Starting /dee2/code/volunteer_pipeline.sh SRR6958279 current disk space = 1550120632320 free memory = 1599471232 SRR6958279 SRAfilesize 446c5896b1006ff599e63ad26174dd24 SRR6958279.sra SRR6958279.sra file validated SRR6958279 is paired end SRR6958279 is conventional basespace SRR6958279 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958279_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.68775 18.0 18.0 18.0 18.0 32.0 2 20.87225 18.0 18.0 25.0 18.0 29.0 3 25.00625 27.0 18.0 29.0 18.0 31.0 4 28.66075 29.0 27.0 31.0 25.0 33.0 5 31.25425 33.0 31.0 33.0 29.0 33.0 6 35.13375 37.0 34.0 38.0 31.0 38.0 7 36.73975 38.0 37.0 38.0 34.0 38.0 8 37.08 38.0 38.0 38.0 35.0 38.0 9 37.248 38.0 38.0 38.0 36.0 38.0 10-14 37.3078 38.0 38.0 38.0 36.8 38.0 15-19 37.4861 38.0 38.0 38.0 37.6 38.0 20-24 37.56165 38.0 38.0 38.0 38.0 38.0 25-29 37.36749999999999 38.0 38.0 38.0 37.2 38.0 30-34 37.44995 38.0 38.0 38.0 37.2 38.0 35-39 37.14645 38.0 38.0 38.0 36.4 38.0 40-44 37.5181 38.0 38.0 38.0 38.0 38.0 45-49 37.44665 38.0 38.0 38.0 37.2 38.0 50-54 37.30605 38.0 38.0 38.0 36.8 38.0 55-59 37.2298 38.0 38.0 38.0 36.8 38.0 60-64 37.310649999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.3289 38.0 38.0 38.0 37.0 38.0 70-74 37.2656 38.0 38.0 38.0 37.0 38.0 75-79 37.2243 38.0 38.0 38.0 36.4 38.0 80-84 37.09935 38.0 38.0 38.0 36.0 38.0 85-89 36.73315 38.0 38.0 38.0 34.8 38.0 90-94 36.1686 38.0 37.6 38.0 32.2 38.0 95-99 34.87570000000001 38.0 35.4 38.0 25.8 38.0 100-104 36.0595 38.0 37.0 38.0 32.6 38.0 105-109 35.99875 38.0 37.0 38.0 32.2 38.0 110-114 35.61755 38.0 36.6 38.0 31.0 38.0 115-119 35.5674 38.0 36.2 38.0 31.0 38.0 120-124 35.451350000000005 38.0 36.0 38.0 29.8 38.0 125-129 35.3447 38.0 36.0 38.0 29.4 38.0 130-134 34.9577 38.0 35.8 38.0 27.8 38.0 135-139 34.328950000000006 38.0 34.2 38.0 26.2 38.0 140-144 32.5809 37.2 31.4 38.0 18.2 38.0 145-149 32.2158 38.0 32.0 38.0 10.8 38.0 150-151 26.198875 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 2.0 20 1.0 21 3.0 22 6.0 23 4.0 24 9.0 25 14.0 26 25.0 27 29.0 28 30.0 29 42.0 30 69.0 31 79.0 32 104.0 33 166.0 34 199.0 35 454.0 36 1207.0 37 1552.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.953365129835717 24.138844727080023 6.968733439321674 44.93905670376259 2 19.025 18.05 23.75 39.175 3 21.95 15.575 22.900000000000002 39.574999999999996 4 25.924999999999997 21.5 22.55 30.025000000000002 5 27.0 26.125 22.875 24.0 6 23.75 30.175 24.224999999999998 21.85 7 17.974999999999998 23.95 38.9 19.175 8 20.875 24.075 28.4 26.650000000000002 9 19.0 21.275 33.675 26.05 10-14 22.15 26.665 26.05 25.135 15-19 22.675 25.564999999999998 26.66 25.1 20-24 22.525000000000002 25.130000000000003 25.935000000000002 26.41 25-29 22.32 25.3 26.619999999999997 25.759999999999998 30-34 22.935 25.650000000000002 25.924999999999997 25.490000000000002 35-39 22.285 25.35 26.915 25.45 40-44 22.48 24.995 25.825 26.700000000000003 45-49 22.395 25.119999999999997 26.284999999999997 26.200000000000003 50-54 22.79 25.21 25.855 26.145000000000003 55-59 22.465 25.319999999999997 26.150000000000002 26.064999999999998 60-64 22.86 25.124999999999996 