Starting /dee2/code/volunteer_pipeline.sh SRR6958278 current disk space = 1550086221824 free memory = 1591890660 SRR6958278 SRAfilesize 576d27fa3af45e428cd95c0d10a5e32b SRR6958278.sra SRR6958278.sra file validated SRR6958278 is paired end SRR6958278 is conventional basespace SRR6958278 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958278_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05425 34.0 33.0 34.0 32.0 34.0 2 32.81375 33.0 33.0 34.0 31.0 34.0 3 32.83675 33.0 33.0 34.0 31.0 34.0 4 32.8415 33.0 33.0 34.0 31.0 34.0 5 32.91525 33.0 33.0 34.0 32.0 34.0 6 35.55425 37.0 35.0 38.0 31.0 38.0 7 37.01475 38.0 37.0 38.0 35.0 38.0 8 36.906 38.0 38.0 38.0 35.0 38.0 9 37.30325 38.0 38.0 38.0 36.0 38.0 10-14 37.43805 38.0 38.0 38.0 37.0 38.0 15-19 37.495050000000006 38.0 38.0 38.0 37.2 38.0 20-24 37.5167 38.0 38.0 38.0 37.6 38.0 25-29 37.51270000000001 38.0 38.0 38.0 37.6 38.0 30-34 37.484649999999995 38.0 38.0 38.0 37.6 38.0 35-39 37.4059 38.0 38.0 38.0 37.0 38.0 40-44 37.4251 38.0 38.0 38.0 37.0 38.0 45-49 37.40820000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.38285 38.0 38.0 38.0 37.0 38.0 55-59 37.16475 38.0 38.0 38.0 36.8 38.0 60-64 36.8652 38.0 38.0 38.0 36.0 38.0 65-69 37.21445 38.0 38.0 38.0 36.4 38.0 70-74 37.202999999999996 38.0 38.0 38.0 36.0 38.0 75-79 37.13565 38.0 38.0 38.0 36.0 38.0 80-84 37.05345 38.0 38.0 38.0 36.0 38.0 85-89 36.9109 38.0 38.0 38.0 35.0 38.0 90-94 36.7648 38.0 38.0 38.0 34.6 38.0 95-99 36.7605 38.0 38.0 38.0 34.8 38.0 100-104 36.5797 38.0 38.0 38.0 34.0 38.0 105-109 36.494299999999996 38.0 38.0 38.0 33.8 38.0 110-114 36.30355 38.0 37.8 38.0 33.8 38.0 115-119 35.99745 38.0 37.0 38.0 32.2 38.0 120-124 35.85395 38.0 36.8 38.0 31.2 38.0 125-129 35.52675000000001 38.0 36.0 38.0 30.2 38.0 130-134 35.13455 38.0 36.0 38.0 28.8 38.0 135-139 34.623400000000004 38.0 35.2 38.0 27.4 38.0 140-144 34.43815 38.0 35.0 38.0 27.0 38.0 145-149 33.51055 38.0 33.0 38.0 22.0 38.0 150-151 27.851625 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 1.0 16 0.0 17 2.0 18 2.0 19 2.0 20 4.0 21 3.0 22 6.0 23 7.0 24 8.0 25 15.0 26 10.0 27 18.0 28 25.0 29 31.0 30 29.0 31 43.0 32 76.0 33 101.0 34 177.0 35 290.0 36 744.0 37 2403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.15 9.225 8.0 35.625 2 23.05 11.35 34.050000000000004 31.55 3 21.025 15.35 25.775 37.85 4 27.375 20.9 22.275 29.45 5 27.925 25.974999999999998 23.549999999999997 22.55 6 25.55 28.999999999999996 24.25 21.2 7 20.325 22.8 36.875 20.0 8 21.325 23.150000000000002 29.175 26.35 9 22.125 22.675 31.900000000000002 23.3 10-14 23.633271645075776 25.6139648877107 25.49892462361827 25.25383884359526 15-19 23.585 24.265 25.979999999999997 26.169999999999998 20-24 23.02 24.705 25.785000000000004 26.490000000000002 25-29 23.25 24.595 26.015 26.14 30-34 24.26 24.529999999999998 25.56 25.650000000000002 35-39 23.724999999999998 23.915 25.845000000000002 26.515 40-44 24.22 24.34 25.4 26.040000000000003 45-49 24.23 24.175 25.295 26.3 50-54 23.419999999999998 24.245 26.255 26.08 55-59 24.02590881703153 24.392448282787708 25.33139184575216 26.250251054428603 60-64 23.949115044247787 24.336283185840706 25.045253419147222 26.66934835076428 65-69 24.27 24.495 25.46 25.775 70-74 24.43 24.915000000000003 24.81 25.845000000000002 75-79 23.685000000000002 24.34 25.509999999999998 26.465 80-84 24.154999999999998 24.41 25.080000000000002 26.355 85-89 24.175 23.97 25.105 26.75 90-94 24.595 24.66 24.779999999999998 25.965 95-99 24.215 24.12 25.564999999999998 26.1 100-104 24.65 24.16 24.815 26.375 105-109 24.64 23.71 25.145 26.505000000000003 110-114 25.259999999999998 23.65 24.975 26.115 115-119 24.565 24.37 24.93 26.135 120-124 24.725 24.265 24.525 26.484999999999996 125-129 24.45 24.15 24.89 26.51 130-134 24.39 24.035 24.945 26.63 135-139 24.48 24.325 25.119999999999997 26.075 140-144 24.42 24.32 24.82 26.44 145-149 24.65 23.94 25.305 26.105 150-151 25.0125 23.6625 24.5375 26.