Starting /dee2/code/volunteer_pipeline.sh SRR6958273 current disk space = 1549826650112 free memory = 1377755144 SRR6958273 SRAfilesize 271835ce81398fee959e9ae286e730f9 SRR6958273.sra SRR6958273.sra file validated SRR6958273 is paired end SRR6958273 is conventional basespace SRR6958273 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958273_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.95425 30.0 18.0 33.0 18.0 33.0 2 27.08225 28.0 25.0 31.0 18.0 33.0 3 30.676 31.0 29.0 33.0 27.0 33.0 4 31.91875 33.0 32.0 33.0 31.0 33.0 5 32.78525 33.0 33.0 33.0 32.0 34.0 6 36.908 38.0 37.0 38.0 35.0 38.0 7 37.29 38.0 38.0 38.0 36.0 38.0 8 37.5095 38.0 38.0 38.0 37.0 38.0 9 37.6045 38.0 38.0 38.0 38.0 38.0 10-14 36.96205 38.0 37.8 38.0 35.0 38.0 15-19 35.80635 37.8 35.0 38.0 31.2 38.0 20-24 35.9713 38.0 36.6 38.0 29.4 38.0 25-29 37.5587 38.0 38.0 38.0 37.6 38.0 30-34 37.596000000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.5596 38.0 38.0 38.0 38.0 38.0 40-44 37.61585 38.0 38.0 38.0 38.0 38.0 45-49 37.63055 38.0 38.0 38.0 38.0 38.0 50-54 37.6563 38.0 38.0 38.0 38.0 38.0 55-59 37.58985 38.0 38.0 38.0 38.0 38.0 60-64 37.53 38.0 38.0 38.0 37.8 38.0 65-69 37.5246 38.0 38.0 38.0 38.0 38.0 70-74 37.477000000000004 38.0 38.0 38.0 37.8 38.0 75-79 36.76155 38.0 37.6 38.0 33.8 38.0 80-84 37.4627 38.0 38.0 38.0 37.4 38.0 85-89 37.42829999999999 38.0 38.0 38.0 37.2 38.0 90-94 36.93835 38.0 38.0 38.0 35.2 38.0 95-99 37.24335 38.0 38.0 38.0 36.6 38.0 100-104 37.241150000000005 38.0 38.0 38.0 36.4 38.0 105-109 37.182500000000005 38.0 38.0 38.0 36.0 38.0 110-114 37.14835 38.0 38.0 38.0 36.0 38.0 115-119 36.95695 38.0 38.0 38.0 35.4 38.0 120-124 36.70865 38.0 38.0 38.0 35.0 38.0 125-129 36.7376 38.0 38.0 38.0 35.0 38.0 130-134 36.7137 38.0 38.0 38.0 35.0 38.0 135-139 36.56445 38.0 38.0 38.0 34.2 38.0 140-144 36.369899999999994 38.0 38.0 38.0 34.2 38.0 145-149 36.024350000000005 38.0 38.0 38.0 33.2 38.0 150-151 32.39525 35.5 33.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 0.0 15 2.0 16 1.0 17 0.0 18 1.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.0 24 4.0 25 5.0 26 6.0 27 7.0 28 11.0 29 13.0 30 14.0 31 28.0 32 58.0 33 68.0 34 111.0 35 216.0 36 690.0 37 2761.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.11292795094533 12.927950945324476 5.697496167603474 34.26162493612672 2 23.125 13.675 32.725 30.475 3 20.05 20.3 25.424999999999997 34.225 4 24.55 27.250000000000004 21.625 26.575 5 24.6 32.025 22.35 21.025 6 22.080520130032507 33.33333333333333 23.330832708177045 21.255313828457115 7 15.275 25.074999999999996 40.8 18.85 8 18.025 24.4 29.45 28.125 9 18.575 21.349999999999998 34.575 25.5 10-14 22.325 26.935 25.86 24.88 15-19 21.87 26.495 26.640000000000004 24.995 20-24 22.189999999999998 26.26 26.75 24.8 25-29 21.85 26.165 26.495 25.490000000000002 30-34 21.769353870774154 26.290258051610323 26.655331066213243 25.28505701140228 35-39 22.140535133783445 26.531632908227053 26.451612903225808 24.87621905476369 40-44 22.125 26.375 26.305 25.195 45-49 22.040000000000003 25.290000000000003 27.245 25.424999999999997 50-54 21.97 26.44 26.169999999999998 25.419999999999998 55-59 22.065 26.424999999999997 26.505000000000003 25.005 60-64 22.39 26.5 26.290000000000003 24.82 65-69 22.920730182545636 25.95648912228057 25.946486621655414 25.176294073518378 70-74 22.444488897779554 26.36027205441088 26.5503100620124 24.64492898579716 75-79 22.39 25.94 26.700000000000003 24.97 