26.479999999999997 25.535000000000004 65-69 22.89 24.695 26.115 26.3 70-74 22.935 25.525 25.835 25.705 75-79 23.0 25.345000000000002 26.115 25.540000000000003 80-84 22.7 25.025 26.525 25.75 85-89 22.825 25.09 26.340000000000003 25.745 90-94 23.73 24.404999999999998 26.155 25.71 95-99 23.035 25.0 26.090000000000003 25.874999999999996 100-104 23.005 24.975 25.674999999999997 26.345000000000002 105-109 23.380000000000003 25.145 25.69 25.785000000000004 110-114 23.035 25.195 25.96 25.81 115-119 23.035 25.31 25.66 25.995 120-124 23.505000000000003 24.95 26.005 25.540000000000003 125-129 22.905 25.535000000000004 25.4 26.16 130-134 23.36 25.240000000000002 26.169999999999998 25.230000000000004 135-139 23.51 25.014999999999997 25.85 25.624999999999996 140-144 23.53 24.834999999999997 25.979999999999997 25.655 145-149 23.255 24.865000000000002 26.27 25.61 150-151 23.8375 24.887500000000003 25.0 26.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.0 25 0.0 26 0.0 27 0.0 28 1.5 29 3.5 30 8.5 31 10.5 32 11.0 33 18.5 34 24.0 35 26.5 36 37.5 37 54.5 38 73.5 39 101.5 40 134.5 41 149.0 42 165.0 43 187.0 44 202.5 45 223.0 46 215.0 47 202.5 48 199.0 49 192.0 50 196.5 51 171.5 52 145.0 53 129.0 54 114.5 55 110.0 56 111.5 57 102.5 58 82.0 59 75.5 60 66.0 61 66.0 62 62.5 63 48.5 64 43.0 65 42.5 66 39.5 67 34.5 68 29.5 69 20.0 70 15.0 71 14.5 72 11.0 73 7.5 74 6.5 75 5.5 76 2.5 77 1.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.7625000000000002 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.4 0.0 0.0 0.0 0.0 128-129 2.625 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.3 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138-139 4.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGCGCA 10 0.0068396386 144.9375 8 >>END_MODULE SRR6958279 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958279_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91225 33.0 33.0 34.0 32.0 34.0 2 33.11675 34.0 33.0 34.0 32.0 34.0 3 33.08225 34.0 33.0 34.0 32.0 34.0 4 33.0455 34.0 33.0 34.0 32.0 34.0 5 32.93075 34.0 33.0 34.0 32.0 34.0 6 37.203 38.0 38.0 38.0 37.0 38.0 7 37.214 38.0 38.0 38.0 37.0 38.0 8 37.1335 38.0 38.0 38.0 37.0 38.0 9 37.057 38.0 38.0 38.0 36.0 38.0 10-14 36.91115 38.0 38.0 38.0 36.0 38.0 15-19 37.007549999999995 38.0 38.0 38.0 36.2 38.0 20-24 37.0005 38.0 38.0 38.0 36.4 38.0 25-29 37.1316 38.0 38.0 38.0 37.0 38.0 30-34 37.1414 38.0 38.0 38.0 37.0 38.0 35-39 37.20725 38.0 38.0 38.0 37.0 38.0 40-44 35.396300000000004 38.0 36.2 38.0 26.0 38.0 45-49 35.280950000000004 38.0 36.0 38.0 26.2 38.0 50-54 35.6424 38.0 36.4 38.0 28.4 38.0 55-59 35.869099999999996 38.0 37.0 38.0 30.0 38.0 60-64 36.620799999999996 38.0 37.8 38.0 34.6 38.0 65-69 35.8846 38.0 37.2 38.0 29.6 38.0 70-74 35.9363 38.0 37.2 38.0 31.8 38.0 75-79 36.313050000000004 38.0 38.0 38.0 33.6 38.0 80-84 36.27714999999999 38.0 38.0 38.0 34.0 38.0 85-89 36.093199999999996 38.0 38.0 38.0 33.2 38.0 90-94 35.87185 38.0 37.4 38.0 32.2 38.0 95-99 36.070949999999996 38.0 37.8 38.0 33.0 38.0 100-104 33.86705 37.4 32.4 38.0 25.2 38.0 105-109 35.8336 38.0 37.2 38.0 32.2 38.0 110-114 35.64685000000001 38.0 37.0 38.0 31.0 38.0 115-119 35.087050000000005 38.0 36.0 38.0 28.8 38.0 120-124 31.82595 36.6 27.6 38.0 19.0 38.0 125-129 30.715700000000005 36.2 25.6 38.0 15.0 38.0 130-134 29.758850000000002 35.0 23.4 38.0 12.6 38.0 135-139 32.5418 37.8 32.6 38.0 15.2 38.0 140-144 30.8615 36.8 28.2 38.0 12.4 38.0 145-149 30.3776 36.8 29.6 38.0 4.0 38.0 150-151 23.93825 29.5 16.