Starting /dee2/code/volunteer_pipeline.sh SRR6958272 current disk space = 1549826650112 free memory = 1377700076 SRR6958272 SRAfilesize 8569db76a9c72da222e4a51974b67012 SRR6958272.sra SRR6958272.sra file validated SRR6958272 is paired end SRR6958272 is conventional basespace SRR6958272 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958272_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.99075 18.0 18.0 18.0 18.0 32.0 2 21.0865 18.0 18.0 25.0 18.0 30.0 3 27.495 27.0 27.0 29.0 25.0 31.0 4 31.3895 32.0 32.0 33.0 27.0 33.0 5 32.458 33.0 33.0 33.0 32.0 33.0 6 33.77075 37.0 34.0 38.0 16.0 38.0 7 36.0655 38.0 36.0 38.0 31.0 38.0 8 36.766 38.0 37.0 38.0 34.0 38.0 9 37.27975 38.0 38.0 38.0 36.0 38.0 10-14 37.41695 38.0 38.0 38.0 37.0 38.0 15-19 37.4077 38.0 38.0 38.0 37.0 38.0 20-24 37.34675 38.0 38.0 38.0 37.2 38.0 25-29 37.17405 38.0 38.0 38.0 36.6 38.0 30-34 37.250299999999996 38.0 38.0 38.0 36.6 38.0 35-39 37.14955 38.0 38.0 38.0 36.2 38.0 40-44 37.4527 38.0 38.0 38.0 37.6 38.0 45-49 37.382349999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.304849999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.26125 38.0 38.0 38.0 36.8 38.0 60-64 37.39085 38.0 38.0 38.0 37.0 38.0 65-69 36.72535 38.0 37.4 38.0 34.0 38.0 70-74 37.2912 38.0 38.0 38.0 36.6 38.0 75-79 37.24175 38.0 38.0 38.0 36.8 38.0 80-84 37.16510000000001 38.0 38.0 38.0 36.4 38.0 85-89 36.938649999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.5422 38.0 38.0 38.0 34.4 38.0 95-99 34.74965 38.0 34.8 38.0 26.0 38.0 100-104 36.11385 38.0 37.6 38.0 33.2 38.0 105-109 35.92885 38.0 37.0 38.0 32.2 38.0 110-114 35.853750000000005 38.0 37.0 38.0 31.8 38.0 115-119 36.26765 38.0 37.8 38.0 33.4 38.0 120-124 36.4399 38.0 38.0 38.0 34.0 38.0 125-129 36.395149999999994 38.0 38.0 38.0 34.0 38.0 130-134 36.280150000000006 38.0 37.4 38.0 33.6 38.0 135-139 35.50664999999999 38.0 35.8 38.0 30.8 38.0 140-144 35.35865 38.0 36.0 38.0 31.2 38.0 145-149 31.7605 35.8 27.8 38.0 20.6 38.0 150-151 29.2935 35.0 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 0.0 20 3.0 21 1.0 22 0.0 23 3.0 24 4.0 25 11.0 26 18.0 27 27.0 28 30.0 29 36.0 30 42.0 31 53.0 32 82.0 33 132.0 34 183.0 35 379.0 36 1149.0 37 1841.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.6259989344699 17.581246670218434 7.67181672882259 49.12093766648908 2 17.925 19.05 30.45 32.574999999999996 3 23.35 18.175 24.075 34.4 4 26.525 24.675 20.7 28.1 5 25.775 28.9 23.1 22.225 6 22.075 32.375 23.95 21.6 7 16.950000000000003 23.05 40.375 19.625 8 19.6 23.599999999999998 28.849999999999998 27.950000000000003 9 18.8 23.575 32.275 25.35 10-14 22.82 26.75 25.505 24.925 15-19 22.865 25.324999999999996 26.43 25.380000000000003 20-24 22.535 25.564999999999998 27.195000000000004 24.705 25-29 22.770000000000003 25.39 26.36 25.480000000000004 30-34 22.54 25.124999999999996 26.83 25.505 35-39 22.615 25.55 26.695 25.14 40-44 22.765 25.915 25.785000000000004 25.535000000000004 45-49 22.57 25.41 26.045 25.974999999999998 50-54 22.535 26.215 25.335 25.915 55-59 22.78 25.919999999999998 25.995 25.305 60-64 22.61 25.505 26.314999999999998 25.569999999999997 65-69 23.080000000000002 25.2 26.174999999999997 25.545 70-74 22.98 25.424999999999997 