80-84 22.30723072307231 25.90759075907591 26.57765776577658 25.207520752075208 85-89 22.305 26.525 26.029999999999998 25.14 90-94 22.42 25.89 26.02 25.669999999999998 95-99 22.452858500475166 26.139148702045716 26.744360526184163 24.66363227129495 100-104 22.371118555927797 25.931296564828244 26.71633581679084 24.981249062453124 105-109 22.742274227422744 26.127612761276126 25.97759775977598 25.152515251525152 110-114 22.25111255562778 26.336316815840792 26.26131306565328 25.151257562878143 115-119 22.674534906981396 25.51010202040408 26.300260052010405 25.51510302060412 120-124 23.044999999999998 25.97 26.085 24.9 125-129 22.835708927231806 26.62165541385346 26.041510377594403 24.50112528132033 130-134 23.105 26.200000000000003 25.919999999999998 24.775 135-139 23.515 26.055 25.53 24.9 140-144 22.759999999999998 26.25 25.695 25.295 145-149 23.59 25.865 25.374999999999996 25.169999999999998 150-151 22.037499999999998 26.1125 25.887500000000003 25.9625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.5 27 1.5 28 2.5 29 4.5 30 8.0 31 12.0 32 18.5 33 29.0 34 39.0 35 48.0 36 58.5 37 67.0 38 90.5 39 129.5 40 151.0 41 167.0 42 188.5 43 199.5 44 197.5 45 205.5 46 225.5 47 233.5 48 219.0 49 198.5 50 189.5 51 171.0 52 143.0 53 121.0 54 107.0 55 91.5 56 81.0 57 77.5 58 58.5 59 50.5 60 54.5 61 42.5 62 39.5 63 42.5 64 38.5 65 35.0 66 34.0 67 30.5 68 23.5 69 21.5 70 15.5 71 7.5 72 6.0 73 6.0 74 5.0 75 3.0 76 2.5 77 2.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.02 35-39 0.025 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.025 70-74 0.02 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.034999999999999996 100-104 0.005 105-109 0.01 110-114 0.005 115-119 0.02 120-124 0.0 125-129 0.025 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2000000000000002 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.3499999999999996 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 4.1125 0.0 0.0 0.0 0.0 122-123 4.5125 0.0 0.0 0.0 0.0 124-125 4.9 0.0 0.0 0.0 0.0 126-127 5.487500000000001 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.2125 0.0 0.0 0.0 0.0 132-133 6.6625 0.0 0.0 0.0 0.0 134-135 7.175 0.0 0.0 0.0 0.0 136-137 7.800000000000001 0.0 0.0 0.0 0.0 138-139 8.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958273 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958273_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.825 33.0 33.0 34.0 32.0 34.0 2 33.0785 33.0 33.0 34.0 32.0 34.0 3 33.16725 34.0 33.0 34.0 33.0 34.0 4 33.2345 34.0 33.0 34.0 33.0 34.0 5 31.649 33.0 33.0 34.0 27.0 34.0 6 37.023 38.0 38.0 38.0 36.0 38.0 7 37.26925 38.0 38.0 38.0 37.0 38.0 8 37.37575 38.0 38.0 38.0 37.0 38.0 9 37.40275 38.0 38.0 38.0 38.0 38.0 10-14 37.390150000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.4246 38.0 38.0 38.0 38.0 38.0 20-24 37.40455 38.0 38.0 38.0 38.0 38.0 25-29 37.4023 38.0 38.0 38.0 38.0 38.0 30-34 37.369 38.0 38.0 38.0 38.0 38.0 35-39 37.2033 38.0 38.0 38.0 37.4 38.0 40-44 37.05895 38.0 38.0 38.0 37.0 38.0 45-49 37.06095 38.0 38.0 38.0 36.8 38.0 50-54 37.2401 38.0 38.0 38.0 37.4 38.0 55-59 37.33825 38.0 38.0 38.0 38.0 38.0 60-64 37.28425 38.0 38.0 38.0 37.4 38.0 65-69 37.2691 38.0 38.0 38.0 37.4 38.0 70-74 37.2316 38.0 38.0 38.0 37.2 38.0 75-79 37.1848 38.0 38.0 38.0 37.0 38.0 80-84 37.12145 38.0 38.0 38.0 36.8 38.0 85-89 37.08185 38.0 38.0 38.0 36.6 38.0 90-94 36.97185 38.0 38.0 38.0 36.2 38.0 95-99 36.7372 38.0 38.0 38.0 35.2 38.0 