Starting /dee2/code/volunteer_pipeline.sh SRR6958280 current disk space = 1550094528512 free memory = 1475484004 SRR6958280 SRAfilesize f8dc87016b2db447756a36d8f15fa41b SRR6958280.sra SRR6958280.sra file validated SRR6958280 is paired end SRR6958280 is conventional basespace SRR6958280 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958280_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.24125 34.0 33.0 34.0 33.0 34.0 2 33.43775 34.0 33.0 34.0 33.0 34.0 3 33.427 34.0 33.0 34.0 33.0 34.0 4 33.3735 34.0 33.0 34.0 33.0 34.0 5 33.26075 34.0 33.0 34.0 33.0 34.0 6 37.0825 38.0 37.0 38.0 36.0 38.0 7 37.36125 38.0 38.0 38.0 36.0 38.0 8 37.58175 38.0 38.0 38.0 37.0 38.0 9 37.644 38.0 38.0 38.0 38.0 38.0 10-14 37.629599999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.5849 38.0 38.0 38.0 38.0 38.0 20-24 37.6263 38.0 38.0 38.0 38.0 38.0 25-29 37.59045 38.0 38.0 38.0 38.0 38.0 30-34 37.52315 38.0 38.0 38.0 38.0 38.0 35-39 37.573899999999995 38.0 38.0 38.0 37.8 38.0 40-44 37.576699999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.52935 38.0 38.0 38.0 38.0 38.0 50-54 37.435249999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.366949999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.14855 38.0 38.0 38.0 36.8 38.0 65-69 37.28869999999999 38.0 38.0 38.0 36.8 38.0 70-74 37.2709 38.0 38.0 38.0 36.4 38.0 75-79 37.12215 38.0 38.0 38.0 36.0 38.0 80-84 37.16155 38.0 38.0 38.0 36.2 38.0 85-89 37.022800000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.97075 38.0 38.0 38.0 35.6 38.0 95-99 36.77355 38.0 38.0 38.0 34.6 38.0 100-104 36.51805 38.0 38.0 38.0 33.2 38.0 105-109 36.34095 38.0 38.0 38.0 33.2 38.0 110-114 36.135000000000005 38.0 38.0 38.0 33.0 38.0 115-119 35.9425 38.0 37.6 38.0 32.2 38.0 120-124 35.7084 38.0 37.0 38.0 31.0 38.0 125-129 35.57125 38.0 36.6 38.0 30.6 38.0 130-134 35.2197 38.0 36.0 38.0 29.0 38.0 135-139 34.4557 38.0 34.4 38.0 26.6 38.0 140-144 34.23695 38.0 34.2 38.0 26.0 38.0 145-149 33.6407 38.0 33.2 38.0 22.8 38.0 150-151 27.17375 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 0.0 15 2.0 16 0.0 17 0.0 18 3.0 19 0.0 20 1.0 21 6.0 22 3.0 23 8.0 24 6.0 25 8.0 26 19.0 27 18.0 28 21.0 29 28.0 30 36.0 31 51.0 32 57.0 33 80.0 34 169.0 35 269.0 36 742.0 37 2470.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.8 9.825000000000001 9.875 37.5 2 23.65 11.475 34.949999999999996 29.925 3 21.15 14.75 24.6 39.5 4 24.95 23.05 22.3 29.7 5 26.75 26.25 22.7 24.3 6 23.325000000000003 31.075000000000003 22.625 22.975 7 17.4 24.675 37.625 20.3 8 21.0 23.7 29.775000000000002 25.525 9 20.424999999999997 21.7 32.7 25.174999999999997 10-14 22.775000000000002 26.19 25.965 25.069999999999997 15-19 23.670651793306988 24.54604572057426 26.07173227952579 25.711570206592967 20-24 23.095 25.745 25.585 25.575 25-29 23.365 25.155 25.759999999999998 25.72 30-34 23.525 25.264999999999997 25.645 25.564999999999998 35-39 22.93 24.695 26.090000000000003 26.284999999999997 40-44 22.99 24.685000000000002 25.835 26.490000000000002 45-49 23.31 25.44 25.295 25.955000000000002 50-54 22.86 24.779999999999998 26.345000000000002 26.015 55-59 23.400000000000002 25.074999999999996 25.845000000000002 25.679999999999996 60-64 23.54741595584546 24.315102860010036 26.342197691921726 25.795283492222783 65-69 23.235 25.014999999999997 26.0 25.75 70-74 23.39 24.88 25.66 26.07 75-79 22.73068267066767 24.91122780695174 25.581395348837212 26.776694173543387 80-84 23.201160058002902 24.941247062353117 25.82629131456573 26.03130156507825 85-89 23.232323232323232 24.782478247824784 25.922592259225922 26.062606260626065 90-94 23.775 24.875 25.25 26.1 95-99 23.306165308265413 24.53122656132807 26.151307565378268 