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 3.0 29 5.5 30 4.5 31 5.5 32 7.5 33 12.0 34 20.5 35 23.5 36 34.5 37 47.5 38 56.5 39 77.0 40 105.5 41 137.5 42 172.0 43 196.5 44 197.5 45 200.5 46 199.5 47 191.0 48 196.5 49 182.0 50 155.0 51 143.5 52 135.0 53 122.0 54 114.5 55 105.0 56 95.5 57 91.0 58 87.5 59 87.5 60 86.5 61 80.5 62 67.5 63 60.5 64 65.0 65 62.5 66 60.0 67 58.0 68 44.0 69 38.5 70 34.5 71 29.0 72 26.0 73 22.0 74 19.0 75 11.0 76 7.5 77 6.5 78 2.0 79 1.5 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.034999999999999996 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.42 60-64 0.5599999999999999 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.23750000000000002 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.9624999999999999 0.0 0.0 0.0 0.0 120-121 1.1375 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.7625 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 2.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAGCG 10 0.006830828 145.0 3 ATGATTA 10 0.006830828 145.0 9 GGCGGAG 30 0.0017973486 72.5 1 AAAAAAA 20 0.00593511 29.0 60-64 >>END_MODULE SRR6958278 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958278_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97225 33.0 33.0 34.0 32.0 34.0 2 33.07125 34.0 33.0 34.0 32.0 34.0 3 33.059 34.0 33.0 34.0 32.0 34.0 4 33.06525 34.0 33.0 34.0 33.0 34.0 5 33.1345 34.0 33.0 34.0 33.0 34.0 6 37.27775 38.0 38.0 38.0 37.0 38.0 7 37.29325 38.0 38.0 38.0 37.0 38.0 8 37.2955 38.0 38.0 38.0 37.0 38.0 9 37.255 38.0 38.0 38.0 37.0 38.0 10-14 37.2853 38.0 38.0 38.0 37.0 38.0 15-19 37.282799999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.193400000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.164849999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.123450000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.16055 38.0 38.0 38.0 37.0 38.0 40-44 37.16335 38.0 38.0 38.0 37.0 38.0 45-49 37.11855 38.0 38.0 38.0 37.0 38.0 50-54 37.068599999999996 38.0 38.0 38.0 36.4 38.0 55-59 37.00135 38.0 38.0 38.0 36.2 38.0 60-64 36.9816 38.0 38.0 38.0 36.0 38.0 65-69 36.8701 38.0 38.0 38.0 35.8 38.0 70-74 36.98795 38.0 38.0 38.0 36.0 38.0 75-79 36.831100000000006 38.0 38.0 38.0 35.6 38.0 80-84 36.86945 38.0 38.0 38.0 35.4 38.0 85-89 36.775850000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.5757 38.0 38.0 38.0 34.4 38.0 95-99 36.533 38.0 38.0 38.0 34.2 38.0 100-104 36.41550000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.32209999999999 38.0 38.0 38.0 34.0 38.0 110-114 35.99735 38.0 38.0 38.0 33.4 38.0 115-119 35.9323 38.0 38.0 38.0 33.2 38.0 120-124 35.947050000000004 38.0 37.8 38.0 33.0 38.0 125-129 35.81615000000001 38.0 37.2 38.0 32.6 38.0 130-134 35.654250000000005 38.0 36.6 38.0 32.2 38.0 135-139 35.53165 38.0 36.2 38.0 31.8 38.0 140-144 35.0162 38.0 36.0 38.0 30.4 38.0 145-149 34.40635 38.0 35.4 38.0 28.0 38.0 150-151 30.438000000000002 35.5 28.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 0.0 5 0.0 6 2.0 7 5.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 3.0 16 4.0 17 2.0 18 3.0 19 4.0 20 4.0 21 4.0 22 12.0 23 2.0 24 10.0 25 15.0 26 14.0 27 16.0 28 23.0 29 38.0 30 27.0 31 46.0 32 67.0 33 82.0 34 138.0 35 190.0 36 514.0 37 2762.