.05 60-64 25.825 25.564999999999998 24.54 24.07 65-69 25.564999999999998 25.885 23.825 24.725 70-74 26.165 25.025 24.505 24.305 75-79 25.915 25.674999999999997 24.060000000000002 24.349999999999998 80-84 26.064999999999998 26.400000000000002 24.495 23.04 85-89 26.055 25.75 24.205 23.990000000000002 90-94 25.735000000000003 25.629999999999995 24.95 23.685000000000002 95-99 25.805 25.790000000000003 25.39 23.015 100-104 25.779999999999998 25.985000000000003 24.305 23.93 105-109 26.135 26.08 24.099999999999998 23.685000000000002 110-114 25.85 25.785000000000004 24.654999999999998 23.71 115-119 26.765 25.36 24.265 23.61 120-124 25.56 25.924999999999997 24.4 24.115000000000002 125-129 26.05 26.16 24.565 23.225 130-134 26.405 25.635 24.315 23.645 135-139 26.66 26.015 24.58 22.745 140-144 26.740000000000002 26.235000000000003 24.5 22.525000000000002 145-149 25.990000000000002 26.14 24.555 23.315 150-151 25.8 26.687499999999996 24.575 22.9375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.5 26 2.0 27 2.5 28 5.5 29 5.5 30 5.5 31 9.0 32 12.5 33 18.0 34 26.5 35 28.5 36 39.5 37 49.0 38 61.5 39 89.5 40 113.0 41 132.5 42 157.0 43 177.0 44 184.0 45 188.5 46 195.0 47 193.5 48 178.5 49 173.0 50 173.5 51 165.0 52 143.0 53 119.0 54 110.0 55 109.0 56 100.5 57 90.5 58 97.0 59 101.5 60 87.5 61 79.0 62 73.5 63 68.5 64 69.0 65 62.0 66 54.0 67 48.5 68 40.0 69 33.0 70 29.5 71 21.5 72 17.5 73 15.0 74 11.5 75 11.0 76 6.0 77 3.5 78 3.0 79 2.0 80 1.5 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4275653923541248 0.8500000000000001 3 0.05030181086519115 0.15 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.2 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 2.0 0.0 0.0 0.0 0.0 130-131 2.225 0.0 0.0 0.0 0.0 132-133 2.6375 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.1875 0.0 0.0 0.0 0.0 138-139 3.4000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1253033 spots for SRR6958271.sra Written 1253033 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra Read 1253020 spots for SRR6958271.sra Written 1253020 spots for SRR6958271.sra SRR ids: ['SRR6958271.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fp5b02he SRR6958271.sra spots: 25060413 blocks: [[1, 1253020], [1253021, 2506040], [2506041, 3759060], [3759061, 5012080], [5012081, 6265100], [6265101, 7518120], [7518121, 8771140], [8771141, 10024160], [10024161, 11277180], [11277181, 12530200], [12530201, 13783220], [13783221, 15036240], [15036241, 16289260], [16289261, 17542280], [17542281, 18795300], [18795301, 20048320], [20048321, 21301340], [21301341, 22554360], [22554361, 23807380], [23807381, 25060413]] SRR6958271 file size 8470451 SRR6958271 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958271 SRR6958271_1.fastq SRR6958271_2.fastq Input file: SRR6958271_1.fastq Paired file: SRR6958271_2.fastq trimmed: SRR6958271-trimmed-pair1.fastq, SRR6958271-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:21:37 2024 >> started Fri Dec 6 18:22:02 2024 >> done (25.438s) 25060413 read pairs processed; of these: 30837 ( 0.12%) short read pairs filtered out after trimming by size control 23656 ( 0.09%) empty read pairs filtered out after trimming by size control 25005920 (99.78%) read pairs available; of these: 9280425 (37.11%) trimmed read pairs available after processing 15725495 (62.