25.705 25.89 75-79 22.470000000000002 25.679999999999996 26.27 25.580000000000002 80-84 23.064999999999998 25.505 25.995 25.435000000000002 85-89 22.535 25.695 25.77 26.0 90-94 23.400000000000002 25.074999999999996 26.32 25.205 95-99 22.985 25.674999999999997 26.179999999999996 25.16 100-104 22.95 25.305 26.105 25.64 105-109 23.1 25.215 25.840000000000003 25.845000000000002 110-114 23.255 25.21 25.990000000000002 25.545 115-119 22.805 26.009999999999998 25.385 25.8 120-124 23.18 25.314999999999998 25.840000000000003 25.665 125-129 23.369999999999997 25.259999999999998 25.590000000000003 25.779999999999998 130-134 23.345 24.990000000000002 26.090000000000003 25.575 135-139 23.316165808290414 25.676283814190707 25.51127556377819 25.496274813740687 140-144 23.715 25.014999999999997 25.765 25.505 145-149 23.935000000000002 25.5 26.340000000000003 24.224999999999998 150-151 23.990498812351543 24.803100387548444 25.115639454931866 26.090761345168147 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 2.0 28 3.5 29 5.0 30 7.0 31 8.5 32 11.0 33 17.0 34 30.5 35 43.5 36 50.5 37 62.0 38 84.5 39 107.5 40 144.0 41 173.5 42 175.5 43 196.0 44 217.5 45 215.0 46 204.5 47 214.5 48 204.0 49 187.0 50 186.0 51 152.5 52 125.5 53 109.0 54 104.5 55 111.0 56 102.0 57 88.0 58 72.5 59 65.0 60 62.5 61 60.5 62 58.0 63 45.5 64 44.0 65 46.0 66 37.5 67 31.0 68 28.5 69 24.5 70 19.0 71 16.0 72 12.0 73 9.5 74 8.5 75 5.0 76 2.5 77 2.0 78 2.0 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09182643794148 98.2 2 0.9081735620585267 1.7999999999999998 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.425 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.2625 0.0 0.0 0.0 0.0 130-131 2.575 0.0 0.0 0.0 0.0 132-133 2.925 0.0 0.0 0.0 0.0 134-135 3.1625 0.0 0.0 0.0 0.0 136-137 3.5375 0.0 0.0 0.0 0.0 138-139 3.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCCAC 10 0.0068396386 144.9375 7 >>END_MODULE SRR6958272 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958272_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9105 33.0 33.0 34.0 32.0 34.0 2 33.143 34.0 33.0 34.0 32.0 34.0 3 33.10375 34.0 33.0 34.0 33.0 34.0 4 32.9815 34.0 33.0 34.0 32.0 34.0 5 33.0785 34.0 33.0 34.0 32.0 34.0 6 37.209 38.0 38.0 38.0 37.0 38.0 7 37.31975 38.0 38.0 38.0 37.0 38.0 8 37.08975 38.0 38.0 38.0 37.0 38.0 9 37.087 38.0 38.0 38.0 37.0 38.0 10-14 36.962450000000004 38.0 38.0 38.0 36.2 38.0 15-19 36.72924999999999 38.0 38.0 38.0 35.2 38.0 20-24 36.939550000000004 38.0 38.0 38.0 36.0 38.0 25-29 37.08715 38.0 38.0 38.0 36.4 38.0 30-34 37.1695 38.0 38.0 38.0 37.0 38.0 35-39 37.260200000000005 38.0 38.0 38.0 37.0 38.0 40-44 35.5432 38.0 35.4 38.0 29.8 38.0 45-49 37.028800000000004 38.0 38.0 38.0 36.4 38.0 50-54 36.5904 38.0 38.0 38.0 34.4 38.0 55-59 36.84095000000001 38.0 38.0 38.0 35.8 38.0 60-64 36.892649999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.94225 38.0 38.0 38.0 36.0 38.0 70-74 36.728249999999996 38.0 38.0 38.0 35.2 38.0 75-79 36.441649999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.44435 38.0 38.0 38.0 34.0 38.0 85-89 36.261900000000004 38.0 38.0 38.0 33.8 38.0 90-94 36.4718 38.0 38.0 38.0 34.2 38.0 95-99 36.5843 38.0 38.0 38.0 34.8 38.0 100-104 36.5687 38.0 38.0 38.0 34.6 38.0 105-109 36.53955 38.0 38.0 38.0 34.4 38.0 110-114 36.3889 38.0 38.0 38.0 34.0 38.0 115-119 36.031600000000005 38.0 37.8 38.0 33.2 38.0 120-124 35.068200000000004 38.0 36.0 38.0 27.0 38.0 125-129 33.32045 37.2 31.6 38.0 21.4 38.0 130-134 32.75595 37.0 30.4 38.0 19.8 38.0 135-139 35.17515 38.0 36.0 38.0 30.4 38.0 140-144 34.48264999999999 38.0 34.8 38.0 25.4 38.0 145-149 34.5505 38.0 36.0 38.0 29.0 38.0 150-151 29.644875 35.5 27.0 38.0 11.