100-104 36.8899 38.0 38.0 38.0 36.0 38.0 105-109 36.850500000000004 38.0 38.0 38.0 35.6 38.0 110-114 36.824349999999995 38.0 38.0 38.0 35.4 38.0 115-119 36.6871 38.0 38.0 38.0 35.0 38.0 120-124 35.81645 38.0 37.0 38.0 31.2 38.0 125-129 36.235 38.0 38.0 38.0 33.8 38.0 130-134 36.16205 38.0 38.0 38.0 33.8 38.0 135-139 35.85209999999999 38.0 38.0 38.0 32.6 38.0 140-144 35.4688 38.0 37.0 38.0 30.6 38.0 145-149 34.95865 38.0 36.0 38.0 30.0 38.0 150-151 28.57825 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 4.0 5 4.0 6 0.0 7 1.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 3.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 3.0 22 4.0 23 3.0 24 5.0 25 6.0 26 8.0 27 8.0 28 18.0 29 24.0 30 28.0 31 34.0 32 60.0 33 75.0 34 115.0 35 201.0 36 484.0 37 2896.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.824999999999996 21.375 8.825 24.975 2 30.525000000000002 22.3 28.175 19.0 3 20.974999999999998 26.25 32.4 20.375 4 26.75 31.900000000000002 20.525 20.825 5 25.6 35.325 20.849999999999998 18.224999999999998 6 22.375 36.625 20.974999999999998 20.025000000000002 7 22.1 19.825 36.75 21.325 8 22.775000000000002 23.25 26.1 27.875 9 23.35 23.200000000000003 28.449999999999996 25.0 10-14 25.509999999999998 26.72 23.97 23.799999999999997 15-19 25.445 25.805 24.795 23.955000000000002 20-24 24.995 26.575 25.31 23.119999999999997 25-29 25.335 26.384999999999998 25.590000000000003 22.689999999999998 30-34 24.654999999999998 25.869999999999997 26.064999999999998 23.41 35-39 24.95 26.69 25.230000000000004 23.13 40-44 25.235000000000003 25.619999999999997 25.900000000000002 23.244999999999997 45-49 25.255 26.174999999999997 25.729999999999997 22.84 50-54 25.27 25.72 25.97 23.04 55-59 25.674999999999997 26.135 25.165 23.025000000000002 60-64 26.265 25.83 25.005 22.900000000000002 65-69 25.805 25.619999999999997 25.52 23.055 70-74 25.785000000000004 26.195 25.31 22.71 75-79 25.040000000000003 26.07 25.83 23.06 80-84 25.490000000000002 26.865 25.580000000000002 22.065 85-89 25.669999999999998 26.38 25.75 22.2 90-94 25.15 26.174999999999997 25.75 22.925 95-99 25.525 26.405 25.840000000000003 22.23 100-104 25.765 25.835 26.365 22.035 105-109 25.525 26.634999999999998 25.355 22.485 110-114 25.976298814940748 26.57632881644082 25.52127606380319 21.92609630481524 115-119 25.495 26.645000000000003 25.679999999999996 22.18 120-124 25.795 26.334999999999997 25.275 22.595000000000002 125-129 25.919999999999998 26.965 25.055 22.06 130-134 26.515 25.979999999999997 25.595000000000002 21.91 135-139 26.424999999999997 26.640000000000004 25.39 21.545 140-144 26.584999999999997 26.815 25.580000000000002 21.02 145-149 26.919999999999998 26.43 25.28 21.37 150-151 26.3625 26.9625 25.45 21.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 2.0 26 2.0 27 3.5 28 8.5 29 8.5 30 11.0 31 16.5 32 21.0 33 24.5 34 26.0 35 30.5 36 44.0 37 66.5 38 95.5 39 115.5 40 124.0 41 146.0 42 185.5 43 196.5 44 199.5 45 214.5 46 231.5 47 229.0 48 193.5 49 174.5 50 162.5 51 147.5 52 127.5 53 118.5 54 117.5 55 103.0 56 88.5 57 75.5 58 74.0 59 74.5 60 69.5 61 64.0 62 56.0 63 50.5 64 46.0 65 39.0 66 34.0 67 34.5 68 33.0 69 25.0 70 23.5 71 25.0 72 17.0 73 8.0 74 6.0 75 5.0 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59798994974875 99.1 2 0.32663316582914576 0.65 3 0.05025125628140704 0.15 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2000000000000002 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.375 