26.01130056502825 100-104 23.89 24.435000000000002 26.14 25.535000000000004 105-109 24.131032758189548 24.246061515378845 25.57639409852463 26.046511627906977 110-114 23.625 25.019999999999996 25.505 25.85 115-119 23.874774954991 25.01500300060012 25.145029005801163 25.96519303860772 120-124 24.062406240624064 24.44744474447445 25.07750775077508 26.412641264126414 125-129 24.089635854341736 24.879951980792317 24.98999599839936 26.040416166466585 130-134 23.68 24.625 25.605 26.090000000000003 135-139 24.21242124212421 24.51245124512451 25.78757875787579 25.48754875487549 140-144 24.706235311765585 24.746237311865592 24.746237311865592 25.801290064503224 145-149 24.215 24.915000000000003 24.834999999999997 26.035000000000004 150-151 23.674999999999997 24.9125 25.137500000000003 26.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.5 28 2.5 29 3.0 30 5.5 31 7.0 32 9.5 33 15.0 34 22.0 35 35.5 36 47.5 37 53.5 38 68.0 39 96.5 40 129.0 41 154.5 42 165.5 43 172.0 44 192.5 45 212.5 46 225.5 47 210.5 48 201.0 49 192.0 50 160.5 51 147.5 52 140.0 53 122.0 54 102.0 55 107.0 56 107.0 57 87.5 58 75.5 59 75.0 60 64.5 61 56.5 62 60.5 63 58.5 64 64.5 65 57.0 66 40.0 67 39.5 68 37.5 69 34.0 70 32.5 71 29.0 72 23.5 73 17.5 74 10.5 75 9.5 76 9.0 77 2.5 78 2.5 79 2.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.045 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.35000000000000003 65-69 0.0 70-74 0.0 75-79 0.025 80-84 0.005 85-89 0.01 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.025 110-114 0.0 115-119 0.02 120-124 0.01 125-129 0.04 130-134 0.0 135-139 0.01 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.2374999999999998 0.0 0.0 0.0 0.0 126-127 1.3375 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.65 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.4875 0.0 0.0 0.0 0.0 138-139 2.7874999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958280 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958280_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.974 33.0 33.0 34.0 32.0 34.0 2 33.07675 34.0 33.0 34.0 33.0 34.0 3 33.12125 34.0 33.0 34.0 33.0 34.0 4 33.107 34.0 33.0 34.0 33.0 34.0 5 33.075 34.0 33.0 34.0 33.0 34.0 6 37.2945 38.0 38.0 38.0 37.0 38.0 7 37.34625 38.0 38.0 38.0 38.0 38.0 8 37.3675 38.0 38.0 38.0 38.0 38.0 9 37.3575 38.0 38.0 38.0 38.0 38.0 10-14 37.297349999999994 38.0 38.0 38.0 37.6 38.0 15-19 37.283249999999995 38.0 38.0 38.0 37.6 38.0 20-24 37.25705 38.0 38.0 38.0 37.2 38.0 25-29 37.20415 38.0 38.0 38.0 37.0 38.0 30-34 37.227199999999996 38.0 38.0 38.0 37.2 38.0 35-39 37.2298 38.0 38.0 38.0 37.2 38.0 40-44 37.164 38.0 38.0 38.0 37.0 38.0 45-49 37.15795000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.08275 38.0 38.0 38.0 37.0 38.0 55-59 36.9825 38.0 38.0 38.0 36.6 38.0 60-64 37.046150000000004 38.0 38.0 38.0 37.0 38.0 65-69 36.970299999999995 38.0 38.0 38.0 36.2 38.0 70-74 36.981950000000005 38.0 38.0 38.0 36.2 38.0 75-79 36.95625 38.0 38.0 38.0 36.0 38.0 80-84 36.9165 38.0 38.0 38.0 36.0 38.0 85-89 36.772450000000006 38.0 38.0 38.0 35.6 38.0 90-94 36.68575 38.0 38.0 38.0 35.2 38.0 95-99 36.555550000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.588899999999995 38.0 38.0 38.0 35.0 38.0 105-109 36.396699999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.2452 38.0 38.0 38.0 34.0 38.0 115-119 36.0453 38.0 38.0 38.0 33.4 38.0 120-124 36.0692 38.0 38.0 38.0 33.8 38.0 125-129 35.9678 38.0 38.0 38.0 33.4 38.0 130-134 35.72005 38.0 37.4 38.0 32.8 38.0 135-139 35.568650000000005 38.0 37.2 38.0 32.6 38.0 140-144 35.25065 38.0 36.0 38.0 31.4 38.0 145-149 34.64795 38.0 36.0 38.0 28.8 38.0 150-151 30.972749999999998 35.5 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 0.0 4 2.0 5 1.0 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 4.0 15 2.0 16 1.0 17 1.0 18 4.0 19 3.0 20 4.0 21 4.0 22 7.0 23 5.0 24 13.0 25 12.0 26 13.0 27 17.0 28 18.0 29 30.0 30 25.0 31 40.0 32 44.0 33 70.0 34 107.0 35 177.0 36 466.0 37 2907.