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 2.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 2.0 15 2.0 16 2.0 17 3.0 18 5.0 19 3.0 20 6.0 21 4.0 22 5.0 23 11.0 24 12.0 25 14.0 26 21.0 27 20.0 28 46.0 29 39.0 30 48.0 31 61.0 32 89.0 33 119.0 34 165.0 35 281.0 36 779.0 37 2247.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.65 18.325 11.600000000000001 33.425 2 28.675 23.75 28.225 19.35 3 22.25 26.3 27.900000000000002 23.549999999999997 4 26.950000000000003 31.474999999999998 20.125 21.45 5 26.974999999999998 32.95 20.4 19.675 6 22.900000000000002 34.725 20.925 21.45 7 21.675 19.375 35.675000000000004 23.275000000000002 8 23.974999999999998 23.150000000000002 23.875 28.999999999999996 9 22.675 23.375 27.450000000000003 26.5 10-14 25.790000000000003 26.384999999999998 23.64 24.185000000000002 15-19 25.965 25.715 24.195 24.125 20-24 25.275 26.5 24.62 23.605 25-29 25.840000000000003 26.265 23.985 23.91 30-34 25.655 26.424999999999997 24.285 23.635 35-39 25.585 26.41 24.4 23.605 40-44 25.759999999999998 26.215 24.555 23.47 45-49 25.35 26.005 24.85 23.794999999999998 50-54 25.290000000000003 25.955000000000002 24.62 24.135 55-59 26.055 25.480000000000004 24.474999999999998 23.990000000000002 60-64 25.775 25.935000000000002 24.215 24.075 65-69 25.855 25.66 25.135 23.35 70-74 25.715 25.419999999999998 25.4 23.465 75-79 25.779999999999998 25.53 25.174999999999997 23.515 80-84 26.02 26.625 24.099999999999998 23.255 85-89 25.619999999999997 25.545 25.130000000000003 23.705000000000002 90-94 25.195 26.52 24.845 23.44 95-99 25.724999999999998 25.835 24.685000000000002 23.755000000000003 100-104 26.174999999999997 25.6 24.855 23.369999999999997 105-109 25.11 25.965 25.15 23.775 110-114 25.665 25.645 25.285000000000004 23.405 115-119 26.595000000000002 26.185000000000002 25.019999999999996 22.2 120-124 25.96 26.205000000000002 25.2 22.634999999999998 125-129 26.090000000000003 25.805 24.955 23.150000000000002 130-134 26.669999999999998 26.155 24.645 22.53 135-139 26.369999999999997 25.759999999999998 25.580000000000002 22.29 140-144 25.83 26.025 25.005 23.14 145-149 26.56 25.929999999999996 25.185000000000002 22.325 150-151 26.650000000000002 26.337500000000002 24.7 22.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 1.5 26 3.0 27 3.5 28 2.5 29 4.0 30 7.0 31 9.0 32 11.0 33 12.5 34 16.5 35 23.0 36 40.5 37 61.0 38 71.5 39 92.5 40 128.0 41 160.0 42 174.5 43 188.5 44 203.0 45 206.5 46 203.5 47 204.0 48 192.5 49 179.0 50 171.5 51 147.0 52 128.5 53 117.0 54 110.0 55 98.5 56 95.5 57 93.5 58 83.0 59 82.0 60 78.5 61 69.5 62 62.0 63 66.5 64 64.0 65 47.5 66 44.0 67 47.5 68 44.0 69 34.0 70 29.5 71 27.0 72 18.0 73 13.5 74 10.5 75 6.5 76 2.5 77 3.0 78 2.