Starting /dee2/code/volunteer_pipeline.sh SRR6958275 current disk space = 1550097592320 free memory = 1589698364 SRR6958275 SRAfilesize 588922289e10ce4d318ae229007f8d5a SRR6958275.sra SRR6958275.sra file validated SRR6958275 is paired end SRR6958275 is conventional basespace SRR6958275 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958275_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.27325 32.0 28.0 33.0 18.0 34.0 2 30.25825 31.0 29.0 33.0 25.0 34.0 3 30.27575 31.0 29.0 33.0 25.0 33.0 4 32.1465 33.0 32.0 33.0 31.0 34.0 5 32.72925 33.0 33.0 33.0 32.0 34.0 6 36.4755 38.0 37.0 38.0 34.0 38.0 7 37.231 38.0 38.0 38.0 36.0 38.0 8 34.92 38.0 36.0 38.0 26.0 38.0 9 36.90525 38.0 38.0 38.0 34.0 38.0 10-14 36.12695 38.0 35.8 38.0 31.2 38.0 15-19 37.43055 38.0 38.0 38.0 37.2 38.0 20-24 37.6235 38.0 38.0 38.0 38.0 38.0 25-29 37.5869 38.0 38.0 38.0 38.0 38.0 30-34 37.533249999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.26475000000001 38.0 38.0 38.0 36.8 38.0 40-44 37.47185 38.0 38.0 38.0 37.8 38.0 45-49 37.51265000000001 38.0 38.0 38.0 37.8 38.0 50-54 36.845349999999996 38.0 37.8 38.0 35.0 38.0 55-59 37.19545 38.0 38.0 38.0 36.4 38.0 60-64 37.3315 38.0 38.0 38.0 37.0 38.0 65-69 37.362199999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.3815 38.0 38.0 38.0 37.0 38.0 75-79 36.94565 38.0 38.0 38.0 35.2 38.0 80-84 37.0773 38.0 38.0 38.0 35.8 38.0 85-89 37.29515 38.0 38.0 38.0 36.6 38.0 90-94 35.25365 37.8 34.2 38.0 29.6 38.0 95-99 36.90839999999999 38.0 37.8 38.0 35.0 38.0 100-104 36.949400000000004 38.0 38.0 38.0 35.2 38.0 105-109 36.83515 38.0 38.0 38.0 35.0 38.0 110-114 36.7201 38.0 38.0 38.0 34.8 38.0 115-119 36.49125 38.0 37.6 38.0 34.0 38.0 120-124 36.3598 38.0 37.8 38.0 33.8 38.0 125-129 36.31505 38.0 38.0 38.0 33.8 38.0 130-134 36.205600000000004 38.0 37.8 38.0 33.4 38.0 135-139 36.07285 38.0 38.0 38.0 32.6 38.0 140-144 35.62045 38.0 36.4 38.0 31.0 38.0 145-149 34.97135 38.0 36.0 38.0 31.0 38.0 150-151 30.633000000000003 35.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 0.0 19 0.0 20 3.0 21 0.0 22 0.0 23 5.0 24 3.0 25 6.0 26 6.0 27 12.0 28 16.0 29 24.0 30 36.0 31 51.0 32 67.0 33 107.0 34 157.0 35 258.0 36 799.0 37 2446.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.0 9.532467532467532 6.597402597402597 37.87012987012987 2 23.9 12.8 35.05 28.249999999999996 3 21.875 16.175 26.275 35.675000000000004 4 27.525 24.0 21.45 27.025 5 25.05 28.299999999999997 25.0 21.65 6 21.95 32.225 24.349999999999998 21.475 7 16.900000000000002 23.974999999999998 38.800000000000004 20.325 8 21.175 22.3 29.425 27.1 9 20.849999999999998 20.8 32.95 25.4 10-14 23.02 25.7 26.119999999999997 25.16 15-19 23.14 25.34 26.11 25.41 20-24 22.96 25.4 26.064999999999998 25.575 25-29 23.035 25.52 26.025 25.419999999999998 30-34 22.8 25.874999999999996 25.369999999999997 25.955000000000002 35-39 23.265 25.324999999999996 26.284999999999997 25.124999999999996 40-44 23.625 24.925 25.924999999999997 25.525 45-49 22.56 25.185000000000002 26.325 25.929999999999996 50-54 22.88 25.27 25.990000000000002 25.86 55-59 23.75 25.15 25.47 25.629999999999995 60-64 23.265 25.374999999999996 25.765 25.595000000000002 65-69 23.205000000000002 25.064999999999998 26.064999999999998 25.665 70-74 23.525 24.95 26.015 25.509999999999998 75-79 23.48 25.445 25.8 25.275 80-84 23.525 25.205 25.895000000000003 25.374999999999996 85-89 23.375 25.195 25.96 25.47 90-94 23.53 