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.2 18.675 10.7 30.425 2 27.848735286751815 23.240671174555473 25.870272977710997 23.040320560981716 3 22.55883825738608 26.86529794692038 26.164246369554334 24.41161742613921 4 27.655310621242485 29.158316633266534 19.664328657314627 23.52204408817635 5 26.619964973730298 32.549412059044286 19.514635976982735 21.31598699024268 6 24.0180135101326 33.950462847135356 20.340255191393545 21.691268451338505 7 23.779724655819777 19.499374217772214 32.515644555694614 24.20525657071339 8 23.57947434292866 24.005006257822277 23.2540675844806 29.161451814768462 9 23.67959949937422 23.128911138923655 26.9837296620776 26.207759699624532 10-14 26.325274065174952 25.599439355258546 22.490864494168296 25.584422085398206 15-19 25.814850047564214 25.429329594953188 23.732038251639715 25.02378210584289 20-24 25.410657051282055 25.315504807692307 23.6328125 25.64102564102564 25-29 26.056690705128204 24.934895833333336 23.973357371794872 25.03505608974359 30-34 26.418590674613114 24.51044222967897 23.72915310261932 25.341813993088596 35-39 25.932042235900514 24.896161737476856 23.865285492668768 25.306510533953862 40-44 26.410654383417615 24.723376558353777 23.762078806388626 25.10389025183998 45-49 25.619090499774877 24.808644754615038 23.878132973135223 25.69413177247486 50-54 26.187856356907073 25.14754426327898 23.687106131839553 24.97749324797439 55-59 25.953167217051938 25.0775542880016 23.26128289802862 25.707995596917844 60-64 26.382425061302108 24.926187259170295 23.47995796426963 25.21142971525797 65-69 26.46749737276685 24.896161737476856 24.110493919831857 24.525846969924437 70-74 26.371096877502005 24.819855884707767 24.09927942353883 24.7097678142514 75-79 26.170329945426325 24.34286286486757 24.48305212036249 25.003755069343615 80-84 26.957130708818966 25.246360862388073 23.075383922765244 24.72112450602771 85-89 26.26525305061012 24.484896979395877 24.35487097419484 24.89497899579916 90-94 26.473236618309155 25.087543771885944 23.666833416708354 24.772386193096548 95-99 26.668668067647356 24.83238266786751 23.636545581907335 24.862403682577806 100-104 26.193096548274138 25.25262631315658 23.47173586793397 25.082541270635318 105-109 26.500900540324196 24.44966980188113 24.069441664999 24.979987992795678 110-114 26.504577517634697 25.008754815148333 23.978188003401872 24.5084796638151 115-119 26.89555077323457 24.66343025874581 23.41224162954807 25.028777338471546 120-124 26.473236618309155 25.767883941970986 23.56178089044522 24.19709854927464 125-129 26.41688759941974 25.77659946976139 23.27047171227052 24.536041218548345 130-134 26.98674668667167 25.171292823205803 23.68592148037009 24.15603900975244 135-139 26.61830915457729 25.137568784392194 24.087043521760883 24.157078539269637 140-144 26.518259129564782 25.49774887443722 23.85192596298149 24.132066033016507 145-149 26.97483615988794 25.43398869378158 23.567962379308618 24.02321276702186 150-151 27.186288002001753 26.060302764919303 22.582259477042413 24.17114975603653 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 1.0 26 2.0 27 1.5 28 2.5 29 3.5 30 3.0 31 4.0 32 3.5 33 4.0 34 9.5 35 20.5 36 29.0 37 37.0 38 53.5 39 84.5 40 117.5 41 138.0 42 153.5 43 174.0 44 174.0 45 171.5 46 174.5 47 163.0 48 170.5 49 175.5 50 171.0 51 165.0 52 139.5 53 108.0 54 97.5 55 102.5 56 111.0 57 108.0 58 104.5 59 97.5 60 86.0 61 88.5 62 85.5 63 76.5 64 77.5 65 76.5 66 66.0 67 61.0 68 55.5 69 53.0 70 46.5 71 36.5 72 32.5 73 28.0 74 18.5 75 12.5 76 9.5 77 2.5 78 0.5 79 2.5 80 2.