Starting /dee2/code/volunteer_pipeline.sh SRR6958274 current disk space = 1549759053824 free memory = 1603146956 SRR6958274 SRAfilesize e3091831dfb4b035563a42840998796b SRR6958274.sra SRR6958274.sra file validated SRR6958274 is paired end SRR6958274 is conventional basespace SRR6958274 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958274_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.3565 32.0 18.0 33.0 18.0 34.0 2 31.19 33.0 29.0 33.0 27.0 34.0 3 32.22325 33.0 31.0 34.0 29.0 34.0 4 32.62475 33.0 33.0 34.0 31.0 34.0 5 32.49975 33.0 33.0 33.0 31.0 34.0 6 36.559 38.0 37.0 38.0 34.0 38.0 7 37.14725 38.0 37.0 38.0 36.0 38.0 8 37.5485 38.0 38.0 38.0 37.0 38.0 9 37.6385 38.0 38.0 38.0 38.0 38.0 10-14 37.618849999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.6442 38.0 38.0 38.0 38.0 38.0 20-24 37.5569 38.0 38.0 38.0 38.0 38.0 25-29 37.354499999999994 38.0 38.0 38.0 37.2 38.0 30-34 37.59635 38.0 38.0 38.0 38.0 38.0 35-39 37.5542 38.0 38.0 38.0 37.8 38.0 40-44 37.286449999999995 38.0 38.0 38.0 36.8 38.0 45-49 37.42100000000001 38.0 38.0 38.0 37.2 38.0 50-54 37.31145 38.0 38.0 38.0 37.0 38.0 55-59 37.192449999999994 38.0 38.0 38.0 36.6 38.0 60-64 37.24445000000001 38.0 38.0 38.0 36.8 38.0 65-69 37.181 38.0 38.0 38.0 36.0 38.0 70-74 37.01635 38.0 38.0 38.0 35.6 38.0 75-79 37.1721 38.0 38.0 38.0 36.0 38.0 80-84 37.086 38.0 38.0 38.0 36.0 38.0 85-89 36.9238 38.0 38.0 38.0 35.4 38.0 90-94 36.77735 38.0 38.0 38.0 35.0 38.0 95-99 36.77974999999999 38.0 38.0 38.0 35.0 38.0 100-104 36.62785 38.0 38.0 38.0 34.4 38.0 105-109 36.50965 38.0 38.0 38.0 34.0 38.0 110-114 36.26885 38.0 37.8 38.0 34.0 38.0 115-119 36.148649999999996 38.0 37.0 38.0 33.4 38.0 120-124 35.98235 38.0 37.0 38.0 33.2 38.0 125-129 35.74875 38.0 36.6 38.0 32.0 38.0 130-134 35.4506 38.0 35.8 38.0 30.6 38.0 135-139 35.275749999999995 38.0 35.8 38.0 30.6 38.0 140-144 34.79235 38.0 34.2 38.0 28.6 38.0 145-149 33.7743 38.0 33.0 38.0 24.0 38.0 150-151 29.340625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 2.0 19 1.0 20 3.0 21 2.0 22 4.0 23 2.0 24 2.0 25 8.0 26 17.0 27 12.0 28 20.0 29 24.0 30 37.0 31 48.0 32 71.0 33 98.0 34 176.0 35 323.0 36 795.0 37 2352.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.142561983471076 12.267561983471074 9.013429752066116 44.57644628099173 2 20.4801200300075 13.078269567391848 37.70942735683921 28.732183045761438 3 18.775 14.899999999999999 26.650000000000002 39.675 4 24.55 24.525 23.025000000000002 27.900000000000002 5 26.85 28.425 23.075000000000003 21.65 6 21.45 33.300000000000004 24.925 20.325 7 17.974999999999998 26.1 37.7 18.224999999999998 8 20.3 24.7 29.975 25.025 9 19.675 22.625 34.5 23.200000000000003 10-14 21.54 27.63 26.790000000000003 24.04 15-19 21.5 26.51 27.29 24.7 20-24 21.6160808040402 26.82134106705335 27.326366318315916 24.23621181059053 25-29 21.975 26.090000000000003 27.125 24.81 30-34 21.6 26.790000000000003 26.935 24.675 35-39 22.12 26.619999999999997 26.235000000000003 25.025 40-44 22.32 26.674999999999997 26.740000000000002 24.265 45-49 21.725 26.779999999999998 26.47 25.025 50-54 22.105 26.314999999999998 26.555 25.025 55-59 22.235 26.419999999999998 26.625 24.72 60-64 22.15110755537777 