24.959999999999997 25.919999999999998 25.590000000000003 95-99 23.535 24.25 26.21 26.005 100-104 23.685000000000002 25.874999999999996 25.224999999999998 25.215 105-109 24.285 24.85 25.3 25.564999999999998 110-114 23.68 25.585 25.19 25.545 115-119 23.72 25.264999999999997 25.765 25.25 120-124 23.69 24.560000000000002 25.790000000000003 25.96 125-129 22.955000000000002 25.385 25.505 26.155 130-134 23.630000000000003 25.974999999999998 25.095 25.3 135-139 24.258638795819373 25.548832324848725 24.52367855178277 25.66885032754913 140-144 24.165 25.31 24.745 25.779999999999998 145-149 24.23 25.779999999999998 24.425 25.564999999999998 150-151 24.3625 25.937500000000004 24.212500000000002 25.4875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 5.0 29 5.5 30 4.5 31 11.0 32 17.5 33 19.5 34 29.5 35 40.0 36 43.5 37 57.5 38 75.0 39 94.0 40 127.0 41 156.0 42 176.0 43 186.5 44 197.0 45 218.0 46 217.0 47 186.5 48 179.0 49 191.5 50 176.5 51 145.0 52 128.5 53 122.0 54 111.5 55 101.0 56 99.0 57 88.0 58 77.5 59 78.5 60 73.0 61 71.5 62 66.5 63 61.0 64 63.0 65 56.5 66 50.0 67 42.5 68 36.0 69 30.5 70 20.0 71 17.0 72 14.5 73 8.5 74 5.5 75 6.5 76 4.5 77 1.5 78 0.0 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.015 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.9249999999999999 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.3499999999999996 0.0 0.0 0.0 0.0 110-111 2.675 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.3125 0.0 0.0 0.0 0.0 116-117 3.6125 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.35 0.0 0.0 0.0 0.0 122-123 4.6 0.0 0.0 0.0 0.0 124-125 5.05 0.0 0.0 0.0 0.0 126-127 5.6 0.0 0.0 0.0 0.0 128-129 6.0 0.0 0.0 0.0 0.0 130-131 6.475 0.0 0.0 0.0 0.0 132-133 6.975 0.0 0.0 0.0 0.0 134-135 7.512499999999999 0.0 0.0 0.0 0.0 136-137 8.0875 0.0 0.0 0.0 0.0 138-139 8.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958275 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958275_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03975 33.0 33.0 34.0 32.0 34.0 2 33.11375 34.0 33.0 34.0 32.0 34.0 3 33.1795 34.0 33.0 34.0 33.0 34.0 4 33.128 34.0 33.0 34.0 33.0 34.0 5 32.96175 34.0 33.0 34.0 32.0 34.0 6 37.131 38.0 38.0 38.0 36.0 38.0 7 37.25625 38.0 38.0 38.0 37.0 38.0 8 37.191 38.0 38.0 38.0 37.0 38.0 9 37.27825 38.0 38.0 38.0 37.0 38.0 10-14 37.27825 38.0 38.0 38.0 37.0 38.0 15-19 37.30005 38.0 38.0 38.0 37.0 38.0 20-24 37.2913 38.0 38.0 38.0 37.0 38.0 25-29 37.2238 38.0 38.0 38.0 37.0 38.0 30-34 37.2438 38.0 38.0 38.0 37.0 38.0 35-39 36.6808 38.0 38.0 38.0 34.8 38.0 40-44 36.5972 38.0 38.0 38.0 34.6 38.0 45-49 36.64035 38.0 38.0 38.0 35.0 38.0 50-54 36.996599999999994 38.0 38.0 38.0 36.2 38.0 55-59 35.62095 38.0 36.4 38.0 28.4 38.0 60-64 36.9976 38.0 38.0 38.0 36.0 38.0 65-69 37.00105 38.0 38.0 38.0 36.0 38.0 70-74 37.023649999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.39255000000001 38.0 37.4 38.0 33.2 38.0 80-84 36.7362 38.0 38.0 38.0 35.0 38.0 85-89 35.79735 38.0 36.8 38.0 29.6 38.0 90-94 36.2391 38.0 37.8 38.0 33.6 38.0 95-99 36.4562 38.0 38.0 38.0 34.2 38.0 100-104 36.4298 38.0 38.0 38.0 34.0 38.0 105-109 36.363299999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.208600000000004 38.0 38.0 38.0 33.8 38.0 115-119 36.0818 38.0 38.0 38.0 33.4 38.0 120-124 35.79325 38.0 36.8 38.0 32.4 38.0 125-129 35.48945 38.0 36.4 38.0 31.0 38.0 130-134 34.4913 38.0 34.6 38.0 25.4 38.0 135-139 33.10765 38.0 32.2 38.0 20.2 38.0 140-144 34.14615 38.0 34.6 38.0 25.4 38.0 145-149 33.43489999999999 38.0 33.6 38.0 20.2 38.0 150-151 27.815375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 1.