Starting /dee2/code/volunteer_pipeline.sh SRR6958276 current disk space = 1550111842304 free memory = 1600100732 SRR6958276 SRAfilesize 3e29b8e5f05b00e2210eb1f089be735a SRR6958276.sra SRR6958276.sra file validated SRR6958276 is paired end SRR6958276 is conventional basespace SRR6958276 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958276_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.449 18.0 18.0 25.0 18.0 32.0 2 26.347 27.0 25.0 30.0 18.0 31.0 3 25.87775 27.0 18.0 31.0 18.0 33.0 4 30.1265 31.0 29.0 33.0 27.0 33.0 5 32.074 33.0 32.0 33.0 32.0 33.0 6 36.45975 38.0 37.0 38.0 34.0 38.0 7 37.056 38.0 38.0 38.0 35.0 38.0 8 36.9255 38.0 38.0 38.0 35.0 38.0 9 37.04075 38.0 38.0 38.0 36.0 38.0 10-14 37.24015 38.0 38.0 38.0 36.4 38.0 15-19 37.244 38.0 38.0 38.0 36.6 38.0 20-24 37.269749999999995 38.0 38.0 38.0 36.8 38.0 25-29 37.324349999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.1566 38.0 38.0 38.0 36.4 38.0 35-39 37.10895000000001 38.0 38.0 38.0 36.2 38.0 40-44 37.1245 38.0 38.0 38.0 36.0 38.0 45-49 37.18175000000001 38.0 38.0 38.0 36.2 38.0 50-54 36.94715 38.0 38.0 38.0 35.4 38.0 55-59 36.472750000000005 38.0 37.6 38.0 34.0 38.0 60-64 36.014450000000004 38.0 37.0 38.0 31.8 38.0 65-69 35.61435 38.0 36.2 38.0 29.4 38.0 70-74 35.7209 38.0 36.2 38.0 30.2 38.0 75-79 36.277300000000004 38.0 37.0 38.0 33.0 38.0 80-84 36.26705 38.0 37.2 38.0 33.2 38.0 85-89 36.05165 38.0 37.0 38.0 32.6 38.0 90-94 36.038650000000004 38.0 37.0 38.0 32.6 38.0 95-99 35.699 38.0 36.6 38.0 30.4 38.0 100-104 35.26395 38.0 35.8 38.0 29.0 38.0 105-109 34.704150000000006 38.0 34.8 38.0 26.4 38.0 110-114 34.07775 38.0 34.0 38.0 23.4 38.0 115-119 33.490750000000006 37.6 33.6 38.0 18.0 38.0 120-124 33.293150000000004 37.2 33.2 38.0 17.4 38.0 125-129 34.1414 38.0 34.0 38.0 23.2 38.0 130-134 34.0861 38.0 34.0 38.0 23.2 38.0 135-139 33.79165 38.0 34.0 38.0 22.8 38.0 140-144 33.05775 37.8 33.4 38.0 17.2 38.0 145-149 31.68505 36.4 31.8 38.0 11.4 38.0 150-151 26.941125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 1.0 15 2.0 16 2.0 17 2.0 18 1.0 19 4.0 20 3.0 21 7.0 22 6.0 23 10.0 24 9.0 25 10.0 26 21.0 27 39.0 28 46.0 29 71.0 30 75.0 31 113.0 32 175.0 33 235.0 34 362.0 35 599.0 36 1191.0 37 1012.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.388429752066116 8.1267217630854 19.11845730027548 39.366391184573004 2 26.075 12.7 34.1 27.125 3 23.125 16.325 26.025 34.525 4 25.1 25.35 23.25 26.3 5 25.21891418563923 29.797348011008257 23.642732049036777 21.341005754315738 6 22.625 31.724999999999998 25.05 20.599999999999998 7 17.175 22.15 41.0 19.675 8 21.875 23.7 29.65 24.775 9 19.675 22.45 34.225 23.65 10-14 22.905 26.179999999999996 26.424999999999997 24.490000000000002 15-19 22.91 25.255 26.525 25.31 20-24 22.955000000000002 26.445 26.015 24.585 25-29 22.865 25.935000000000002 26.105 25.095 30-34 22.64 26.340000000000003 25.895000000000003 25.124999999999996 35-39 22.615 25.255 26.645000000000003 25.485000000000003 40-44 23.474999999999998 25.36 26.395000000000003 24.77 45-49 22.725 25.540000000000003 26.41 25.324999999999996 50-54 22.275 25.230000000000004 26.935 25.56 55-59 22.765 25.395 26.484999999999996 25.355 60-64 22.45 25.505 26.340000000000003 25.705 65-69 22.71 25.130000000000003 26.5 25.66 70-74 22.81 25.25 