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 0.0 5 0.0 6 4.0 7 0.0 8 2.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 4.0 15 2.0 16 5.0 17 5.0 18 6.0 19 5.0 20 14.0 21 13.0 22 23.0 23 23.0 24 22.0 25 28.0 26 32.0 27 47.0 28 37.0 29 68.0 30 80.0 31 94.0 32 134.0 33 209.0 34 321.0 35 531.0 36 1198.0 37 1077.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.2 19.2 11.5 30.099999999999998 2 30.599999999999998 24.224999999999998 25.3 19.875 3 22.650000000000002 25.95 27.250000000000004 24.15 4 26.85 30.825000000000003 21.45 20.875 5 28.075 31.574999999999996 18.6 21.75 6 23.549999999999997 34.675 20.275000000000002 21.5 7 22.225 21.175 34.4 22.2 8 24.025 24.55 23.875 27.55 9 23.474999999999998 23.75 26.900000000000002 25.874999999999996 10-14 26.14 26.495 22.84 24.525 15-19 25.885 25.619999999999997 25.03 23.465 20-24 25.06 26.85 24.495 23.595 25-29 25.415 25.88 24.02 24.685000000000002 30-34 25.635 25.924999999999997 25.05 23.39 35-39 25.155 25.835 24.63 24.38 40-44 25.540000000000003 25.97 23.735 24.755 45-49 25.585 25.650000000000002 24.77 23.995 50-54 26.25 25.105 24.97 23.674999999999997 55-59 26.26 26.150000000000002 24.099999999999998 23.49 60-64 25.895000000000003 25.2 24.97 23.935000000000002 65-69 26.13 25.985000000000003 24.45 23.435 70-74 26.729999999999997 25.85 23.985 23.435 75-79 26.02 25.290000000000003 24.88 23.810000000000002 80-84 26.41 26.155 24.52 22.915 85-89 26.090000000000003 25.895000000000003 24.415 23.599999999999998 90-94 26.415 26.340000000000003 24.245 23.0 95-99 25.935000000000002 25.605 25.25 23.21 100-104 26.334999999999997 25.75 24.884999999999998 23.03 105-109 25.814999999999998 25.355 25.34 23.49 110-114 26.19 25.790000000000003 24.67 23.35 115-119 26.845000000000002 26.19 24.240000000000002 22.725 120-124 25.96 26.369999999999997 25.035 22.634999999999998 125-129 25.93629681484074 26.201310065503275 24.73623681184059 23.12615630781539 130-134 27.005000000000003 26.275 24.104999999999997 22.615 135-139 26.575 25.95 24.93 22.545 140-144 26.685 26.419999999999998 24.65 22.245 145-149 26.795 26.255 24.39 22.56 150-151 25.8625 25.55 25.087500000000002 23.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.0 24 0.0 25 1.5 26 3.5 27 2.0 28 0.5 29 2.5 30 5.0 31 5.5 32 9.0 33 12.5 34 16.5 35 29.5 36 37.5 37 47.0 38 64.5 39 86.5 40 123.0 41 156.0 42 171.0 43 168.0 44 172.0 45 196.5 46 200.5 47 200.0 48 204.5 49 192.0 50 168.0 51 154.0 52 141.5 53 128.5 54 125.0 55 117.0 56 117.5 57 108.0 58 94.0 59 87.5 60 80.5 61 72.5 62 62.5 63 59.5 64 55.5 65 52.5 66 52.5 67 42.5 68 31.5 69 30.0 70 29.5 71 23.0 72 17.5 73 12.5 74 8.5 75 7.5 76 5.5 77 2.5 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34475806451613 98.55000000000001 2 0.5796370967741935 