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.525 18.775 13.0 30.7 2 30.441323971915747 23.846539618856568 25.952858575727184 19.7592778335005 3 21.570102834211184 27.2886882367695 27.715073990469026 23.426134938550288 4 26.57973921765296 31.795386158475424 19.834503510531594 21.790371113340022 5 25.977933801404212 31.770310932798395 19.633901705115345 22.617853560682047 6 22.51190774630233 33.843068438205066 20.957633492103284 22.68739032338932 7 22.386563048383053 20.180496365003762 33.79293055903735 23.640010027575833 8 23.93483709273183 22.05513784461153 23.809523809523807 30.200501253132835 9 24.072216649949848 23.495486459378135 26.83049147442327 25.601805416248745 10-14 26.011734617120506 26.33268141015997 22.98781405145178 24.66776992126774 15-19 25.64218342364038 24.703993578165765 24.618703592213524 25.035119405980332 20-24 26.199909724660213 25.071467977330858 24.349265259040074 24.379357038968855 25-29 25.74739165329053 25.371187800963078 24.282704654895664 24.598715890850723 30-34 25.481347773766544 25.401123144805453 24.558764540713998 24.558764540713998 35-39 25.824892187343295 25.243205295356535 24.104904222244507 24.82699829505566 40-44 25.79076645445887 25.038849065116047 24.572660283723494 24.59772419670159 45-49 26.367236452955034 25.038849065116047 24.407238458068072 24.186676023860844 50-54 26.340069197212056 25.40239683096826 24.13378127663842 24.123752695181267 55-59 26.51792429180246 25.134118826773626 23.62998245174229 24.717974429681625 60-64 26.457758836801204 25.29957382802707 24.52243670092755 23.72023063424417 65-69 25.91626974178992 25.239408373025825 24.432188518425672 24.41213336675859 70-74 26.03309929789368 25.376128385155468 24.488465396188566 24.102306920762288 75-79 26.032477947072973 25.59141940657578 24.423616680032076 23.952485966319166 80-84 25.97864768683274 25.48744423838404 24.038895293468997 24.49501278131422 85-89 25.950065175975134 26.1205254186303 23.698987265617166 24.2304221397774 90-94 26.046628227625973 25.24442216094259 24.42216094259213 24.286788668839307 95-99 25.950255741650786 25.925183030789288 24.320529535653396 23.80403169190653 100-104 26.288866599799398 26.10330992978937 24.0320962888666 23.575727181544632 105-109 26.24586383234734 25.523914569337208 24.59139677128246 23.63882482703299 110-114 26.227370743693896 25.159219698109425 24.732962238603882 23.880447319592797 115-119 26.553020807219855 24.958636249686638 24.572574580095264 23.915768362998246 120-124 26.320276844375346 25.738502432418876 24.31415818245649 23.627062540749286 125-129 26.45245375708056 25.469948368339264 24.30197002356008 23.7756278510201 130-134 26.778641263474555 25.856104286788668 24.001002757583354 23.364251692153424 135-139 26.42370162422298 25.947463404852616 24.533787848405854 23.095047122518547 140-144 26.55435218612114 26.514239871640594 24.002206177296433 22.929201764941837 145-149 26.77264065790793 25.870023066893992 24.55119847557918 22.806137799618895 150-151 27.641970665663784 25.398019305503322 24.69600100288329 22.264009025949605 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 4.5 2 1.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.5 28 3.0 29 2.5 30 5.0 31 9.0 32 10.5 33 12.5 34 18.5 35 25.0 36 34.5 37 54.0 38 66.5 39 81.5 40 113.5 41 137.0 42 150.0 43 167.5 44 206.0 45 216.5 46 194.0 47 177.0 48 170.0 49 170.5 50 162.5 51 163.0 52 150.5 53 119.5 54 109.5 55 112.0 56 103.5 57 91.0 58 82.5 59 70.5 60 71.0 61 87.0 62 80.0 63 66.0 64 65.5 65 60.0 66 48.5 67 49.0 68 57.0 69 47.0 70 38.5 71 31.5 72 19.5 73 15.0 74 13.0 75 16.5 76 11.5 77 4.5 78 4.0 79 3.5 80 2.