26.240000000000002 25.7 75-79 22.33 25.985000000000003 26.39 25.295 80-84 23.330000000000002 25.345000000000002 26.029999999999998 25.295 85-89 23.57 25.285000000000004 26.119999999999997 25.025 90-94 23.265 24.9 26.075 25.759999999999998 95-99 22.63 25.46 26.57 25.34 100-104 23.325000000000003 25.335 25.56 25.779999999999998 105-109 23.244999999999997 25.96 26.095000000000002 24.7 110-114 23.0 25.674999999999997 26.11 25.215 115-119 23.1 25.324999999999996 26.145000000000003 25.430000000000003 120-124 22.805 25.85 25.55 25.795 125-129 23.1 25.4 25.935000000000002 25.564999999999998 130-134 22.965 24.77 26.6 25.665 135-139 23.380000000000003 25.165 25.595000000000002 25.86 140-144 23.03 25.0 26.290000000000003 25.679999999999996 145-149 23.044999999999998 25.64 25.855 25.46 150-151 23.775 24.85 25.724999999999998 25.650000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 1.0 28 1.5 29 3.5 30 5.5 31 11.0 32 14.5 33 16.0 34 25.5 35 41.5 36 60.0 37 70.5 38 79.5 39 111.5 40 138.5 41 156.5 42 170.5 43 194.5 44 219.5 45 213.0 46 217.5 47 224.0 48 209.0 49 186.5 50 176.5 51 166.0 52 140.5 53 120.0 54 108.5 55 98.5 56 96.5 57 97.0 58 86.5 59 75.0 60 65.0 61 59.0 62 54.5 63 51.0 64 43.5 65 33.5 66 28.0 67 21.0 68 18.0 69 19.5 70 15.0 71 11.5 72 11.5 73 8.0 74 5.5 75 5.5 76 5.0 77 2.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.25 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4778672032193159 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025150905432595575 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7875000000000001 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.8999999999999999 0.0 0.0 0.0 0.0 120-121 1.1124999999999998 0.0 0.0 0.0 0.0 122-123 1.2625000000000002 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.7000000000000002 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.3 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138-139 2.9625000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGACT 10 0.006841402 144.925 2 CGTATTT 10 0.006841402 144.925 3 CAGACTT 10 0.006841402 144.925 3 >>END_MODULE SRR6958276 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958276_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.939 33.0 33.0 34.0 32.0 34.0 2 32.9375 34.0 33.0 34.0 32.0 34.0 3 32.8955 34.0 33.0 34.0 32.0 34.0 4 32.9655 34.0 33.0 34.0 32.0 34.0 5 32.86575 34.0 33.0 34.0 32.0 34.0 6 36.84775 38.0 38.0 38.0 36.0 38.0 7 36.744 38.0 38.0 38.0 35.0 38.0 8 36.58375 38.0 38.0 38.0 35.0 38.0 9 36.7835 38.0 38.0 38.0 35.0 38.0 10-14 36.79275 38.0 38.0 38.0 35.6 38.0 15-19 36.93795 38.0 38.0 38.0 36.0 38.0 20-24 37.0201 38.0 38.0 38.0 36.4 38.0 25-29 36.96065 38.0 38.0 38.0 36.0 38.0 30-34 36.855999999999995 38.0 38.0 38.0 35.8 38.0 35-39 36.6828 38.0 38.0 38.0 34.8 38.0 40-44 36.70055 38.0 38.0 38.0 35.0 38.0 45-49 36.734899999999996 38.0 38.0 38.0 35.2 38.0 50-54 36.74715 38.0 38.0 38.0 35.4 38.0 55-59 36.66925 38.0 38.0 38.0 35.0 38.0 60-64 36.6577 38.0 38.0 38.0 35.0 38.0 65-69 36.58605 38.0 38.0 38.0 34.6 38.0 70-74 36.54545 38.0 38.0 38.0 34.4 38.0 75-79 36.3945 38.0 38.0 38.0 34.0 38.0 80-84 36.2188 38.0 38.0 38.0 33.6 38.0 85-89 36.113800000000005 38.0 38.0 38.0 33.0 38.0 90-94 36.14265 38.0 38.0 38.0 33.2 38.0 95-99 36.08945 38.0 37.6 38.0 33.4 38.0 