Starting /dee2/code/volunteer_pipeline.sh SRR6958281 current disk space = 1550110580736 free memory = 1593094540 SRR6958281 SRAfilesize 317e0eeb77215e1757901e8237ed8855 SRR6958281.sra SRR6958281.sra file validated SRR6958281 is paired end SRR6958281 is conventional basespace SRR6958281 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958281_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.05625 18.0 18.0 31.0 18.0 32.0 2 29.6585 30.0 27.0 33.0 27.0 33.0 3 30.4845 33.0 29.0 33.0 27.0 33.0 4 30.606 33.0 31.0 33.0 27.0 33.0 5 31.84375 33.0 32.0 33.0 30.0 33.0 6 36.267 38.0 36.0 38.0 33.0 38.0 7 36.8675 38.0 37.0 38.0 35.0 38.0 8 36.97425 38.0 38.0 38.0 35.0 38.0 9 37.1955 38.0 38.0 38.0 36.0 38.0 10-14 37.268449999999994 38.0 38.0 38.0 36.2 38.0 15-19 37.2838 38.0 38.0 38.0 36.6 38.0 20-24 37.19715 38.0 38.0 38.0 36.2 38.0 25-29 37.12935 38.0 38.0 38.0 36.2 38.0 30-34 37.02195 38.0 38.0 38.0 35.6 38.0 35-39 36.710699999999996 38.0 38.0 38.0 34.6 38.0 40-44 36.82149999999999 38.0 38.0 38.0 34.8 38.0 45-49 36.5867 38.0 38.0 38.0 34.0 38.0 50-54 36.321549999999995 38.0 37.8 38.0 33.2 38.0 55-59 36.311 38.0 37.8 38.0 33.4 38.0 60-64 36.7786 38.0 38.0 38.0 34.6 38.0 65-69 36.527950000000004 38.0 37.8 38.0 34.0 38.0 70-74 35.9778 38.0 37.2 38.0 31.8 38.0 75-79 35.77755 38.0 36.8 38.0 30.2 38.0 80-84 35.941449999999996 38.0 37.0 38.0 31.8 38.0 85-89 36.1669 38.0 37.0 38.0 33.0 38.0 90-94 36.001349999999995 38.0 37.0 38.0 32.2 38.0 95-99 35.02075 38.0 35.4 38.0 27.4 38.0 100-104 34.881299999999996 38.0 35.0 38.0 26.4 38.0 105-109 34.4043 38.0 34.2 38.0 24.2 38.0 110-114 34.603649999999995 38.0 34.6 38.0 25.6 38.0 115-119 33.9661 38.0 34.0 38.0 22.6 38.0 120-124 34.08365 38.0 34.0 38.0 23.4 38.0 125-129 33.65335 37.8 33.8 38.0 19.6 38.0 130-134 32.89835 37.2 32.4 38.0 16.6 38.0 135-139 32.14365 36.4 31.4 38.0 14.4 38.0 140-144 30.398000000000003 35.4 28.0 38.0 13.2 38.0 145-149 28.09015 34.0 22.4 38.0 2.0 38.0 150-151 23.821875 31.0 7.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 4.0 16 1.0 17 1.0 18 6.0 19 3.0 20 6.0 21 9.0 22 10.0 23 19.0 24 14.0 25 31.0 26 39.0 27 62.0 28 73.0 29 92.0 30 96.0 31 125.0 32 163.0 33 238.0 34 364.0 35 511.0 36 1034.0 37 1096.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.875171467764055 15.582990397805213 6.611796982167352 38.93004115226337 2 21.425 12.65 32.6 33.324999999999996 3 19.475 16.475 23.625 40.425 4 24.55 23.5 23.75 28.199999999999996 5 26.3 28.725 23.075000000000003 21.9 6 23.849999999999998 31.1 23.35 21.7 7 17.625 22.625 40.1 19.650000000000002 8 20.1 24.05 29.349999999999998 26.5 9 19.925 22.225 32.324999999999996 25.525 10-14 22.82 26.150000000000002 25.935000000000002 25.095 15-19 22.435 25.005 26.125 26.435 20-24 22.91 25.305 26.0 25.785000000000004 25-29 22.39 25.34 26.435 25.835 30-34 22.96 25.395 26.064999999999998 25.580000000000002 35-39 22.759999999999998 24.83 26.540000000000003 25.869999999999997 40-44 22.770000000000003 25.080000000000002 26.555 25.595000000000002 45-49 23.21 25.06 26.02 25.71 50-54 23.11 25.055 26.355 25.480000000000004 55-59 23.07 24.705 26.045 26.179999999999996 60-64 23.244999999999997 25.21 25.735000000000003 25.81 65-69 22.89 25.77 25.96 25.380000000000003 70-74 23.66 24.654999999999998 25.740000000000002 25.945 75-79 23.195 24.474999999999998 26.26 26.07 80-84 23.49 25.019999999999996 25.705 25.785000000000004 85-89 23.13 25.069999999999997 26.05 25.75 90-94 23.599999999999998 24.73 25.865 25.805 95-99 23.605 24.765 26.36 25.27 100-104 23.02 24.64 26.055 26.284999999999997 105-109 23.400000000000002 24.355 26.290000000000003 25.955000000000002 110-114 23.415 24.715 25.495 26.375 115-119 23.46 24.675 26.185000000000002 25.679999999999996 120-124 23.335 25.03 25.485000000000003 26.150000000000002 125-129 23.875 24.11 25.95 26.064999999999998 130-134 24.215 24.09 25.924999999999997 25.77 135-139 23.885 24.765 25.785000000000004 25.564999999999998 140-144 24.085 24.955 25.71 25.25 145-149 24.09 24.73 25.629999999999995 25.55 150-151 24.5375 24.3125 25.575 25.