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.325 4 0.3 5 0.3 6 0.27499999999999997 7 0.27499999999999997 8 0.25 9 0.3 10-14 0.295 15-19 0.33999999999999997 20-24 0.305 25-29 0.32 30-34 0.27999999999999997 35-39 0.29 40-44 0.255 45-49 0.255 50-54 0.28500000000000003 55-59 0.27499999999999997 60-64 0.27499999999999997 65-69 0.27499999999999997 70-74 0.3 75-79 0.24 80-84 0.245 85-89 0.27 90-94 0.27499999999999997 95-99 0.29 100-104 0.3 105-109 0.27 110-114 0.295 115-119 0.27499999999999997 120-124 0.305 125-129 0.255 130-134 0.27499999999999997 135-139 0.26 140-144 0.27999999999999997 145-149 0.29 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5538771399798591 1.0999999999999999 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.1 0.0 0.0 0.0 0.0 124-125 1.2374999999999998 0.0 0.0 0.0 0.0 126-127 1.3375 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.65 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAACCT 10 0.006830828 145.0 7 >>END_MODULE Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215775 spots for SRR6958280.sra Written 1215775 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra Read 1215771 spots for SRR6958280.sra Written 1215771 spots for SRR6958280.sra SRR ids: ['SRR6958280.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mbjte0rk SRR6958280.sra spots: 24315424 blocks: [[1, 1215771], [1215772, 2431542], [2431543, 3647313], [3647314, 4863084], [4863085, 6078855], [6078856, 7294626], [7294627, 8510397], [8510398, 9726168], [9726169, 10941939], [10941940, 12157710], [12157711, 13373481], [13373482, 14589252], [14589253, 15805023], [15805024, 17020794], [17020795, 18236565], [18236566, 19452336], [19452337, 20668107], [20668108, 21883878], [21883879, 23099649], [23099650, 24315424]] SRR6958280 file size 8217998 SRR6958280 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958280 SRR6958280_1.fastq SRR6958280_2.fastq Input file: SRR6958280_1.fastq Paired file: SRR6958280_2.fastq trimmed: SRR6958280-trimmed-pair1.fastq, SRR6958280-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:35:38 2024 >> started Fri Dec 6 18:40:00 2024 >> done (261.263s) 24315424 read pairs processed; of these: 22182 ( 0.09%) short read pairs filtered out after trimming by size control 77962 ( 0.32%) empty read pairs filtered out after trimming by size control 24215280 (99.59%) read pairs available; of these: 10428812 (43.07%) trimmed read pairs available after processing 13786468 (56.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 4 0.00% 21 7 0.00% 22 7 0.00% 23 4 0.00% 24 5 0.00% 25 10 0.00% 26 4 0.00% 27 5 0.00% 28 7 0.00% 29 8 0.00% 30 6 0.00% 31 9 0.00% 32 4 0.00% 33 3 0.00% 34 3 0.00% 35 7 0.00% 36 5 0.00% 37 7 0.00% 38 14 0.00% 39 6 0.00% 40 11 0.00% 41 9 0.00% 42 10 0.00% 43 14 0.00% 44 19 0.00% 45 15 0.00% 46 13 0.00% 47 19 0.00% 48 29 0.00% 49 21 0.00% 50 19 0.00% 51 33 0.00% 52 30 0.00% 53 53 0.00% 54 31 0.00% 55 40 0.00% 56 37 0.00% 57 54 0.00% 58 46 0.00% 59 85 0.00% 60 68 0.00% 61 93 0.00% 62 95 0.00% 63 95 0.00% 64 101 0.00% 65 123 0.00% 66 121 0.00% 67 152 0.00% 68 173 0.00% 69 199 0.00% 70 211 0.00% 71 261 0.00% 72 314 0.00% 73 325 0.00% 74 347 0.00% 75 399 0.00% 76 464 0.00% 77 530 0.00% 78 580 0.00% 79 632 0.00% 80 760 0.00% 81 824 0.00% 82 1007 0.00% 83 1143 0.00% 84 2044 0.01% 85 2441 0.01% 86 2661 0.01% 87 2770 0.01% 88 3078 0.01% 89 3151 0.01% 90 3359 0.01% 91 3541 0.01% 92 3788 0.02% 93 4027 0.02% 94 4292 0.02% 95 4702 0.02% 96 4917 