100-104 35.7862 38.0 37.0 38.0 32.0 38.0 105-109 35.126 38.0 36.0 38.0 28.0 38.0 110-114 34.8243 38.0 35.4 38.0 27.2 38.0 115-119 34.72715000000001 38.0 35.2 38.0 26.6 38.0 120-124 34.3761 38.0 35.0 38.0 24.4 38.0 125-129 33.97775 38.0 34.2 38.0 23.0 38.0 130-134 33.122550000000004 38.0 33.6 38.0 17.2 38.0 135-139 31.777350000000002 36.4 31.6 38.0 14.0 38.0 140-144 31.563850000000002 36.0 31.0 38.0 13.8 38.0 145-149 31.458799999999997 37.0 31.0 38.0 11.0 38.0 150-151 27.033 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 2.0 5 1.0 6 1.0 7 3.0 8 0.0 9 0.0 10 3.0 11 0.0 12 2.0 13 1.0 14 1.0 15 3.0 16 5.0 17 7.0 18 2.0 19 7.0 20 6.0 21 6.0 22 15.0 23 15.0 24 17.0 25 25.0 26 19.0 27 36.0 28 32.0 29 38.0 30 86.0 31 77.0 32 118.0 33 169.0 34 252.0 35 427.0 36 839.0 37 1770.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.7 19.650000000000002 11.5 31.15 2 30.725 21.9 28.599999999999998 18.775 3 21.575 24.85 29.799999999999997 23.775 4 24.925 32.45 21.275 21.349999999999998 5 27.400000000000002 33.275 20.549999999999997 18.775 6 22.975 37.05 19.775000000000002 20.200000000000003 7 22.85 21.15 33.775 22.225 8 23.674999999999997 23.5 24.675 28.15 9 24.55 22.425 27.6 25.424999999999997 10-14 25.67128356417821 26.65633281664083 23.481174058702937 24.191209560478026 15-19 25.71 25.724999999999998 24.47 24.095 20-24 25.22 26.39 24.46 23.93 25-29 26.153923088463273 26.428964344651696 24.398659798969845 23.018452767915186 30-34 25.145 26.145000000000003 25.155 23.555 35-39 25.419999999999998 25.629999999999995 24.755 24.195 40-44 25.64 25.445 25.09 23.825 45-49 25.44 25.615 24.855 24.09 50-54 25.4 25.445 25.105 24.05 55-59 25.655 26.055 24.775 23.515 60-64 25.85 25.82 24.85 23.48 65-69 25.415 26.0 25.174999999999997 23.41 70-74 25.69 25.91 25.0 23.400000000000002 75-79 25.845000000000002 25.64 25.165 23.35 80-84 25.47 26.279999999999998 24.89 23.36 85-89 25.115 26.119999999999997 25.25 23.515 90-94 25.790000000000003 26.145000000000003 25.03 23.035 95-99 25.355 25.665 25.619999999999997 23.36 100-104 25.765 25.745 25.36 23.13 105-109 25.745 25.805 25.485000000000003 22.965 110-114 25.569999999999997 26.38 25.045 23.005 115-119 25.405 26.540000000000003 25.03 23.025000000000002 120-124 26.08 26.145000000000003 25.31 22.465 125-129 25.785000000000004 26.66 24.86 22.695 130-134 25.677567756775677 26.752675267526755 24.837483748374837 22.732273227322732 135-139 26.135454181672667 26.120448179271712 24.359743897559024 23.3843537414966 140-144 25.829206063334837 27.034869178047927 24.433438391115114 22.702486367502125 145-149 26.235000000000003 26.1 25.05 22.615 150-151 26.187500000000004 27.1125 24.0375 22.662499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 1.5 27 1.5 28 4.5 29 6.0 30 8.0 31 11.0 32 11.5 33 13.0 34 21.0 35 30.5 36 47.5 37 58.0 38 70.5 39 101.5 40 120.5 41 148.5 42 174.5 43 188.5 44 198.5 45 184.0 46 195.0 47 207.5 48 200.5 49 188.5 50 167.5 51 156.0 52 149.0 53 138.0 54 119.0 55 109.5 56 106.0 57 99.5 58 87.5 59 76.0 60 71.0 61 68.0 62 57.0 63 54.5 64 60.0 65 51.0 66 42.5 67 36.5 68 31.0 69 27.5 70 28.0 71 26.0 72 16.0 73 10.5 74 8.5 75 4.0 76 0.0 77 0.5 78 0.5 79 0.0 80 1.5 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.04 140-144 0.055 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08952959028832 