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 0.5 28 4.0 29 6.0 30 5.5 31 9.5 32 13.5 33 17.0 34 26.0 35 34.5 36 47.5 37 56.0 38 73.5 39 103.5 40 121.5 41 146.5 42 180.5 43 210.5 44 223.5 45 211.5 46 200.5 47 193.5 48 192.5 49 195.5 50 174.0 51 149.0 52 142.5 53 135.0 54 115.0 55 95.5 56 80.5 57 83.0 58 79.0 59 70.5 60 72.0 61 63.5 62 55.0 63 60.0 64 53.5 65 40.5 66 38.5 67 36.5 68 37.0 69 30.5 70 26.0 71 19.0 72 17.5 73 17.0 74 10.0 75 9.5 76 6.0 77 2.0 78 2.5 79 2.5 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.6000000000000001 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.1124999999999998 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.2625 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.575 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.2249999999999996 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.975 0.0 0.0 0.0 0.0 138-139 3.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATCTT 10 0.006846698 144.88751 4 >>END_MODULE SRR6958281 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958281_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2945 33.0 33.0 34.0 31.0 34.0 2 32.29375 33.0 33.0 34.0 31.0 34.0 3 32.486 33.0 33.0 34.0 31.0 34.0 4 32.14725 33.0 33.0 34.0 31.0 34.0 5 32.255 33.0 33.0 34.0 31.0 34.0 6 35.778 38.0 38.0 38.0 30.0 38.0 7 35.99975 38.0 38.0 38.0 31.0 38.0 8 35.95025 38.0 38.0 38.0 31.0 38.0 9 36.129 38.0 38.0 38.0 33.0 38.0 10-14 36.1661 38.0 38.0 38.0 32.6 38.0 15-19 36.4429 38.0 38.0 38.0 34.2 38.0 20-24 36.57334999999999 38.0 38.0 38.0 34.6 38.0 25-29 36.51985 38.0 38.0 38.0 34.6 38.0 30-34 36.3329 38.0 38.0 38.0 34.0 38.0 35-39 36.27275 38.0 38.0 38.0 33.4 38.0 40-44 36.18249999999999 38.0 38.0 38.0 33.2 38.0 45-49 36.126799999999996 38.0 38.0 38.0 33.0 38.0 50-54 36.07385000000001 38.0 37.8 38.0 33.4 38.0 55-59 36.11525 38.0 38.0 38.0 33.4 38.0 60-64 35.8241 38.0 37.0 38.0 31.4 38.0 65-69 35.748400000000004 38.0 37.2 38.0 31.2 38.0 70-74 35.57195 38.0 37.0 38.0 30.2 38.0 75-79 35.516000000000005 38.0 37.0 38.0 30.2 38.0 80-84 35.4231 38.0 36.8 38.0 29.4 38.0 85-89 35.26835 38.0 36.6 38.0 29.2 38.0 90-94 35.14375 38.0 36.2 38.0 28.8 38.0 95-99 34.87165 38.0 35.6 38.0 27.2 38.0 100-104 34.181799999999996 38.0 34.4 38.0 23.2 38.0 105-109 34.07405 38.0 34.2 38.0 22.6 38.0 110-114 33.89505 38.0 34.0 38.0 21.4 38.0 115-119 33.316700000000004 38.0 33.8 38.0 17.8 38.0 120-124 33.1503 38.0 33.4 38.0 17.4 38.0 125-129 32.87325 37.8 33.2 38.0 16.0 38.0 130-134 32.16395000000001 37.0 32.0 38.0 14.0 38.0 135-139 31.330400000000004 36.0 30.4 38.0 13.2 38.0 140-144 30.933299999999996 36.2 30.4 38.0 13.0 38.0 145-149 29.05455 35.2 25.8 38.0 2.0 38.0 150-151 23.357875 29.0 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 6.0 4 7.0 5 1.0 6 2.0 7 3.0 8 0.0 9 4.0 10 2.0 11 0.0 12 3.0 13 7.0 14 2.0 15 6.0 16 2.0 17 4.0 18 9.0 19 7.0 20 15.0 21 13.0 22 19.0 23 28.0 24 28.0 25 32.0 26 48.0 27 53.0 28 61.0 29 74.0 30 115.0 31 118.0 32 151.0 33 192.0 34 301.0 35 469.0 36 864.0 37 1337.