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.2249999999999996 0.0 0.0 0.0 0.0 118-119 3.725 0.0 0.0 0.0 0.0 120-121 4.1375 0.0 0.0 0.0 0.0 122-123 4.5375 0.0 0.0 0.0 0.0 124-125 4.9375 0.0 0.0 0.0 0.0 126-127 5.5375 0.0 0.0 0.0 0.0 128-129 5.975 0.0 0.0 0.0 0.0 130-131 6.3 0.0 0.0 0.0 0.0 132-133 6.7375 0.0 0.0 0.0 0.0 134-135 7.275 0.0 0.0 0.0 0.0 136-137 7.9125 0.0 0.0 0.0 0.0 138-139 8.475000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTATAG 10 0.006830828 145.0 1 >>END_MODULE Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191685 spots for SRR6958273.sra Written 1191685 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra Read 1191666 spots for SRR6958273.sra Written 1191666 spots for SRR6958273.sra SRR ids: ['SRR6958273.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pstoh7a_ SRR6958273.sra spots: 23833339 blocks: [[1, 1191666], [1191667, 2383332], [2383333, 3574998], [3574999, 4766664], [4766665, 5958330], [5958331, 7149996], [7149997, 8341662], [8341663, 9533328], [9533329, 10724994], [10724995, 11916660], [11916661, 13108326], [13108327, 14299992], [14299993, 15491658], [15491659, 16683324], [16683325, 17874990], [17874991, 19066656], [19066657, 20258322], [20258323, 21449988], [21449989, 22641654], [22641655, 23833339]] SRR6958273 file size 8054636 SRR6958273 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958273 SRR6958273_1.fastq SRR6958273_2.fastq Input file: SRR6958273_1.fastq Paired file: SRR6958273_2.fastq trimmed: SRR6958273-trimmed-pair1.fastq, SRR6958273-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:28:37 2024 >> started Fri Dec 6 18:29:16 2024 >> done (38.492s) 23833339 read pairs processed; of these: 23292 ( 0.10%) short read pairs filtered out after trimming by size control 22154 ( 0.09%) empty read pairs filtered out after trimming by size control 23787893 (99.81%) read pairs available; of these: 8496876 (35.72%) trimmed read pairs available after processing 15291017 (64.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 14 0.00% 20 16 0.00% 21 14 0.00% 22 23 0.00% 23 21 0.00% 24 18 0.00% 25 21 0.00% 26 19 0.00% 27 31 0.00% 28 20 0.00% 29 21 0.00% 30 24 0.00% 31 20 0.00% 32 23 0.00% 33 21 0.00% 34 18 0.00% 35 37 0.00% 36 38 0.00% 37 31 0.00% 38 36 0.00% 39 36 0.00% 40 35 0.00% 41 48 0.00% 42 45 0.00% 43 59 0.00% 44 52 0.00% 45 65 0.00% 46 86 0.00% 47 63 0.00% 48 92 0.00% 49 102 0.00% 50 137 0.00% 51 118 0.00% 52 134 0.00% 53 139 0.00% 54 137 0.00% 55 188 0.00% 56 199 0.00% 57 217 0.00% 58 274 0.00% 59 301 0.00% 60 366 0.00% 61 403 0.00% 62 498 0.00% 63 490 0.00% 64 522 0.00% 65 609 0.00% 66 690 0.00% 67 685 0.00% 68 891 0.00% 69 1011 0.00% 70 1149 0.00% 71 1337 0.01% 72 1575 0.01% 73 1745 0.01% 74 1939 0.01% 75 2146 0.01% 76 2360 0.01% 77 2666 0.01% 78 2950 0.01% 79 3399 0.01% 80 3916 0.02% 81 4553 0.02% 82 4952 0.02% 83 5502 0.02% 84 7115 0.03% 85 8220 0.03% 86 8772 0.04% 87 9296 0.04% 88 10312 0.04% 89 10904 0.05% 90 11664 0.05% 91 12743 0.05% 92 13706 0.06% 93 14983 0.06% 94 15706 0.07% 95 16595 0.07% 96 17179 0.07% 97 18389 0.08% 98 19063 0.08% 99 20381 0.09% 100 21914 0.09% 101 23255 0.10% 102 25451 0.11% 103 26888 0.11% 104 28093 0.12% 105 29364 0.12% 106 30371 0.13% 107 31076 0.13% 108 32394 0.14% 109 33746 0.14% 110 34904 0.15% 111 36879 0.16% 112 39027 0.16% 113 40999 0.17% 114 43338 0.18% 115 44946 0.19% 116 46395 0.20% 117 47378 0.20% 118 47912 0.20% 119 49637 0.21% 120 50887 0.21% 121 