97.95 2 0.7081436519979768 1.4000000000000001 3 0.15174506828528073 0.44999999999999996 4 0.05058168942842691 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7875000000000001 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.8999999999999999 0.0 0.0 0.0 0.0 120-121 1.1124999999999998 0.0 0.0 0.0 0.0 122-123 1.2625000000000002 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.6749999999999998 0.0 0.0 0.0 0.0 128-129 1.7875 0.0 0.0 0.0 0.0 130-131 2.0 0.0 0.0 0.0 0.0 132-133 2.2625 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGACAAG 30 0.0017973486 72.5 1 >>END_MODULE Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978691 spots for SRR6958276.sra Written 978691 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra Read 978679 spots for SRR6958276.sra Written 978679 spots for SRR6958276.sra SRR ids: ['SRR6958276.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_esk1manz SRR6958276.sra spots: 19573592 blocks: [[1, 978679], [978680, 1957358], [1957359, 2936037], [2936038, 3914716], [3914717, 4893395], [4893396, 5872074], [5872075, 6850753], [6850754, 7829432], [7829433, 8808111], [8808112, 9786790], [9786791, 10765469], [10765470, 11744148], [11744149, 12722827], [12722828, 13701506], [13701507, 14680185], [14680186, 15658864], [15658865, 16637543], [16637544, 17616222], [17616223, 18594901], [18594902, 19573592]] SRR6958276 file size 6611147 SRR6958276 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958276 SRR6958276_1.fastq SRR6958276_2.fastq Input file: SRR6958276_1.fastq Paired file: SRR6958276_2.fastq trimmed: SRR6958276-trimmed-pair1.fastq, SRR6958276-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:30:12 2024 >> started Fri Dec 6 18:30:32 2024 >> done (20.154s) 19573592 read pairs processed; of these: 17757 ( 0.09%) short read pairs filtered out after trimming by size control 13223 ( 0.07%) empty read pairs filtered out after trimming by size control 19542612 (99.84%) read pairs available; of these: 8073935 (41.31%) trimmed read pairs available after processing 11468677 (58.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 5 0.00% 21 7 0.00% 22 8 0.00% 23 9 0.00% 24 6 0.00% 25 7 0.00% 26 5 0.00% 27 6 0.00% 28 4 0.00% 29 12 0.00% 30 5 0.00% 31 9 0.00% 32 5 0.00% 33 6 0.00% 34 10 0.00% 35 15 0.00% 36 10 0.00% 37 10 0.00% 38 12 0.00% 39 14 0.00% 40 14 0.00% 41 9 0.00% 42 13 0.00% 43 19 0.00% 44 12 0.00% 45 18 0.00% 46 15 0.00% 47 21 0.00% 48 30 0.00% 49 30 0.00% 50 26 0.00% 51 24 0.00% 52 40 0.00% 53 39 0.00% 54 53 0.00% 55 45 0.00% 56 63 0.00% 57 50 0.00% 58 72 0.00% 59 79 0.00% 60 88 0.00% 61 107 0.00% 62 113 0.00% 63 131 0.00% 64 170 0.00% 65 147 0.00% 66 175 0.00% 67 194 0.00% 68 242 0.00% 69 227 0.00% 70 262 0.00% 71 340 0.00% 72 405 0.00% 73 418 0.00% 74 496 0.00% 75 546 0.00% 76 627 0.00% 77 752 0.00% 78 747 0.00% 79 848 0.00% 80 1031 0.01% 81 1102 0.01% 82 1331 0.01% 83 1571 0.01% 84 2456 0.01% 85 2924 0.01% 86 2959 0.02% 87 3204 0.02% 88 3450 0.02% 89 3612 0.02% 90 3681 0.02% 91 3945 0.02% 92 4402 0.02% 93 4713 0.02% 94 5063 0.03% 95 5500 0.03% 96 5815 0.03% 97 6371 0.03% 98 6477 0.03% 99 6964 0.04% 100 7557 0.04% 101 8024 0.04% 102 8583 0.04% 103 9451 0.05% 104 10024 0.05% 105 10841 0.06% 106 11434 0.06% 107 12157 0.06% 108 12593 