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 2.0 15 1.0 16 2.0 17 1.0 18 3.0 19 3.0 20 6.0 21 7.0 22 3.0 23 2.0 24 11.0 25 9.0 26 16.0 27 24.0 28 43.0 29 54.0 30 61.0 31 65.0 32 89.0 33 130.0 34 184.0 35 306.0 36 724.0 37 2240.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.675 19.725 10.2 30.4 2 30.425 22.75 28.349999999999998 18.475 3 21.45 25.6 28.175 24.775 4 24.349999999999998 32.7 20.349999999999998 22.6 5 27.025 33.725 19.525000000000002 19.725 6 22.325 35.8 19.900000000000002 21.975 7 22.325 21.025 33.675 22.975 8 24.05 22.775000000000002 23.65 29.525000000000002 9 23.65 21.85 27.950000000000003 26.55 10-14 25.845000000000002 26.16 22.96 25.035 15-19 25.01750525157547 25.492647794338303 24.902470741222366 24.58737621286386 20-24 25.881470367591895 25.98149537384346 24.711177794448613 23.42585646411603 25-29 25.45 25.455 24.485 24.610000000000003 30-34 25.36 26.0 24.555 24.085 35-39 25.311327831957993 26.03150787696924 24.266066516629156 24.391097774443608 40-44 25.603840576086412 25.343801570235534 24.508676301445217 24.543681552232837 45-49 25.874999999999996 25.605 24.51 24.01 50-54 25.983897584637695 25.74386157923689 24.59868980347052 23.6735510326549 55-59 26.128919337900687 25.248787318097715 24.493674051107668 24.128619292893934 60-64 25.790000000000003 26.1 24.435000000000002 23.674999999999997 65-69 25.736434108527135 25.41635408852213 24.44611152788197 24.401100275068767 70-74 25.840000000000003 25.21 24.560000000000002 24.39 75-79 25.455 25.485000000000003 24.97 24.09 80-84 26.255 25.455 24.795 23.494999999999997 85-89 26.321580395098778 25.656414103525883 24.306076519129782 23.71592898224556 90-94 25.740000000000002 25.729999999999997 24.685000000000002 23.845 95-99 26.275 25.8 24.425 23.5 100-104 25.96149037259315 25.41635408852213 24.48112028007002 24.141035258814703 105-109 26.408961344201632 25.433815072260842 24.37365604840726 23.78356753513027 110-114 26.497949384815445 25.88776632989897 24.287286185855756 23.32699809942983 115-119 26.531632908227053 26.556639159789945 23.460865216304075 23.45086271567892 120-124 26.655 26.435 23.830000000000002 23.080000000000002 125-129 26.57632881644082 25.551277563878195 24.74123706185309 23.131156557827893 130-134 27.426856714178545 25.4913728432108 23.6609152288072 23.420855213803453 135-139 26.751687921980494 26.93173293323331 23.98599649912478 22.330582645661416 140-144 26.945000000000004 26.529999999999998 23.98 22.545 145-149 27.284999999999997 26.22 23.885 22.61 150-151 27.675 26.674999999999997 24.025 21.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 2.5 26 2.5 27 1.5 28 4.5 29 5.5 30 4.0 31 9.0 32 14.0 33 16.5 34 19.5 35 27.0 36 43.0 37 49.5 38 67.5 39 96.0 40 118.5 41 155.5 42 179.5 43 169.5 44 167.5 45 196.0 46 201.5 47 175.0 48 176.5 49 183.5 50 157.5 51 153.0 52 137.0 53 108.5 54 108.0 55 116.0 56 111.5 57 90.5 58 95.0 59 102.0 60 84.5 61 78.0 62 82.0 63 77.0 64 64.0 65 52.0 66 55.0 67 55.5 68 42.0 69 32.5 70 31.0 71 25.5 72 19.0 73 12.0 74 5.5 75 3.5 76 5.0 77 3.0 78 1.0 79 2.