Starting /dee2/code/volunteer_pipeline.sh SRR6958277 current disk space = 1550092980224 free memory = 1600115668 SRR6958277 SRAfilesize 5333c4fc6ce0dfd141ad7c005bfd3aa5 SRR6958277.sra SRR6958277.sra file validated SRR6958277 is paired end SRR6958277 is conventional basespace SRR6958277 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958277_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.96425 18.0 18.0 30.0 18.0 32.0 2 23.6955 25.0 18.0 28.0 18.0 31.0 3 27.6185 29.0 27.0 31.0 18.0 33.0 4 31.843 32.0 32.0 33.0 30.0 33.0 5 31.8635 33.0 32.0 33.0 31.0 33.0 6 36.35775 38.0 36.0 38.0 34.0 38.0 7 37.37125 38.0 38.0 38.0 36.0 38.0 8 37.48025 38.0 38.0 38.0 37.0 38.0 9 37.6065 38.0 38.0 38.0 38.0 38.0 10-14 37.530449999999995 38.0 38.0 38.0 37.8 38.0 15-19 37.5466 38.0 38.0 38.0 38.0 38.0 20-24 37.485749999999996 38.0 38.0 38.0 37.8 38.0 25-29 37.2322 38.0 38.0 38.0 36.8 38.0 30-34 37.277 38.0 38.0 38.0 37.0 38.0 35-39 37.57765 38.0 38.0 38.0 38.0 38.0 40-44 37.591249999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.493 38.0 38.0 38.0 37.6 38.0 50-54 37.4145 38.0 38.0 38.0 37.4 38.0 55-59 37.389799999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.4229 38.0 38.0 38.0 37.2 38.0 65-69 37.426300000000005 38.0 38.0 38.0 37.0 38.0 70-74 37.41374999999999 38.0 38.0 38.0 37.2 38.0 75-79 36.18865 38.0 36.8 38.0 30.8 38.0 80-84 37.1019 38.0 38.0 38.0 36.0 38.0 85-89 36.86285 38.0 38.0 38.0 35.4 38.0 90-94 36.652100000000004 38.0 38.0 38.0 34.4 38.0 95-99 36.20555 38.0 38.0 38.0 33.6 38.0 100-104 36.22905 38.0 38.0 38.0 33.6 38.0 105-109 36.13905 38.0 38.0 38.0 33.2 38.0 110-114 36.08855 38.0 38.0 38.0 33.4 38.0 115-119 36.419799999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.592150000000004 38.0 38.0 38.0 34.2 38.0 125-129 36.634299999999996 38.0 38.0 38.0 34.4 38.0 130-134 36.3215 38.0 38.0 38.0 34.0 38.0 135-139 35.6868 38.0 36.2 38.0 31.6 38.0 140-144 35.494350000000004 38.0 36.2 38.0 31.0 38.0 145-149 33.7205 38.0 33.4 38.0 23.0 38.0 150-151 29.734875000000002 35.5 27.5 38.0 10.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 2.0 16 3.0 17 0.0 18 4.0 19 2.0 20 4.0 21 0.0 22 3.0 23 1.0 24 3.0 25 11.0 26 10.0 27 13.0 28 15.0 29 31.0 30 39.0 31 58.0 32 70.0 33 91.0 34 149.0 35 298.0 36 834.0 37 2356.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.28767123287671 17.726027397260275 9.178082191780822 39.8082191780822 2 24.9 14.975 29.7 30.425 3 22.400000000000002 17.424999999999997 24.55 35.625 4 27.450000000000003 24.075 21.275 27.200000000000003 5 26.900000000000002 27.875 23.05 22.175 6 23.875 32.225 22.8 21.099999999999998 7 17.875 23.225 39.175 19.725 8 20.95 23.974999999999998 28.475 26.6 9 19.625 22.650000000000002 32.9 24.825 10-14 23.18 26.355 25.345000000000002 25.119999999999997 15-19 23.150000000000002 25.650000000000002 26.02 25.180000000000003 20-24 23.255 24.825 25.805 26.115 25-29 23.64 25.674999999999997 24.995 25.69 30-34 23.345 24.915000000000003 26.115 25.624999999999996 35-39 23.665 25.19 25.235000000000003 25.91 40-44 23.47 25.5 25.505 25.525 45-49 23.385 25.624999999999996 25.41 25.580000000000002 50-54 23.325000000000003 24.34 26.0 26.334999999999997 55-59 23.880000000000003 25.045 25.430000000000003 25.645 60-64 23.474999999999998 25.4 25.56 25.564999999999998 