1.15 3 0.0 0.0 4 0.07560483870967742 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.7625 0.0 0.0 0.0 0.0 126-127 2.05 0.0 0.0 0.0 0.0 128-129 2.275 0.0 0.0 0.0 0.0 130-131 2.5625 0.0 0.0 0.0 0.0 132-133 2.85 0.0 0.0 0.0 0.0 134-135 3.175 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGGGA 10 0.006830828 145.0 5 >>END_MODULE Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791416 spots for SRR6958279.sra Written 791416 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra Read 791409 spots for SRR6958279.sra Written 791409 spots for SRR6958279.sra SRR ids: ['SRR6958279.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qoc0p1un SRR6958279.sra spots: 15828187 blocks: [[1, 791409], [791410, 1582818], [1582819, 2374227], [2374228, 3165636], [3165637, 3957045], [3957046, 4748454], [4748455, 5539863], [5539864, 6331272], [6331273, 7122681], [7122682, 7914090], [7914091, 8705499], [8705500, 9496908], [9496909, 10288317], [10288318, 11079726], [11079727, 11871135], [11871136, 12662544], [12662545, 13453953], [13453954, 14245362], [14245363, 15036771], [15036772, 15828187]] SRR6958279 file size 5341952 SRR6958279 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958279 SRR6958279_1.fastq SRR6958279_2.fastq Input file: SRR6958279_1.fastq Paired file: SRR6958279_2.fastq trimmed: SRR6958279-trimmed-pair1.fastq, SRR6958279-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:30:07 2024 >> started Fri Dec 6 18:30:25 2024 >> done (17.747s) 15828187 read pairs processed; of these: 14155 ( 0.09%) short read pairs filtered out after trimming by size control 13741 ( 0.09%) empty read pairs filtered out after trimming by size control 15800291 (99.82%) read pairs available; of these: 7007735 (44.35%) trimmed read pairs available after processing 8792556 (55.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 1 0.00% 27 1 0.00% 28 5 0.00% 29 1 0.00% 30 1 0.00% 31 2 0.00% 32 3 0.00% 33 5 0.00% 34 6 0.00% 35 8 0.00% 36 6 0.00% 37 6 0.00% 38 4 0.00% 39 10 0.00% 40 7 0.00% 41 7 0.00% 42 8 0.00% 43 15 0.00% 44 10 0.00% 45 8 0.00% 46 13 0.00% 47 4 0.00% 48 14 0.00% 49 11 0.00% 50 14 0.00% 51 19 0.00% 52 24 0.00% 53 19 0.00% 54 25 0.00% 55 35 0.00% 56 28 0.00% 57 39 0.00% 58 50 0.00% 59 52 0.00% 60 49 0.00% 61 73 0.00% 62 73 0.00% 63 86 0.00% 64 75 0.00% 65 125 0.00% 66 123 0.00% 67 140 0.00% 68 157 0.00% 69 179 0.00% 70 251 0.00% 71 267 0.00% 72 304 0.00% 73 365 0.00% 74 384 0.00% 75 417 0.00% 76 468 0.00% 77 541 0.00% 78 631 0.00% 79 757 0.00% 80 848 0.01% 81 931 0.01% 82 1134 0.01% 83 1337 0.01% 84 1949 0.01% 85 2386 0.02% 86 2583 0.02% 87 2698 0.02% 88 2827 0.02% 89 2966 0.02% 90 3234 0.02% 91 3364 0.02% 92 3736 0.02% 93 4006 0.03% 94 4339 0.03% 95 4771 0.03% 96 5191 0.03% 97 5465 0.03% 98 5839 0.04% 99 6222 0.04% 100 6778 0.04% 101 7152 0.05% 102 7655 0.05% 103 8369 0.05% 104 9040 0.06% 105 9542 0.06% 106 10098 0.06% 107 10523 0.07% 108 11250 0.07% 109 11723 0.07% 110 12510 0.08% 111 13290 0.08% 112 14056 0.09% 113 14584 0.09% 114 15725 0.10% 115 16511 0.10% 116 17900 0.11% 117 18198 0.12% 118 19316 0.12% 119 20273 0.13% 120 21227 0.13% 121 