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.03 20-24 0.025 25-29 0.0 30-34 0.0 35-39 0.025 40-44 0.015 45-49 0.0 50-54 0.015 55-59 0.015 60-64 0.0 65-69 0.025 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.015 110-114 0.03 115-119 0.025 120-124 0.0 125-129 0.005 130-134 0.025 135-139 0.025 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19130654536265 98.125 2 0.6570634318928481 1.3 3 0.0758150113722517 0.22499999999999998 4 0.025271670457417232 0.1 5 0.050543340914834464 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 1.925 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 2.7750000000000004 0.0 0.0 0.0 0.0 112-113 3.0125 0.0 0.0 0.0 0.0 114-115 3.3875 0.0 0.0 0.0 0.0 116-117 3.6875 0.0 0.0 0.0 0.0 118-119 4.1375 0.0 0.0 0.0 0.0 120-121 4.45 0.0 0.0 0.0 0.0 122-123 4.6875 0.0 0.0 0.0 0.0 124-125 5.074999999999999 0.0 0.0 0.0 0.0 126-127 5.550000000000001 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.35 0.0 0.0 0.0 0.0 132-133 6.825 0.0 0.0 0.0 0.0 134-135 7.35 0.0 0.0 0.0 0.0 136-137 7.9125000000000005 0.0 0.0 0.0 0.0 138-139 8.587499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1443011 spots for SRR6958275.sra Written 1443011 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra Read 1442995 spots for SRR6958275.sra Written 1442995 spots for SRR6958275.sra SRR ids: ['SRR6958275.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vqum9r6_ SRR6958275.sra spots: 28859916 blocks: [[1, 1442995], [1442996, 2885990], [2885991, 4328985], [4328986, 5771980], [5771981, 7214975], [7214976, 8657970], [8657971, 10100965], [10100966, 11543960], [11543961, 12986955], [12986956, 14429950], [14429951, 15872945], [15872946, 17315940], [17315941, 18758935], [18758936, 20201930], [20201931, 21644925], [21644926, 23087920], [23087921, 24530915], [24530916, 25973910], [25973911, 27416905], [27416906, 28859916]] SRR6958275 file size 9757978 SRR6958275 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958275 SRR6958275_1.fastq SRR6958275_2.fastq Input file: SRR6958275_1.fastq Paired file: SRR6958275_2.fastq trimmed: SRR6958275-trimmed-pair1.fastq, SRR6958275-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:38:22 2024 >> started Fri Dec 6 18:38:55 2024 >> done (33.500s) 28859916 read pairs processed; of these: 19005 ( 0.07%) short read pairs filtered out after trimming by size control 22292 ( 0.08%) empty read pairs filtered out after trimming by size control 28818619 (99.86%) read pairs available; of these: 11697943 (40.59%) trimmed read pairs available after processing 17120676 (59.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 14 0.00% 20 16 0.00% 21 24 0.00% 22 19 0.00% 23 11 0.00% 24 24 0.00% 25 24 0.00% 26 21 0.00% 27 21 0.00% 28 17 0.00% 29 16 0.00% 30 26 0.00% 31 34 0.00% 32 31 0.00% 33 33 0.00% 34 39 0.00% 35 44 0.00% 36 38 0.00% 37 36 0.00% 38 53 0.00% 39 53 0.00% 40 54 0.00% 41 58 0.00% 42 80 0.00% 43 61 0.00% 44 83 0.00% 45 66 0.00% 46 105 0.00% 47 99 0.00% 48 112 0.00% 49 158 0.00% 50 198 0.00% 51 228 0.00% 52 208 0.00% 53 215 0.00% 54 236 0.00% 55 274 0.00% 56 315 0.00% 57 364 0.00% 58 413 0.00% 59 502 0.00% 60 612 0.00% 61 658 0.00% 62 728 0.00% 63 780 0.00% 64 937 0.00% 65 1044 0.00% 66 1142 0.00% 67 1312 0.00% 68 1418 0.00% 69 1570 0.01% 70 1798 0.01% 71 2128 0.01% 72 2459 0.01% 73 2681 0.01% 74 3038 0.01% 75 3336 0.01% 76 3750 0.01% 77 4216 0.01% 78 4737 0.02% 79 5270 0.02% 80 5808 0.02% 81 6652 0.02% 82 7632 0.03% 83 8585 0.03% 84 10205 0.04% 85 11522 0.04% 86 12253 0.04% 87 13216 0.05% 88 14583 0.05% 89 15312 0.05% 90 16728 0.06% 91 18172 0.06% 92 19361 0.07% 93 21154 0.07% 