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70722433460077 97.35000000000001 2 1.1913814955640052 2.35 3 0.10139416983523447 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.8375 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.1875 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 2.2125 0.0 0.0 0.0 0.0 130-131 2.525 0.0 0.0 0.0 0.0 132-133 2.8375 0.0 0.0 0.0 0.0 134-135 3.0875 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 3.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTGA 10 0.006830828 145.0 145 AGCAAGC 10 0.006830828 145.0 2 >>END_MODULE Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979652 spots for SRR6958272.sra Written 979652 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra Read 979646 spots for SRR6958272.sra Written 979646 spots for SRR6958272.sra SRR ids: ['SRR6958272.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q9yarlw3 SRR6958272.sra spots: 19592926 blocks: [[1, 979646], [979647, 1959292], [1959293, 2938938], [2938939, 3918584], [3918585, 4898230], [4898231, 5877876], [5877877, 6857522], [6857523, 7837168], [7837169, 8816814], [8816815, 9796460], [9796461, 10776106], [10776107, 11755752], [11755753, 12735398], [12735399, 13715044], [13715045, 14694690], [14694691, 15674336], [15674337, 16653982], [16653983, 17633628], [17633629, 18613274], [18613275, 19592926]] SRR6958272 file size 6617699 SRR6958272 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958272 SRR6958272_1.fastq SRR6958272_2.fastq Input file: SRR6958272_1.fastq Paired file: SRR6958272_2.fastq trimmed: SRR6958272-trimmed-pair1.fastq, SRR6958272-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:27:30 2024 >> started Fri Dec 6 18:27:51 2024 >> done (21.501s) 19592926 read pairs processed; of these: 9955 ( 0.05%) short read pairs filtered out after trimming by size control 11506 ( 0.06%) empty read pairs filtered out after trimming by size control 19571465 (99.89%) read pairs available; of these: 6307328 (32.23%) trimmed read pairs available after processing 13264137 (67.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 4 0.00% 21 4 0.00% 22 4 0.00% 23 3 0.00% 24 2 0.00% 25 5 0.00% 26 5 0.00% 27 5 0.00% 28 6 0.00% 29 5 0.00% 30 6 0.00% 31 5 0.00% 32 10 0.00% 33 7 0.00% 34 7 0.00% 35 9 0.00% 36 8 0.00% 37 7 0.00% 38 6 0.00% 39 8 0.00% 40 16 0.00% 41 18 0.00% 42 11 0.00% 43 14 0.00% 44 10 0.00% 45 15 0.00% 46 17 0.00% 47 16 0.00% 48 24 0.00% 49 21 0.00% 50 35 0.00% 51 32 0.00% 52 37 0.00% 53 27 0.00% 54 42 0.00% 55 47 0.00% 56 53 0.00% 57 62 0.00% 58 54 0.00% 59 77 0.00% 60 73 0.00% 61 87 0.00% 62 117 0.00% 63 119 0.00% 64 134 0.00% 65 136 0.00% 66 164 0.00% 67 182 0.00% 68 210 0.00% 69 243 0.00% 70 270 0.00% 71 346 0.00% 72 388 0.00% 73 423 0.00% 74 457 0.00% 75 542 0.00% 76 606 0.00% 77 727 0.00% 78 771 0.00% 79 891 0.00% 80 1015 0.01% 81 1121 0.01% 82 1368 0.01% 83 1538 0.01% 84 2052 0.01% 85 2566 0.01% 86 2699 0.01% 87 2946 0.02% 88 3161 0.02% 89 3228 0.02% 90 3558 0.02% 91 3843 0.02% 92 4275 0.02% 93 4551 0.02% 94 5148 0.03% 95 5452 0.03% 96 5785 0.03% 97 6169 0.03% 98 6712 0.03% 99 6780 0.03% 100 7466 0.04% 101 8062 0.04% 102 8591 0.04% 103 9391 0.05% 104 9869 0.05% 105 10586 0.05% 106 10994 0.06% 107 11883 0.06% 108 12307 0.06% 