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.15 4 0.2 5 0.075 6 0.075 7 0.125 8 0.125 9 0.125 10-14 0.11499999999999999 15-19 0.135 20-24 0.16 25-29 0.16 30-34 0.165 35-39 0.08499999999999999 40-44 0.135 45-49 0.055 50-54 0.03 55-59 0.06999999999999999 60-64 0.08499999999999999 65-69 0.08499999999999999 70-74 0.08 75-79 0.135 80-84 0.045 85-89 0.02 90-94 0.05 95-99 0.06999999999999999 100-104 0.05 105-109 0.06 110-114 0.055 115-119 0.095 120-124 0.05 125-129 0.045 130-134 0.025 135-139 0.05 140-144 0.05 145-149 0.055 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78017789072427 97.175 2 0.8894536213468869 1.7500000000000002 3 0.25412960609911056 0.75 4 0.05082592121982211 0.2 5 0.025412960609911054 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.23750000000000002 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.9875 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.8125 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.5999999999999996 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138-139 3.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACGGTG 10 0.006932181 144.28749 145 CTCAAGG 10 0.006932181 144.28749 7 >>END_MODULE Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra Read 1263234 spots for SRR6958278.sra Written 1263234 spots for SRR6958278.sra SRR ids: ['SRR6958278.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x1jsgrlf SRR6958278.sra spots: 25264680 blocks: [[1, 1263234], [1263235, 2526468], [2526469, 3789702], [3789703, 5052936], [5052937, 6316170], [6316171, 7579404], [7579405, 8842638], [8842639, 10105872], [10105873, 11369106], [11369107, 12632340], [12632341, 13895574], [13895575, 15158808], [15158809, 16422042], [16422043, 17685276], [17685277, 18948510], [18948511, 20211744], [20211745, 21474978], [21474979, 22738212], [22738213, 24001446], [24001447, 25264680]] SRR6958278 file size 8539670 SRR6958278 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958278 SRR6958278_1.fastq SRR6958278_2.fastq Input file: SRR6958278_1.fastq Paired file: SRR6958278_2.fastq trimmed: SRR6958278-trimmed-pair1.fastq, SRR6958278-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:31:31 2024 >> started Fri Dec 6 18:31:59 2024 >> done (28.156s) 25264680 read pairs processed; of these: 33540 ( 0.13%) short read pairs filtered out after trimming by size control 58541 ( 0.23%) empty read pairs filtered out after trimming by size control 25172599 (99.64%) read pairs available; of these: 10496085 (41.70%) trimmed read pairs available after processing 14676514 (58.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 8 0.00% 23 7 0.00% 24 9 0.00% 25 5 0.00% 26 8 0.00% 27 10 0.00% 28 5 0.00% 29 8 0.00% 30 9 0.00% 31 8 0.00% 32 7 0.00% 33 10 0.00% 34 8 0.00% 35 6 0.00% 36 10 0.00% 37 3 0.00% 38 14 0.00% 39 14 0.00% 40 16 0.00% 41 13 0.00% 42 19 0.00% 43 11 0.00% 44 15 0.00% 45 19 0.00% 46 21 0.00% 47 30 0.00% 48 26 0.00% 49 38 0.00% 50 39 0.00% 51 27 0.00% 52 45 0.00% 53 47 0.00% 54 49 0.00% 55 55 0.00% 56 61 0.00% 57 71 0.00% 58 66 0.00% 59 84 0.00% 60 92 0.00% 61 118 0.00% 62 130 0.00% 63 163 0.00% 64 146 0.00% 65 198 0.00% 66 174 0.00% 67 222 0.00% 68 256 0.00% 69 282 0.00% 70 315 0.00% 71 330 0.00% 72 380 0.00% 73 430 0.00% 74 480 0.00% 75 533 0.00% 76 634 0.00% 77 658 0.00% 78 728 0.00% 79 836 0.00% 80 963 0.00% 81 1040 0.00% 82 1201 0.00% 83 1513 0.01% 84 2535 0.01% 85 3173 0.01% 86 3312 0.01% 87 3536 0.01% 88 3777 0.02% 89 3998 0.02% 90 