26.601330066503326 27.026351317565876 24.221211060553028 65-69 22.736136806840342 26.381319065953296 26.156307815390768 24.72623631181559 70-74 22.207220722072208 26.247624762476246 26.587658765876586 24.957495749574957 75-79 22.595000000000002 25.88 26.445 25.080000000000002 80-84 22.235 26.51 26.595000000000002 24.66 85-89 22.245 25.919999999999998 27.029999999999998 24.805 90-94 22.235 26.355 26.56 24.85 95-99 22.400000000000002 26.115 26.235000000000003 25.25 100-104 22.67566891722931 26.006501625406354 26.636659164791197 24.681170292573142 105-109 22.615 26.255 26.91 24.22 110-114 22.36031069907291 26.29917313956402 26.329240791781512 25.011275369581558 115-119 23.196237366156307 25.833083158210744 26.018212748924245 24.952466726708696 120-124 21.94597298649325 26.31815907953977 26.878439219609806 24.85742871435718 125-129 22.257870463204334 26.52396230198516 26.4337276919992 24.78443954281131 130-134 22.94794794794795 26.79179179179179 25.730730730730734 24.52952952952953 135-139 22.105 26.83 26.08 24.985 140-144 22.33 25.795 26.284999999999997 25.590000000000003 145-149 22.869999999999997 25.755 25.935000000000002 25.44 150-151 22.7625 25.0375 26.4125 25.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 2.5 28 3.5 29 5.0 30 6.5 31 11.0 32 21.0 33 30.5 34 35.5 35 49.0 36 67.0 37 84.5 38 98.0 39 121.0 40 155.0 41 193.0 42 198.0 43 210.5 44 246.5 45 243.0 46 229.5 47 223.5 48 208.0 49 185.0 50 165.0 51 141.5 52 119.0 53 107.0 54 93.5 55 84.0 56 80.0 57 71.5 58 64.0 59 57.5 60 54.0 61 47.5 62 45.0 63 43.5 64 38.5 65 34.0 66 23.0 67 19.5 68 23.0 69 19.0 70 14.0 71 10.5 72 6.5 73 3.0 74 1.5 75 1.5 76 2.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.005 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.22499999999999998 115-119 0.06999999999999999 120-124 0.05 125-129 0.26 130-134 0.1 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.1124999999999998 0.0 0.0 0.0 0.0 120-121 1.3624999999999998 0.0 0.0 0.0 0.0 122-123 1.575 0.0 0.0 0.0 0.0 124-125 1.7875 0.0 0.0 0.0 0.0 126-127 1.8875 0.0 0.0 0.0 0.0 128-129 2.1625 0.0 0.0 0.0 0.0 130-131 2.4124999999999996 0.0 0.0 0.0 0.0 132-133 2.6875 0.0 0.0 0.0 0.0 134-135 2.975 0.0 0.0 0.0 0.0 136-137 3.3375000000000004 0.0 0.0 0.0 0.0 138-139 3.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958274 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958274_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.101 33.0 33.0 34.0 33.0 34.0 2 33.2635 34.0 33.0 34.0 33.0 34.0 3 33.2995 34.0 33.0 34.0 33.0 34.0 4 33.31125 34.0 33.0 34.0 33.0 34.0 5 33.00425 34.0 33.0 34.0 32.0 34.0 6 37.37025 38.0 38.0 38.0 37.0 38.0 7 37.5325 38.0 38.0 38.0 38.0 38.0 8 37.51025 38.0 38.0 38.0 38.0 38.0 9 37.44 38.0 38.0 38.0 38.0 38.0 10-14 36.6733 38.0 36.6 38.0 33.6 38.0 15-19 37.0777 38.0 37.8 38.0 36.0 38.0 20-24 37.4735 38.0 38.0 38.0 38.0 38.0 25-29 37.49465 38.0 38.0 38.0 38.0 38.0 30-34 37.502050000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.4768 38.0 38.0 38.0 38.0 38.0 40-44 36.78125 38.0 37.8 38.0 34.4 38.0 45-49 37.05065 38.0 38.0 38.0 36.2 38.0 50-54 37.337 38.0 38.0 38.0 37.6 38.0 55-59 37.39594999999999 38.0 38.0 38.0 37.6 38.0 60-64 37.38334999999999 38.0 38.0 