65-69 23.775 25.145 25.94 25.14 70-74 24.04 24.955 25.080000000000002 25.924999999999997 75-79 23.665 24.77 25.790000000000003 25.775 80-84 24.14 25.045 25.525 25.290000000000003 85-89 23.47 24.490000000000002 25.535000000000004 26.505000000000003 90-94 24.154999999999998 24.725 25.605 25.515 95-99 23.945 24.955 25.53 25.569999999999997 100-104 24.255 24.675 24.995 26.075 105-109 23.419999999999998 24.8 25.895000000000003 25.885 110-114 24.035 24.775 25.155 26.035000000000004 115-119 23.96 25.255 25.05 25.735000000000003 120-124 23.955000000000002 24.775 25.64 25.629999999999995 125-129 23.985 24.165 25.324999999999996 26.525 130-134 24.25 25.025 25.285000000000004 25.44 135-139 24.48 24.404999999999998 24.815 26.3 140-144 24.455 25.314999999999998 24.735 25.495 145-149 24.305 24.335 25.264999999999997 26.095000000000002 150-151 24.0125 25.0 25.0125 25.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 1.5 28 2.5 29 5.0 30 5.5 31 9.0 32 10.0 33 13.5 34 25.0 35 33.0 36 43.5 37 54.5 38 73.5 39 100.0 40 134.5 41 160.0 42 164.5 43 187.5 44 200.0 45 211.0 46 234.5 47 214.5 48 176.0 49 163.5 50 163.5 51 144.5 52 122.0 53 113.0 54 106.5 55 97.5 56 90.0 57 78.0 58 76.0 59 83.5 60 82.0 61 78.0 62 72.0 63 64.0 64 55.5 65 55.0 66 54.0 67 45.5 68 35.0 69 38.0 70 36.5 71 24.5 72 17.0 73 10.0 74 10.0 75 9.0 76 4.0 77 1.0 78 1.5 79 2.5 80 1.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.6802721088435374 1.35 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.3375000000000004 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.6125 0.0 0.0 0.0 0.0 130-131 4.0875 0.0 0.0 0.0 0.0 132-133 4.475 0.0 0.0 0.0 0.0 134-135 5.0 0.0 0.0 0.0 0.0 136-137 5.4625 0.0 0.0 0.0 0.0 138-139 6.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGATT 10 0.006841402 144.925 2 TCAACTT 10 0.006841402 144.925 3 CGGATTC 10 0.006841402 144.925 3 >>END_MODULE SRR6958277 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958277_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95725 33.0 33.0 34.0 32.0 34.0 2 33.1285 34.0 33.0 34.0 32.0 34.0 3 33.23625 34.0 33.0 34.0 33.0 34.0 4 33.157 34.0 33.0 34.0 33.0 34.0 5 33.20925 34.0 33.0 34.0 33.0 34.0 6 37.29125 38.0 38.0 38.0 37.0 38.0 7 37.16775 38.0 38.0 38.0 37.0 38.0 8 37.24975 38.0 38.0 38.0 37.0 38.0 9 37.30875 38.0 38.0 38.0 37.0 38.0 10-14 37.1436 38.0 38.0 38.0 36.8 38.0 15-19 37.096199999999996 38.0 38.0 38.0 36.6 38.0 20-24 37.028549999999996 38.0 38.0 38.0 36.4 38.0 25-29 37.1469 38.0 38.0 38.0 37.0 38.0 30-34 37.3206 38.0 38.0 38.0 37.4 38.0 35-39 37.39725 38.0 38.0 38.0 38.0 38.0 40-44 37.32445 38.0 38.0 38.0 37.2 38.0 45-49 37.20385 38.0 38.0 38.0 37.0 38.0 50-54 36.900349999999996 38.0 38.0 38.0 35.8 38.0 55-59 36.9724 38.0 38.0 38.0 36.0 38.0 60-64 36.950149999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.88915000000001 38.0 38.0 38.0 35.8 38.0 70-74 36.75485 38.0 38.0 38.0 35.6 38.0 75-79 36.57935 38.0 38.0 38.0 34.8 38.0 80-84 36.324 38.0 38.0 38.0 34.2 38.0 85-89 36.053349999999995 38.0 38.0 38.0 33.0 38.0 90-94 36.4966 38.0 38.0 38.0 34.4 38.0 95-99 36.593199999999996 38.0 38.0 38.0 34.8 38.0 100-104 36.61045 38.0 38.0 38.0 35.0 38.0 105-109 36.4685 38.0 38.0 38.0 34.4 38.0 110-114 36.349 38.0 38.0 38.0 34.0 38.0 115-119 34.134499999999996 37.8 33.2 38.0 25.8 38.0 120-124 32.6803 37.0 29.6 38.0 20.2 38.0 125-129 34.645050000000005 38.0 34.4 38.0 26.0 38.0 130-134 33.32735 37.6 31.8 38.0 20.2 38.0 135-139 29.773900000000005 33.4 23.4 38.0 16.2 38.0 140-144 34.333000000000006 38.0 34.6 38.0 26.8 38.0 145-149 33.36825 38.0 33.8 38.0 20.4 38.0 150-151 27.319000000000003 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 3.