4158 0.02% 91 4360 0.02% 92 4555 0.02% 93 4935 0.02% 94 5234 0.02% 95 5745 0.02% 96 6115 0.02% 97 6519 0.03% 98 7109 0.03% 99 7424 0.03% 100 7888 0.03% 101 8683 0.03% 102 9303 0.04% 103 10024 0.04% 104 10569 0.04% 105 11395 0.05% 106 12281 0.05% 107 12966 0.05% 108 13644 0.05% 109 14669 0.06% 110 15538 0.06% 111 16650 0.07% 112 17803 0.07% 113 18822 0.07% 114 20174 0.08% 115 21540 0.09% 116 22821 0.09% 117 23849 0.09% 118 25303 0.10% 119 26212 0.10% 120 27600 0.11% 121 28904 0.11% 122 30212 0.12% 123 32278 0.13% 124 34556 0.14% 125 36251 0.14% 126 38251 0.15% 127 40484 0.16% 128 41831 0.17% 129 44171 0.18% 130 45950 0.18% 131 48491 0.19% 132 51342 0.20% 133 54861 0.22% 134 58203 0.23% 135 61962 0.25% 136 65163 0.26% 137 69446 0.28% 138 73200 0.29% 139 79426 0.32% 140 85286 0.34% 141 92914 0.37% 142 102643 0.41% 143 115125 0.46% 144 133425 0.53% 145 159175 0.63% 146 197928 0.79% 147 273885 1.09% 148 432803 1.72% 149 938170 3.73% 150 6592792 26.19% 151 14676514 58.30% 25172599 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=19 prefix-density=0.89 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=34.85 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.16 fanout-score-rank=24 prefix-density=0.62 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.15 sequence-density-rank=19 fanout-score=62.43 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=12.1 sequence=GCCGCCGCCGCC SRR6958278 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:32:41 Started mapping on | Dec 06 18:32:41 Finished on | Dec 06 18:34:27 Mapping speed, Million of reads per hour | 854.92 Number of input reads | 25172599 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 24553625 Uniquely mapped reads % | 97.54% Average mapped length | 297.53 Number of splices: Total | 28343529 Number of splices: Annotated (sjdb) | 26643039 Number of splices: GT/AG | 27976795 Number of splices: GC/AG | 335403 Number of splices: AT/AC | 10982 Number of splices: Non-canonical | 20349 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 146633 % of reads mapped to multiple loci | 0.58% Number of reads mapped to too many loci | 10268 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.57% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 488480 488480 488480 N_multimapping 146633 146633 146633 N_noFeature 660239 23904863 831078 N_ambiguous 571438 3310 94728 UnstrandedReadsAssigned:23321948 PositiveStrandReadsAssigned:645452 NegativeStrandReadsAssigned:23627819 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958278 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958278-trimmed-pair1.fastq SRR6958278-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,172,599 reads, 23,644,883 reads pseudoaligned [quant] estimated average fragment length: 269.771 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52973 SRR6958278.ke.tsv 35125 SRR6958278.se.tsv 88098 total ==> SRR6958278.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.914 0 0 PNS24247 1044 775.229 74.9241 5.97105 PNS24249 1928 1659.23 44.3499 1.65137 PNS24246 1044 775.229 74.9241 5.97105 PNS24248 1044 775.229 74.9241 5.97105 PNS24244 1471 1202.23 17.8778 0.918726 PNS24243 293 81.4704 0 0 KQK14069 1603 1334.23 3994.36 184.959 KQK14071 474 221.391 73.6429 20.5509 ==> SRR6958278.se.tsv <== BRADI_1g14170v3 4474 BRADI_1g53295v3 284 BRADI_1g59795v3 230 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 364 BRADI_1g74790v3 148 BRADI_1g09890v3 0 BRADI_1g77505v3 322 BRADI_1g48960v3 0 SRR6958278 completed mapping pipeline successfully