52177 0.22% 122 54881 0.23% 123 57188 0.24% 124 59753 0.25% 125 62052 0.26% 126 62704 0.26% 127 64088 0.27% 128 64627 0.27% 129 66474 0.28% 130 67535 0.28% 131 70065 0.29% 132 72641 0.31% 133 75969 0.32% 134 78899 0.33% 135 82522 0.35% 136 83812 0.35% 137 85722 0.36% 138 88512 0.37% 139 91218 0.38% 140 94325 0.40% 141 99359 0.42% 142 105931 0.45% 143 113645 0.48% 144 125780 0.53% 145 140709 0.59% 146 164850 0.69% 147 207112 0.87% 148 288197 1.21% 149 546409 2.30% 150 4240475 17.83% 151 15291017 64.28% 23787893 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=5.25 fanout-score-rank=19 prefix-density=0.51 prefix-fanout=3.7 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=34.85 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.9 sequence=CAAAAAAGAGGTGTGTGTGTATATATAGTCCATAAACACGGGAAGTGGACATGGTATGATAAAGGGTTACAAACTCTCAAGTAACAACTCGATCTCCTCCAAAAGAGAGTAAACCAACAAGCCCGGAGAGAGTGCTTTTATTCTGTATATAAACTCGCATAAAACAGTAATACATAGACAGAGACGCCGCACGCTTCAACCGATCCATATGGAAGTAGCTGATGAAGACGCCGGCTGAGAGACCCGATCGTCTCTCCAGCTCACACCCTGGAGCA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=6.41 fanout-score-rank=13 prefix-density=0.44 prefix-fanout=4.1 sequence=TGCAAGTGCGGCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=69.47 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=12.5 sequence=CCGCCGCCGCCG SRR6958273 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:30:18 Started mapping on | Dec 06 18:30:18 Finished on | Dec 06 18:32:43 Mapping speed, Million of reads per hour | 590.60 Number of input reads | 23787893 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 22939597 Uniquely mapped reads % | 96.43% Average mapped length | 293.87 Number of splices: Total | 26004720 Number of splices: Annotated (sjdb) | 24424757 Number of splices: GT/AG | 25653055 Number of splices: GC/AG | 284551 Number of splices: AT/AC | 10855 Number of splices: Non-canonical | 56259 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299460 % of reads mapped to multiple loci | 1.26% Number of reads mapped to too many loci | 9252 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.08% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 568912 568912 568912 N_multimapping 299460 299460 299460 N_noFeature 1018614 22310690 1222530 N_ambiguous 503528 2735 79507 UnstrandedReadsAssigned:21417455 PositiveStrandReadsAssigned:626172 NegativeStrandReadsAssigned:21637560 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958273 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958273-trimmed-pair1.fastq SRR6958273-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,787,893 reads, 21,619,424 reads pseudoaligned [quant] estimated average fragment length: 256.474 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52973 SRR6958273.ke.tsv 35125 SRR6958273.se.tsv 88098 total ==> SRR6958273.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.155 0 0 PNS24247 1044 788.526 71.2851 6.44258 PNS24249 1928 1672.53 67.5441 2.87801 PNS24246 1044 788.526 71.2851 6.44258 PNS24248 1044 788.526 71.2851 6.44258 PNS24244 1471 1215.53 97.6006 5.72223 PNS24243 293 96.494 0 0 KQK14069 1603 1347.53 2003.28 105.945 KQK14071 474 238.39 52.2791 15.6285 ==> SRR6958273.se.tsv <== BRADI_1g14170v3 2393 BRADI_1g53295v3 2369 BRADI_1g59795v3 153 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 935 BRADI_1g74790v3 257 BRADI_1g09890v3 0 BRADI_1g77505v3 346 BRADI_1g48960v3 1 SRR6958273 completed mapping pipeline successfully