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 3.0 15 1.0 16 4.0 17 4.0 18 2.0 19 5.0 20 4.0 21 9.0 22 9.0 23 4.0 24 14.0 25 18.0 26 20.0 27 27.0 28 28.0 29 32.0 30 50.0 31 58.0 32 95.0 33 125.0 34 235.0 35 393.0 36 1061.0 37 1782.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.775 17.1 11.95 33.175 2 30.3 22.425 26.85 20.424999999999997 3 24.05 24.45 28.075 23.425 4 26.8 29.775000000000002 20.225 23.200000000000003 5 27.900000000000002 31.674999999999997 18.35 22.075 6 23.5 35.6 21.075 19.825 7 22.925 19.25 34.125 23.7 8 24.75 22.975 22.85 29.425 9 23.9 21.775 28.499999999999996 25.825 10-14 26.200000000000003 25.369999999999997 23.425 25.005 15-19 25.745 25.035 24.38 24.84 20-24 25.835 25.41 23.87 24.884999999999998 25-29 26.474999999999998 25.014999999999997 23.575 24.935 30-34 25.89 25.745 23.895 24.47 35-39 25.71 25.545 23.94 24.805 40-44 26.66 24.959999999999997 23.655 24.725 45-49 25.595000000000002 25.615 24.325 24.465 50-54 26.200000000000003 25.480000000000004 23.87 24.45 55-59 26.340000000000003 25.36 23.669999999999998 24.63 60-64 26.169999999999998 25.14 24.15 24.54 65-69 25.655 24.975 24.605 24.765 70-74 26.0 24.779999999999998 24.43 24.79 75-79 26.27 24.805 24.435000000000002 24.490000000000002 80-84 25.735000000000003 25.465 24.245 24.555 85-89 26.71 24.77 23.925 24.595 90-94 26.040000000000003 25.785000000000004 23.830000000000002 24.345 95-99 25.8 25.75 24.68 23.77 100-104 25.759999999999998 25.14 24.63 24.47 105-109 26.05 25.465 24.224999999999998 24.26 110-114 26.169999999999998 25.88 23.655 24.295 115-119 26.155 25.669999999999998 23.91 24.265 120-124 26.255 25.64 24.59 23.515 125-129 26.355 25.83 23.835 23.98 130-134 26.855 25.430000000000003 23.630000000000003 24.085 135-139 26.665 24.985 24.610000000000003 23.74 140-144 26.985 26.0 24.2 22.814999999999998 145-149 27.0 25.130000000000003 23.86 24.01 150-151 27.500000000000004 25.7125 23.4875 23.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 2.0 26 1.5 27 1.0 28 3.5 29 7.5 30 6.5 31 4.5 32 7.5 33 9.0 34 13.5 35 24.5 36 30.0 37 45.0 38 74.5 39 91.0 40 103.0 41 131.0 42 153.5 43 167.0 44 190.5 45 197.5 46 188.0 47 175.0 48 177.0 49 181.5 50 163.0 51 145.5 52 131.0 53 119.0 54 112.0 55 99.5 56 92.0 57 93.0 58 94.0 59 103.0 60 101.0 61 88.5 62 78.0 63 80.5 64 82.0 65 65.0 66 53.0 67 50.5 68 49.5 69 50.0 70 45.0 71 32.0 72 20.5 73 18.0 74 16.0 75 10.5 76 6.5 77 4.5 78 3.0 79 2.0 80 1.5 81 1.0 82 1.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34056676027572 96.3 2 1.4296655603778403 2.8000000000000003 3 0.10211896859841717 0.3 4 0.07658922644881287 0.3 5 0.025529742149604292 0.125 6 0.0 0.0 7 0.025529742149604292 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 7 0.17500000000000002 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0499999999999998 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.45 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 2.0375 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.575 0.0 0.0 0.0 0.0 126-127 2.9000000000000004 0.0 0.0 0.0 0.0 128-129 3.1375 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.8875 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.8 0.0 0.0 0.0 0.0 138-139 5.