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 8 0.00% 21 5 0.00% 22 6 0.00% 23 5 0.00% 24 10 0.00% 25 2 0.00% 26 3 0.00% 27 7 0.00% 28 8 0.00% 29 8 0.00% 30 7 0.00% 31 4 0.00% 32 12 0.00% 33 15 0.00% 34 7 0.00% 35 6 0.00% 36 8 0.00% 37 5 0.00% 38 12 0.00% 39 14 0.00% 40 6 0.00% 41 9 0.00% 42 19 0.00% 43 26 0.00% 44 12 0.00% 45 28 0.00% 46 18 0.00% 47 34 0.00% 48 30 0.00% 49 34 0.00% 50 35 0.00% 51 38 0.00% 52 49 0.00% 53 67 0.00% 54 56 0.00% 55 70 0.00% 56 67 0.00% 57 74 0.00% 58 87 0.00% 59 92 0.00% 60 117 0.00% 61 125 0.00% 62 163 0.00% 63 172 0.00% 64 188 0.00% 65 220 0.00% 66 226 0.00% 67 254 0.00% 68 289 0.00% 69 339 0.00% 70 382 0.00% 71 408 0.00% 72 491 0.00% 73 590 0.00% 74 655 0.00% 75 669 0.00% 76 787 0.00% 77 897 0.00% 78 994 0.00% 79 1237 0.00% 80 1337 0.01% 81 1514 0.01% 82 1780 0.01% 83 2027 0.01% 84 3326 0.01% 85 4265 0.02% 86 4439 0.02% 87 4663 0.02% 88 4838 0.02% 89 4835 0.02% 90 5173 0.02% 91 5520 0.02% 92 5878 0.02% 93 6312 0.03% 94 6848 0.03% 95 7408 0.03% 96 7469 0.03% 97 8142 0.03% 98 8563 0.03% 99 9252 0.04% 100 9861 0.04% 101 10317 0.04% 102 11270 0.05% 103 11984 0.05% 104 12919 0.05% 105 13724 0.05% 106 14487 0.06% 107 15174 0.06% 108 15903 0.06% 109 16662 0.07% 110 17602 0.07% 111 18819 0.08% 112 20169 0.08% 113 21102 0.08% 114 22811 0.09% 115 24097 0.10% 116 25157 0.10% 117 26249 0.10% 118 27041 0.11% 119 28079 0.11% 120 29558 0.12% 121 30958 0.12% 122 32463 0.13% 123 34316 0.14% 124 36588 0.15% 125 38457 0.15% 126 40501 0.16% 127 41906 0.17% 128 43239 0.17% 129 45224 0.18% 130 47095 0.19% 131 49612 0.20% 132 52867 0.21% 133 56184 0.22% 134 59502 0.24% 135 64049 0.26% 136 66782 0.27% 137 71755 0.29% 138 75940 0.30% 139 81739 0.33% 140 87206 0.35% 141 96083 0.38% 142 107876 0.43% 143 121926 0.49% 144 140630 0.56% 145 168680 0.67% 146 211027 0.84% 147 288912 1.16% 148 437820 1.75% 149 853351 3.41% 150 5290950 21.16% 151 15725495 62.89% 25005920 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=19 prefix-density=0.95 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=33.31 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=14 prefix-density=0.73 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=31.29 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=4.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958271 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:25:34 Started mapping on | Dec 06 18:25:35 Finished on | Dec 06 18:28:12 Mapping speed, Million of reads per hour | 573.38 Number of input reads | 25005920 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 24161465 Uniquely mapped reads % | 96.62% Average mapped length | 296.95 Number of splices: Total | 27705247 Number of splices: Annotated (sjdb) | 26106689 Number of splices: GT/AG | 27330901 Number of splices: GC/AG | 328499 Number of splices: AT/AC | 9881 Number of splices: Non-canonical | 35966 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223686 % of reads mapped to multiple loci | 0.89% Number of reads mapped to too many loci | 20591 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 639921 639921 639921 N_multimapping 223686 223686 223686 N_noFeature 800752 23467116 991801 N_ambiguous 604066 3403 102285 UnstrandedReadsAssigned:22756647 PositiveStrandReadsAssigned:690946 NegativeStrandReadsAssigned:23067379 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958271 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958271-trimmed-pair1.fastq SRR6958271-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,005,920 reads, 23,073,505 reads pseudoaligned [quant] estimated average fragment length: 266.892 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR6958271.ke.tsv 35125 SRR6958271.se.tsv 88098 total ==> SRR6958271.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.639 3.10991 0.288903 PNS24247 1044 778.108 90.2185 7.22352 PNS24249 1928 1662.11 78.2108 2.93157 PNS24246 1044 778.108 90.2185 7.22352 PNS24248 1044 778.108 90.2185 7.22352 PNS24244 1471 1205.11 20.0239 1.03518 PNS24243 293 83.1032 0 0 KQK14069 1603 1337.11 8216.81 382.851 KQK14071 474 223.068 146.623 40.9503 ==> SRR6958271.se.tsv <== BRADI_1g14170v3 9337 BRADI_1g53295v3 281 BRADI_1g59795v3 328 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 260 BRADI_1g74790v3 126 BRADI_1g09890v3 0 BRADI_1g77505v3 294 BRADI_1g48960v3 0 SRR6958271 completed mapping pipeline successfully