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.75943985996499 19.4048512128032 12.028007001750437 30.807701925481368 2 28.575 23.45 27.275 20.7 3 21.175 26.35 29.299999999999997 23.175 4 26.375 31.65 20.474999999999998 21.5 5 27.825 32.125 18.475 21.575 6 23.875 34.575 20.349999999999998 21.2 7 22.75 20.275000000000002 33.900000000000006 23.075000000000003 8 24.65 23.575 23.05 28.725 9 23.5 23.3 27.525 25.674999999999997 10-14 25.495 26.405 23.085 25.014999999999997 15-19 25.790000000000003 25.69 24.48 24.04 20-24 25.255 26.185000000000002 24.224999999999998 24.335 25-29 26.11 25.46 23.919999999999998 24.51 30-34 25.1 25.795 24.72 24.385 35-39 25.509999999999998 25.2 24.73 24.560000000000002 40-44 26.245 25.535000000000004 24.404999999999998 23.815 45-49 25.96 25.53 24.115000000000002 24.395 50-54 26.334999999999997 25.865 24.154999999999998 23.645 55-59 26.090000000000003 25.2 24.965 23.745 60-64 25.88 25.825 24.195 24.099999999999998 65-69 25.619999999999997 25.814999999999998 24.3 24.265 70-74 26.14 25.490000000000002 24.675 23.695 75-79 25.669999999999998 26.095000000000002 24.42 23.815 80-84 26.015 25.53 24.21 24.245 85-89 25.97 25.275 24.715 24.04 90-94 25.679999999999996 25.5 25.014999999999997 23.805 95-99 25.759999999999998 25.6 24.610000000000003 24.03 100-104 26.015 25.5 24.610000000000003 23.875 105-109 25.95 25.740000000000002 24.834999999999997 23.474999999999998 110-114 26.655 25.535000000000004 24.240000000000002 23.57 115-119 26.625 25.814999999999998 24.255 23.305 120-124 26.845000000000002 25.724999999999998 24.135 23.294999999999998 125-129 26.605 25.935000000000002 24.285 23.175 130-134 26.77 25.81 24.43 22.99 135-139 26.245 25.945 24.695 23.115 140-144 26.825 25.779999999999998 24.68 22.715 145-149 26.615 25.775 24.610000000000003 23.0 150-151 27.500000000000004 25.5125 25.074999999999996 21.912499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.5 28 2.5 29 4.5 30 6.5 31 11.5 32 12.5 33 10.0 34 16.0 35 33.5 36 42.5 37 49.5 38 77.5 39 99.5 40 121.5 41 136.0 42 160.0 43 184.0 44 185.5 45 193.5 46 199.0 47 192.5 48 181.5 49 190.5 50 172.0 51 149.5 52 138.0 53 112.5 54 103.0 55 99.5 56 89.0 57 83.5 58 91.0 59 88.0 60 82.0 61 75.0 62 75.5 63 72.5 64 57.5 65 56.0 66 61.0 67 60.0 68 51.5 69 40.5 70 35.5 71 27.0 72 18.0 73 14.0 74 10.5 75 9.5 76 6.5 77 3.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21677614957048 98.175 2 0.6063668519454269 1.2 3 0.12632642748863063 0.375 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.025265285497726126 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.2625 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.7875 0.0 0.0 0.0 0.0 132-133 2.1125 0.0 0.0 0.0 0.0 134-135 2.5375 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 3.1624999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096082 spots for SRR6958281.sra Written 1096082 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra Read 1096081 spots for SRR6958281.sra Written 1096081 spots for SRR6958281.sra SRR ids: ['SRR6958281.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6lbe_c_d SRR6958281.sra spots: 21921621 blocks: [[1, 1096081], [1096082, 2192162], [2192163, 3288243], [3288244, 4384324], [4384325, 5480405], [5480406, 6576486], [6576487, 7672567], [7672568, 8768648], [8768649, 9864729], [9864730, 10960810], [10960811, 12056891], [12056892, 13152972], [13152973, 14249053], [14249054, 15345134], [15345135, 16441215], [16441216, 17537296], [17537297, 18633377], [18633378, 19729458], [19729459, 20825539], [20825540, 21921621]] SRR6958281 file size 7406817 SRR6958281 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958281 SRR6958281_1.fastq SRR6958281_2.fastq Input file: SRR6958281_1.fastq Paired file: SRR6958281_2.fastq trimmed: SRR6958281-trimmed-pair1.fastq, SRR6958281-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:33:15 2024 >> started Fri Dec 6 18:33:38 2024 >> done (23.235s) 21921621 read pairs processed; of these: 36714 ( 0.17%) short read pairs filtered out after trimming by size control 29792 ( 0.14%) empty read pairs filtered out after trimming by size control 21855115 (99.70%) read pairs available; of these: 10053819 (46.00%) trimmed read pairs available after processing 11801296 (54.