21737 0.14% 122 23315 0.15% 123 24785 0.16% 124 25804 0.16% 125 27220 0.17% 126 28422 0.18% 127 30043 0.19% 128 31541 0.20% 129 32933 0.21% 130 34686 0.22% 131 36616 0.23% 132 38748 0.25% 133 41408 0.26% 134 43527 0.28% 135 45932 0.29% 136 48470 0.31% 137 52002 0.33% 138 54905 0.35% 139 59470 0.38% 140 63799 0.40% 141 69152 0.44% 142 76710 0.49% 143 87185 0.55% 144 100083 0.63% 145 118788 0.75% 146 148933 0.94% 147 204201 1.29% 148 315206 1.99% 149 650069 4.11% 150 4124558 26.10% 151 8792556 55.65% 15800291 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=22 prefix-density=0.74 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=20.76 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.8 sequence=CACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTTG criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=23 prefix-density=0.56 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=364.72 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=16.3 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958279 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:31:19 Started mapping on | Dec 06 18:31:19 Finished on | Dec 06 18:32:33 Mapping speed, Million of reads per hour | 768.66 Number of input reads | 15800291 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15078190 Uniquely mapped reads % | 95.43% Average mapped length | 296.51 Number of splices: Total | 17717377 Number of splices: Annotated (sjdb) | 16697137 Number of splices: GT/AG | 17484216 Number of splices: GC/AG | 207836 Number of splices: AT/AC | 6557 Number of splices: Non-canonical | 18768 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245656 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 46751 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 1.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 485146 485146 485146 N_multimapping 245656 245656 245656 N_noFeature 546093 14666383 667246 N_ambiguous 348516 1955 59021 UnstrandedReadsAssigned:14183581 PositiveStrandReadsAssigned:409852 NegativeStrandReadsAssigned:14351923 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958279 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958279-trimmed-pair1.fastq SRR6958279-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,800,291 reads, 14,412,336 reads pseudoaligned [quant] estimated average fragment length: 264.488 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR6958279.ke.tsv 35125 SRR6958279.se.tsv 88098 total ==> SRR6958279.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 673.034 2.86123 0.446801 PNS24247 1044 780.512 52.238 7.03404 PNS24249 1928 1664.51 48.7186 3.07614 PNS24246 1044 780.512 52.238 7.03404 PNS24248 1044 780.512 52.238 7.03404 PNS24244 1471 1207.51 25.7062 2.23741 PNS24243 293 86.0653 0 0 KQK14069 1603 1339.51 3615.18 283.649 KQK14071 474 227.477 21.068 9.73385 ==> SRR6958279.se.tsv <== BRADI_1g14170v3 3834 BRADI_1g53295v3 171 BRADI_1g59795v3 128 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 154 BRADI_1g74790v3 55 BRADI_1g09890v3 0 BRADI_1g77505v3 141 BRADI_1g48960v3 0 SRR6958279 completed mapping pipeline successfully