94 22818 0.08% 95 23952 0.08% 96 25961 0.09% 97 27346 0.09% 98 28663 0.10% 99 30577 0.11% 100 32554 0.11% 101 34265 0.12% 102 36736 0.13% 103 38373 0.13% 104 40616 0.14% 105 42038 0.15% 106 44663 0.15% 107 45773 0.16% 108 47421 0.16% 109 49755 0.17% 110 51451 0.18% 111 53326 0.19% 112 56338 0.20% 113 58770 0.20% 114 60702 0.21% 115 64135 0.22% 116 64971 0.23% 117 67318 0.23% 118 69028 0.24% 119 69782 0.24% 120 72517 0.25% 121 74009 0.26% 122 75924 0.26% 123 78673 0.27% 124 82515 0.29% 125 84613 0.29% 126 86945 0.30% 127 89177 0.31% 128 89400 0.31% 129 91936 0.32% 130 94885 0.33% 131 96620 0.34% 132 99589 0.35% 133 104391 0.36% 134 108020 0.37% 135 110748 0.38% 136 113860 0.40% 137 117280 0.41% 138 120412 0.42% 139 126102 0.44% 140 132789 0.46% 141 139392 0.48% 142 149827 0.52% 143 161028 0.56% 144 177731 0.62% 145 202251 0.70% 146 240231 0.83% 147 306999 1.07% 148 436678 1.52% 149 838202 2.91% 150 5578631 19.36% 151 17120676 59.41% 28818619 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=23 prefix-density=0.78 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=48.40 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=22 prefix-density=0.45 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=86.49 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.5 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958275 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:39:38 Started mapping on | Dec 06 18:39:39 Finished on | Dec 06 18:41:48 Mapping speed, Million of reads per hour | 804.24 Number of input reads | 28818619 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 28246187 Uniquely mapped reads % | 98.01% Average mapped length | 293.24 Number of splices: Total | 31323123 Number of splices: Annotated (sjdb) | 29346570 Number of splices: GT/AG | 30920989 Number of splices: GC/AG | 364243 Number of splices: AT/AC | 11858 Number of splices: Non-canonical | 26033 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 182970 % of reads mapped to multiple loci | 0.63% Number of reads mapped to too many loci | 19133 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 404183 404183 404183 N_multimapping 182970 182970 182970 N_noFeature 1083872 27403142 1359298 N_ambiguous 675798 3892 109518 UnstrandedReadsAssigned:26486517 PositiveStrandReadsAssigned:839153 NegativeStrandReadsAssigned:26777371 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958275 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958275-trimmed-pair1.fastq SRR6958275-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,818,619 reads, 26,826,706 reads pseudoaligned [quant] estimated average fragment length: 252.978 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52973 SRR6958275.ke.tsv 35125 SRR6958275.se.tsv 88098 total ==> SRR6958275.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 684.524 0 0 PNS24247 1044 792.022 86.2114 6.16226 PNS24249 1928 1676.02 68.4862 2.31332 PNS24246 1044 792.022 86.2114 6.16226 PNS24248 1044 792.022 86.2114 6.16226 PNS24244 1471 1219.02 41.8796 1.94493 PNS24243 293 98.7612 0 0 KQK14069 1603 1351.02 5725.62 239.924 KQK14071 474 241.308 107.282 25.1691 ==> SRR6958275.se.tsv <== BRADI_1g14170v3 6572 BRADI_1g53295v3 488 BRADI_1g59795v3 365 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 341 BRADI_1g74790v3 135 BRADI_1g09890v3 0 BRADI_1g77505v3 276 BRADI_1g48960v3 0 SRR6958275 completed mapping pipeline successfully