109 13177 0.07% 110 13781 0.07% 111 14555 0.07% 112 15735 0.08% 113 16453 0.08% 114 17440 0.09% 115 18616 0.10% 116 19577 0.10% 117 20273 0.10% 118 20760 0.11% 119 21509 0.11% 120 22649 0.12% 121 23687 0.12% 122 24897 0.13% 123 25921 0.13% 124 27566 0.14% 125 29044 0.15% 126 30340 0.16% 127 31893 0.16% 128 32656 0.17% 129 33526 0.17% 130 35242 0.18% 131 36695 0.19% 132 39024 0.20% 133 40977 0.21% 134 43236 0.22% 135 45806 0.23% 136 47955 0.25% 137 50653 0.26% 138 52757 0.27% 139 56507 0.29% 140 59860 0.31% 141 64635 0.33% 142 70722 0.36% 143 78818 0.40% 144 89130 0.46% 145 104773 0.54% 146 126832 0.65% 147 166592 0.85% 148 248769 1.27% 149 497761 2.54% 150 3705772 18.93% 151 13264137 67.77% 19571465 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=21 prefix-density=0.92 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=55.03 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=15 prefix-density=0.60 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=76.89 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.1 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958272 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:28:43 Started mapping on | Dec 06 18:28:44 Finished on | Dec 06 18:30:03 Mapping speed, Million of reads per hour | 891.86 Number of input reads | 19571465 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19153014 Uniquely mapped reads % | 97.86% Average mapped length | 297.56 Number of splices: Total | 22985438 Number of splices: Annotated (sjdb) | 21682171 Number of splices: GT/AG | 22690890 Number of splices: GC/AG | 269490 Number of splices: AT/AC | 8788 Number of splices: Non-canonical | 16270 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 138102 % of reads mapped to multiple loci | 0.71% Number of reads mapped to too many loci | 19376 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.74% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 287296 287296 287296 N_multimapping 138102 138102 138102 N_noFeature 602314 18627637 739056 N_ambiguous 462374 2459 75155 UnstrandedReadsAssigned:18088326 PositiveStrandReadsAssigned:522918 NegativeStrandReadsAssigned:18338803 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958272 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958272-trimmed-pair1.fastq SRR6958272-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,571,465 reads, 18,373,635 reads pseudoaligned [quant] estimated average fragment length: 264.165 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52973 SRR6958272.ke.tsv 35125 SRR6958272.se.tsv 88098 total ==> SRR6958272.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 673.344 0 0 PNS24247 1044 780.835 63.5298 6.633 PNS24249 1928 1664.84 41.704 2.0422 PNS24246 1044 780.835 63.5298 6.633 PNS24248 1044 780.835 63.5298 6.633 PNS24244 1471 1207.84 27.7064 1.8701 PNS24243 293 84.1188 0 0 KQK14069 1603 1339.84 5259.96 320.053 KQK14071 474 225.652 86.2281 31.1531 ==> SRR6958272.se.tsv <== BRADI_1g14170v3 5953 BRADI_1g53295v3 237 BRADI_1g59795v3 210 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 219 BRADI_1g74790v3 85 BRADI_1g09890v3 0 BRADI_1g77505v3 246 BRADI_1g48960v3 0 SRR6958272 completed mapping pipeline successfully