38.0 38.0 38.0 65-69 37.350350000000006 38.0 38.0 38.0 37.6 38.0 70-74 37.282 38.0 38.0 38.0 37.2 38.0 75-79 36.87235 38.0 38.0 38.0 35.0 38.0 80-84 36.49565 38.0 37.6 38.0 32.4 38.0 85-89 36.00005 38.0 37.2 38.0 30.4 38.0 90-94 36.75025000000001 38.0 37.8 38.0 35.4 38.0 95-99 37.070299999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.9577 38.0 38.0 38.0 36.0 38.0 105-109 36.931599999999996 38.0 38.0 38.0 35.4 38.0 110-114 36.8584 38.0 38.0 38.0 35.4 38.0 115-119 36.76665 38.0 38.0 38.0 35.0 38.0 120-124 36.804700000000004 38.0 38.0 38.0 35.0 38.0 125-129 36.649649999999994 38.0 38.0 38.0 34.8 38.0 130-134 36.41179999999999 38.0 38.0 38.0 34.4 38.0 135-139 33.4533 37.0 30.2 38.0 24.8 38.0 140-144 35.128 38.0 36.0 38.0 29.8 38.0 145-149 34.50435 38.0 35.4 38.0 28.2 38.0 150-151 30.10925 35.5 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 0.0 19 1.0 20 3.0 21 2.0 22 3.0 23 4.0 24 6.0 25 8.0 26 10.0 27 20.0 28 20.0 29 18.0 30 28.0 31 46.0 32 53.0 33 59.0 34 124.0 35 253.0 36 693.0 37 2636.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.775 18.025 12.65 35.55 2 29.575000000000003 24.6 27.425 18.4 3 22.3 26.55 28.375 22.775000000000002 4 25.124999999999996 29.525000000000002 21.5 23.849999999999998 5 26.6 33.725 20.8 18.875 6 20.925 38.0 22.375 18.7 7 21.575 20.775 36.05 21.6 8 22.375 25.374999999999996 26.0 26.25 9 22.625 23.45 30.15 23.775 10-14 25.035 27.125 24.165 23.674999999999997 15-19 25.31 26.924999999999997 25.124999999999996 22.64 20-24 25.185000000000002 26.845000000000002 25.515 22.455 25-29 25.735000000000003 26.650000000000002 24.54 23.075000000000003 30-34 24.68 26.55 26.13 22.64 35-39 25.3 26.525 25.455 22.720000000000002 40-44 24.715 25.755 26.295 23.235 45-49 24.505 26.795 25.865 22.835 50-54 24.990000000000002 26.529999999999998 25.729999999999997 22.75 55-59 25.41 26.135 25.509999999999998 22.945 60-64 25.395 26.284999999999997 25.590000000000003 22.73 65-69 24.91 27.015 25.435000000000002 22.64 70-74 25.580000000000002 26.229999999999997 25.595000000000002 22.595000000000002 75-79 25.064999999999998 26.169999999999998 26.005 22.759999999999998 80-84 25.4 26.55 25.97 22.08 85-89 24.97 25.985000000000003 25.715 23.330000000000002 90-94 25.14 26.529999999999998 25.81 22.52 95-99 25.095 26.515 26.11 22.28 100-104 24.755 26.545 26.545 22.155 105-109 24.985 26.495 25.790000000000003 22.73 110-114 25.264999999999997 26.765 25.650000000000002 22.32 115-119 25.590000000000003 26.075 25.919999999999998 22.415 120-124 24.855 26.784999999999997 25.985000000000003 22.375 125-129 25.825 26.5 25.305 22.37 130-134 25.535000000000004 27.075 25.169999999999998 22.220000000000002 135-139 24.875 26.889999999999997 26.22 22.015 140-144 26.06 26.974999999999998 25.380000000000003 21.584999999999997 145-149 25.66 26.905 25.41 22.025 150-151 25.874999999999996 26.2625 25.8625 22.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 3.5 25 3.0 26 3.0 27 4.5 28 4.0 29 6.0 30 10.0 31 14.0 32 15.5 33 16.0 34 25.5 35 38.0 36 57.5 37 76.5 38 86.0 39 108.5 40 143.0 41 165.5 42 187.5 43 211.0 44 212.5 45 222.5 46 225.5 47 210.5 48 211.0 49 180.5 50 156.5 51 165.5 52 138.0 53 115.0 54 111.0 55 93.5 56 78.5 57 75.5 58 75.5 59 70.5 60 67.0 61 63.0 62 46.5 63 43.5 64 44.5 65 35.5 66 32.0 67 31.5 68 30.5 69 25.5 70 19.0 71 15.5 72 12.0 73 5.0 74 1.0 75 1.5 76 2.