0.02% 97 5244 0.02% 98 5676 0.02% 99 6034 0.02% 100 6518 0.03% 101 7123 0.03% 102 7498 0.03% 103 8008 0.03% 104 8894 0.04% 105 9374 0.04% 106 10111 0.04% 107 10694 0.04% 108 11348 0.05% 109 12058 0.05% 110 12696 0.05% 111 13552 0.06% 112 14480 0.06% 113 15377 0.06% 114 16826 0.07% 115 17661 0.07% 116 19045 0.08% 117 19863 0.08% 118 21013 0.09% 119 22076 0.09% 120 23455 0.10% 121 24659 0.10% 122 25881 0.11% 123 27595 0.11% 124 29417 0.12% 125 31021 0.13% 126 32729 0.14% 127 34521 0.14% 128 36100 0.15% 129 38138 0.16% 130 39631 0.16% 131 41625 0.17% 132 44421 0.18% 133 46929 0.19% 134 49685 0.21% 135 52640 0.22% 136 56028 0.23% 137 58718 0.24% 138 62821 0.26% 139 67407 0.28% 140 72669 0.30% 141 79461 0.33% 142 87963 0.36% 143 98197 0.41% 144 114554 0.47% 145 137032 0.57% 146 173451 0.72% 147 240511 0.99% 148 380540 1.57% 149 856082 3.54% 150 7029256 29.03% 151 13786468 56.93% 24215280 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=9.36 fanout-score-rank=11 prefix-density=0.71 prefix-fanout=4.4 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.12 sequence-density-rank=14 fanout-score=51.25 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=16.1 sequence=TTCTCCTCCTTG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=38 prefix-density=0.44 prefix-fanout=2.0 sequence=GCGGCAACTGCG criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=87.53 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=5.7 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAG SRR6958280 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:45:23 Started mapping on | Dec 06 18:45:24 Finished on | Dec 06 19:11:25 Mapping speed, Million of reads per hour | 55.85 Number of input reads | 24215280 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23442958 Uniquely mapped reads % | 96.81% Average mapped length | 297.72 Number of splices: Total | 26532146 Number of splices: Annotated (sjdb) | 24898011 Number of splices: GT/AG | 26187251 Number of splices: GC/AG | 292529 Number of splices: AT/AC | 12374 Number of splices: Non-canonical | 39992 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.51 Insertion rate per base | 0.01% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 209381 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 21570 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.60% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 575472 575472 575472 N_multimapping 209381 209381 209381 N_noFeature 809398 22854255 988384 N_ambiguous 488879 3249 79937 UnstrandedReadsAssigned:22144681 PositiveStrandReadsAssigned:585454 NegativeStrandReadsAssigned:22374637 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958280 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958280-trimmed-pair1.fastq SRR6958280-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,215,280 reads, 22,367,217 reads pseudoaligned [quant] estimated average fragment length: 265.429 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR6958280.ke.tsv 35125 SRR6958280.se.tsv 88098 total ==> SRR6958280.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.073 70.4297 6.80097 PNS24247 1044 779.571 71.9294 5.988 PNS24249 1928 1663.57 107.587 4.19709 PNS24246 1044 779.571 71.9294 5.988 PNS24248 1044 779.571 71.9294 5.988 PNS24244 1471 1206.57 52.1955 2.80744 PNS24243 293 80.2186 0 0 KQK14069 1603 1338.57 1138.01 55.1744 KQK14071 474 222.412 19.3715 5.65243 ==> SRR6958280.se.tsv <== BRADI_1g14170v3 1269 BRADI_1g53295v3 509 BRADI_1g59795v3 288 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 697 BRADI_1g74790v3 629 BRADI_1g09890v3 0 BRADI_1g77505v3 300 BRADI_1g48960v3 1 SRR6958280 completed mapping pipeline successfully