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTTAT 10 0.006830828 145.0 9 TTCCTCA 10 0.006830828 145.0 9 AAGGTTT 10 0.006830828 145.0 3 >>END_MODULE Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038126 spots for SRR6958277.sra Written 1038126 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra Read 1038107 spots for SRR6958277.sra Written 1038107 spots for SRR6958277.sra SRR ids: ['SRR6958277.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6_og0ol0 SRR6958277.sra spots: 20762159 blocks: [[1, 1038107], [1038108, 2076214], [2076215, 3114321], [3114322, 4152428], [4152429, 5190535], [5190536, 6228642], [6228643, 7266749], [7266750, 8304856], [8304857, 9342963], [9342964, 10381070], [10381071, 11419177], [11419178, 12457284], [12457285, 13495391], [13495392, 14533498], [14533499, 15571605], [15571606, 16609712], [16609713, 17647819], [17647820, 18685926], [18685927, 19724033], [19724034, 20762159]] SRR6958277 file size 7013914 SRR6958277 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958277 SRR6958277_1.fastq SRR6958277_2.fastq Input file: SRR6958277_1.fastq Paired file: SRR6958277_2.fastq trimmed: SRR6958277-trimmed-pair1.fastq, SRR6958277-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:31:12 2024 >> started Fri Dec 6 18:31:31 2024 >> done (19.783s) 20762159 read pairs processed; of these: 15592 ( 0.08%) short read pairs filtered out after trimming by size control 12274 ( 0.06%) empty read pairs filtered out after trimming by size control 20734293 (99.87%) read pairs available; of these: 7736219 (37.31%) trimmed read pairs available after processing 12998074 (62.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 3 0.00% 21 0 0.00% 22 6 0.00% 23 6 0.00% 24 4 0.00% 25 5 0.00% 26 8 0.00% 27 5 0.00% 28 3 0.00% 29 5 0.00% 30 13 0.00% 31 5 0.00% 32 11 0.00% 33 7 0.00% 34 5 0.00% 35 14 0.00% 36 6 0.00% 37 11 0.00% 38 6 0.00% 39 14 0.00% 40 14 0.00% 41 8 0.00% 42 8 0.00% 43 18 0.00% 44 22 0.00% 45 10 0.00% 46 15 0.00% 47 13 0.00% 48 26 0.00% 49 23 0.00% 50 29 0.00% 51 48 0.00% 52 34 0.00% 53 44 0.00% 54 41 0.00% 55 43 0.00% 56 63 0.00% 57 61 0.00% 58 93 0.00% 59 80 0.00% 60 102 0.00% 61 138 0.00% 62 134 0.00% 63 145 0.00% 64 182 0.00% 65 206 0.00% 66 199 0.00% 67 270 0.00% 68 277 0.00% 69 333 0.00% 70 413 0.00% 71 437 0.00% 72 499 0.00% 73 572 0.00% 74 714 0.00% 75 722 0.00% 76 879 0.00% 77 961 0.00% 78 1140 0.01% 79 1331 0.01% 80 1443 0.01% 81 1632 0.01% 82 1984 0.01% 83 2253 0.01% 84 3122 0.02% 85 3824 0.02% 86 4039 0.02% 87 4549 0.02% 88 4898 0.02% 89 5226 0.03% 90 5431 0.03% 91 5835 0.03% 92 6628 0.03% 93 7098 0.03% 94 7654 0.04% 95 8343 0.04% 96 8870 0.04% 97 9718 0.05% 98 10265 0.05% 99 11075 0.05% 100 11886 0.06% 101 12540 0.06% 102 13563 0.07% 103 14703 0.07% 104 15803 0.08% 105 16934 0.08% 106 18152 0.09% 107 19071 0.09% 108 19769 0.10% 109 21289 0.10% 110 22219 0.11% 111 23525 0.11% 112 24947 0.12% 113 26353 0.13% 114 27847 0.13% 115 30110 0.15% 116 30956 0.15% 117 32346 0.16% 118 