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4462622703247 98.775 2 0.47822803926503904 0.95 3 0.025169896803423106 0.075 4 0.05033979360684621 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.625 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.2125000000000004 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.6625 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAAAA 10 0.006830828 145.0 5 >>END_MODULE Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756257 spots for SRR6958274.sra Written 756257 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra Read 756238 spots for SRR6958274.sra Written 756238 spots for SRR6958274.sra SRR ids: ['SRR6958274.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_905fkoj7 SRR6958274.sra spots: 15124779 blocks: [[1, 756238], [756239, 1512476], [1512477, 2268714], [2268715, 3024952], [3024953, 3781190], [3781191, 4537428], [4537429, 5293666], [5293667, 6049904], [6049905, 6806142], [6806143, 7562380], [7562381, 8318618], [8318619, 9074856], [9074857, 9831094], [9831095, 10587332], [10587333, 11343570], [11343571, 12099808], [12099809, 12856046], [12856047, 13612284], [13612285, 14368522], [14368523, 15124779]] SRR6958274 file size 5103590 SRR6958274 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958274 SRR6958274_1.fastq SRR6958274_2.fastq Input file: SRR6958274_1.fastq Paired file: SRR6958274_2.fastq trimmed: SRR6958274-trimmed-pair1.fastq, SRR6958274-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:26:31 2024 >> started Fri Dec 6 18:26:48 2024 >> done (16.935s) 15124779 read pairs processed; of these: 7817 ( 0.05%) short read pairs filtered out after trimming by size control 6322 ( 0.04%) empty read pairs filtered out after trimming by size control 15110640 (99.91%) read pairs available; of these: 4992871 (33.04%) trimmed read pairs available after processing 10117769 (66.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 4 0.00% 23 1 0.00% 24 4 0.00% 25 3 0.00% 26 4 0.00% 27 3 0.00% 28 2 0.00% 29 7 0.00% 30 4 0.00% 31 5 0.00% 32 2 0.00% 33 4 0.00% 34 7 0.00% 35 1 0.00% 36 4 0.00% 37 10 0.00% 38 8 0.00% 39 11 0.00% 40 3 0.00% 41 6 0.00% 42 8 0.00% 43 10 0.00% 44 12 0.00% 45 14 0.00% 46 20 0.00% 47 24 0.00% 48 11 0.00% 49 19 0.00% 50 22 0.00% 51 22 0.00% 52 28 0.00% 53 31 0.00% 54 43 0.00% 55 26 0.00% 56 32 0.00% 57 52 0.00% 58 58 0.00% 59 34 0.00% 60 87 0.00% 61 79 0.00% 62 77 0.00% 63 115 0.00% 64 110 0.00% 65 110 0.00% 66 119 0.00% 67 133 0.00% 68 169 0.00% 69 194 0.00% 70 219 0.00% 71 259 0.00% 72 276 0.00% 73 298 0.00% 74 356 0.00% 75 415 0.00% 76 453 0.00% 77 594 0.00% 78 542 0.00% 79 647 0.00% 80 746 0.00% 81 830 0.01% 82 896 0.01% 83 1016 0.01% 84 1443 0.01% 85 1586 0.01% 86 1654 0.01% 87 1733 0.01% 88 1991 0.01% 89 2158 0.01% 90 2348 0.02% 91 2578 0.02% 92 2788 0.02% 93 2842 0.02% 94 3171 0.02% 95 3368 0.02% 96 3624 0.02% 97 3731 0.02% 98 4063 0.03% 99 4572 0.03% 100 4801 0.03% 101 5106 0.03% 102 5289 0.04% 103 5592 0.04% 104 6055 0.04% 105 6393 0.04% 106 6842 0.05% 107 7094 0.05% 108 7585 0.05% 109 