0.06% 109 13153 0.07% 110 13755 0.07% 111 14854 0.08% 112 16310 0.08% 113 17119 0.09% 114 18167 0.09% 115 19321 0.10% 116 20765 0.11% 117 21496 0.11% 118 22360 0.11% 119 23072 0.12% 120 24765 0.13% 121 25769 0.13% 122 27432 0.14% 123 29250 0.15% 124 30829 0.16% 125 32775 0.17% 126 34817 0.18% 127 36746 0.19% 128 38328 0.20% 129 40715 0.21% 130 42732 0.22% 131 45725 0.23% 132 48685 0.25% 133 53102 0.27% 134 56226 0.29% 135 60757 0.31% 136 66159 0.34% 137 71273 0.36% 138 77054 0.39% 139 85289 0.44% 140 93462 0.48% 141 103300 0.53% 142 112495 0.58% 143 123029 0.63% 144 134550 0.69% 145 150509 0.77% 146 183134 0.94% 147 252642 1.29% 148 406733 2.08% 149 853265 4.37% 150 4356904 22.29% 151 11468677 58.69% 19542612 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=25 prefix-density=0.80 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=56.84 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.8 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=16 prefix-density=0.55 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=392.39 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=15.1 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958276 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:31:26 Started mapping on | Dec 06 18:31:27 Finished on | Dec 06 18:32:50 Mapping speed, Million of reads per hour | 847.63 Number of input reads | 19542612 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18896642 Uniquely mapped reads % | 96.69% Average mapped length | 296.69 Number of splices: Total | 21815337 Number of splices: Annotated (sjdb) | 20545202 Number of splices: GT/AG | 21538346 Number of splices: GC/AG | 253214 Number of splices: AT/AC | 7807 Number of splices: Non-canonical | 15970 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217952 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 35018 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.84% % of reads unmapped: other | 1.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 439700 439700 439700 N_multimapping 217952 217952 217952 N_noFeature 779467 18365329 933640 N_ambiguous 449677 2536 73595 UnstrandedReadsAssigned:17667498 PositiveStrandReadsAssigned:528777 NegativeStrandReadsAssigned:17889407 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958276 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958276-trimmed-pair1.fastq SRR6958276-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,542,612 reads, 17,961,861 reads pseudoaligned [quant] estimated average fragment length: 267.288 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR6958276.ke.tsv 35125 SRR6958276.se.tsv 88098 total ==> SRR6958276.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.129 0 0 PNS24247 1044 777.712 65.9148 7.15069 PNS24249 1928 1661.71 36.9295 1.875 PNS24246 1044 777.712 65.9148 7.15069 PNS24248 1044 777.712 65.9148 7.15069 PNS24244 1471 1204.71 18.3261 1.28343 PNS24243 293 82.5569 0 0 KQK14069 1603 1336.71 4395.91 277.456 KQK14071 474 222.848 48.9939 18.5488 ==> SRR6958276.se.tsv <== BRADI_1g14170v3 4880 BRADI_1g53295v3 309 BRADI_1g59795v3 258 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 232 BRADI_1g74790v3 80 BRADI_1g09890v3 0 BRADI_1g77505v3 216 BRADI_1g48960v3 0 SRR6958276 completed mapping pipeline successfully