33381 0.16% 119 34529 0.17% 120 36516 0.18% 121 37403 0.18% 122 39309 0.19% 123 41095 0.20% 124 43436 0.21% 125 45408 0.22% 126 46986 0.23% 127 48865 0.24% 128 50241 0.24% 129 52472 0.25% 130 54138 0.26% 131 55901 0.27% 132 58898 0.28% 133 61370 0.30% 134 64169 0.31% 135 67020 0.32% 136 70272 0.34% 137 72498 0.35% 138 76112 0.37% 139 80684 0.39% 140 84882 0.41% 141 90534 0.44% 142 98858 0.48% 143 107943 0.52% 144 120196 0.58% 145 136259 0.66% 146 160056 0.77% 147 205729 0.99% 148 296708 1.43% 149 584528 2.82% 150 4173437 20.13% 151 12998074 62.69% 20734293 reads passed initial QC criterion=sequence-density sequence-density=1.16 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=15 prefix-density=1.21 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=50.02 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.6 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=13 prefix-density=0.81 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=57.87 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.0 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958277 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:32:19 Started mapping on | Dec 06 18:32:19 Finished on | Dec 06 18:33:54 Mapping speed, Million of reads per hour | 785.72 Number of input reads | 20734293 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20245429 Uniquely mapped reads % | 97.64% Average mapped length | 295.75 Number of splices: Total | 23743493 Number of splices: Annotated (sjdb) | 22404713 Number of splices: GT/AG | 23431525 Number of splices: GC/AG | 277321 Number of splices: AT/AC | 8512 Number of splices: Non-canonical | 26135 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.44 Insertion rate per base | 0.01% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 163945 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 18337 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.96% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 336234 336234 336234 N_multimapping 163945 163945 163945 N_noFeature 538166 19688901 690061 N_ambiguous 484248 2466 81265 UnstrandedReadsAssigned:19223015 PositiveStrandReadsAssigned:554062 NegativeStrandReadsAssigned:19474103 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958277 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958277-trimmed-pair1.fastq SRR6958277-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,734,293 reads, 19,476,044 reads pseudoaligned [quant] estimated average fragment length: 253.682 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,319 rounds 52973 SRR6958277.ke.tsv 35125 SRR6958277.se.tsv 88098 total ==> SRR6958277.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.904 6.18462 0.6789 PNS24247 1044 791.318 47.7542 4.53053 PNS24249 1928 1675.32 57.4594 2.57485 PNS24246 1044 791.318 47.7542 4.53053 PNS24248 1044 791.318 47.7542 4.53053 PNS24244 1471 1218.32 8.09326 0.498713 PNS24243 293 92.5079 0 0 KQK14069 1603 1350.32 6452.53 358.742 KQK14071 474 236.706 65.2199 20.6852 ==> SRR6958277.se.tsv <== BRADI_1g14170v3 7097 BRADI_1g53295v3 152 BRADI_1g59795v3 169 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 176 BRADI_1g74790v3 105 BRADI_1g09890v3 0 BRADI_1g77505v3 203 BRADI_1g48960v3 0 SRR6958277 completed mapping pipeline successfully