8063 0.05% 110 8432 0.06% 111 8780 0.06% 112 9440 0.06% 113 9975 0.07% 114 10334 0.07% 115 10778 0.07% 116 11468 0.08% 117 12083 0.08% 118 12525 0.08% 119 13040 0.09% 120 13743 0.09% 121 14231 0.09% 122 15117 0.10% 123 15896 0.11% 124 16558 0.11% 125 17494 0.12% 126 18215 0.12% 127 18812 0.12% 128 19658 0.13% 129 20847 0.14% 130 22355 0.15% 131 22387 0.15% 132 23753 0.16% 133 25244 0.17% 134 26340 0.17% 135 28398 0.19% 136 30425 0.20% 137 32331 0.21% 138 33640 0.22% 139 36465 0.24% 140 39864 0.26% 141 42918 0.28% 142 47634 0.32% 143 53852 0.36% 144 62688 0.41% 145 75828 0.50% 146 94741 0.63% 147 130452 0.86% 148 205641 1.36% 149 442195 2.93% 150 3122521 20.66% 151 10117769 66.96% 15110640 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=28 prefix-density=0.81 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=35.73 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=17 prefix-density=0.57 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=431.28 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=13.2 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958274 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:27:42 Started mapping on | Dec 06 18:27:42 Finished on | Dec 06 18:29:51 Mapping speed, Million of reads per hour | 421.69 Number of input reads | 15110640 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14696458 Uniquely mapped reads % | 97.26% Average mapped length | 297.79 Number of splices: Total | 17791252 Number of splices: Annotated (sjdb) | 16774065 Number of splices: GT/AG | 17549577 Number of splices: GC/AG | 204249 Number of splices: AT/AC | 6640 Number of splices: Non-canonical | 30786 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161189 % of reads mapped to multiple loci | 1.07% Number of reads mapped to too many loci | 5576 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.40% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 256350 256350 256350 N_multimapping 161189 161189 161189 N_noFeature 529473 14215444 653082 N_ambiguous 407926 1873 51088 UnstrandedReadsAssigned:13759059 PositiveStrandReadsAssigned:479141 NegativeStrandReadsAssigned:13992288 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958274 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958274-trimmed-pair1.fastq SRR6958274-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,110,640 reads, 13,966,516 reads pseudoaligned [quant] estimated average fragment length: 257.26 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR6958274.ke.tsv 35125 SRR6958274.se.tsv 88098 total ==> SRR6958274.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 680.095 0 0 PNS24247 1044 787.74 48.4646 6.78888 PNS24249 1928 1671.74 18.4095 1.21515 PNS24246 1044 787.74 48.4646 6.78888 PNS24248 1044 787.74 48.4646 6.78888 PNS24244 1471 1214.74 27.1968 2.47053 PNS24243 293 79.5353 0 0 KQK14069 1603 1346.74 4769.35 390.779 KQK14071 474 225.332 34.8518 17.0671 ==> SRR6958274.se.tsv <== BRADI_1g14170v3 5220 BRADI_1g53295v3 894 BRADI_1g59795v3 55 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 235 BRADI_1g74790v3 62 BRADI_1g09890v3 0 BRADI_1g77505v3 168 BRADI_1g48960v3 0 SRR6958274 completed mapping pipeline successfully