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 7 0.00% 24 4 0.00% 25 3 0.00% 26 8 0.00% 27 7 0.00% 28 8 0.00% 29 5 0.00% 30 6 0.00% 31 8 0.00% 32 6 0.00% 33 13 0.00% 34 6 0.00% 35 12 0.00% 36 12 0.00% 37 9 0.00% 38 11 0.00% 39 14 0.00% 40 14 0.00% 41 13 0.00% 42 30 0.00% 43 18 0.00% 44 20 0.00% 45 22 0.00% 46 28 0.00% 47 41 0.00% 48 42 0.00% 49 29 0.00% 50 36 0.00% 51 47 0.00% 52 55 0.00% 53 78 0.00% 54 65 0.00% 55 64 0.00% 56 74 0.00% 57 99 0.00% 58 115 0.00% 59 109 0.00% 60 164 0.00% 61 146 0.00% 62 150 0.00% 63 159 0.00% 64 173 0.00% 65 186 0.00% 66 226 0.00% 67 255 0.00% 68 274 0.00% 69 340 0.00% 70 320 0.00% 71 375 0.00% 72 447 0.00% 73 475 0.00% 74 534 0.00% 75 646 0.00% 76 724 0.00% 77 793 0.00% 78 903 0.00% 79 947 0.00% 80 1091 0.00% 81 1282 0.01% 82 1446 0.01% 83 1763 0.01% 84 3296 0.02% 85 4194 0.02% 86 4130 0.02% 87 4473 0.02% 88 4328 0.02% 89 4735 0.02% 90 4855 0.02% 91 4987 0.02% 92 5318 0.02% 93 5574 0.03% 94 5997 0.03% 95 6647 0.03% 96 6904 0.03% 97 7236 0.03% 98 7578 0.03% 99 8152 0.04% 100 8610 0.04% 101 9434 0.04% 102 10013 0.05% 103 10862 0.05% 104 11928 0.05% 105 12754 0.06% 106 13443 0.06% 107 14181 0.06% 108 15060 0.07% 109 15799 0.07% 110 16933 0.08% 111 17855 0.08% 112 19186 0.09% 113 20095 0.09% 114 21907 0.10% 115 23417 0.11% 116 24344 0.11% 117 25682 0.12% 118 27185 0.12% 119 28096 0.13% 120 29804 0.14% 121 31043 0.14% 122 33068 0.15% 123 34891 0.16% 124 37238 0.17% 125 39643 0.18% 126 41353 0.19% 127 43739 0.20% 128 46020 0.21% 129 48496 0.22% 130 50806 0.23% 131 53959 0.25% 132 57350 0.26% 133 61649 0.28% 134 65657 0.30% 135 69831 0.32% 136 73641 0.34% 137 78451 0.36% 138 84183 0.39% 139 91325 0.42% 140 99054 0.45% 141 108150 0.49% 142 122010 0.56% 143 139228 0.64% 144 162841 0.75% 145 197610 0.90% 146 246856 1.13% 147 339237 1.55% 148 524117 2.40% 149 1066669 4.88% 150 5525740 25.28% 151 11801296 54.00% 21855115 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=20 prefix-density=0.72 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=60.63 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=23 prefix-density=0.54 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=61.91 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.8 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958281 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:34:19 Started mapping on | Dec 06 18:34:19 Finished on | Dec 06 18:36:46 Mapping speed, Million of reads per hour | 535.23 Number of input reads | 21855115 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21065816 Uniquely mapped reads % | 96.39% Average mapped length | 295.90 Number of splices: Total | 24334603 Number of splices: Annotated (sjdb) | 22883407 Number of splices: GT/AG | 23993463 Number of splices: GC/AG | 286181 Number of splices: AT/AC | 9322 Number of splices: Non-canonical | 45637 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234668 % of reads mapped to multiple loci | 1.07% Number of reads mapped to too many loci | 7111 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.32% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 576378 576378 576378 N_multimapping 234668 234668 234668 N_noFeature 700576 20456118 849585 N_ambiguous 541000 2946 80985 UnstrandedReadsAssigned:19824240 PositiveStrandReadsAssigned:606752 NegativeStrandReadsAssigned:20135246 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958281 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958281-trimmed-pair1.fastq SRR6958281-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,855,115 reads, 20,117,203 reads pseudoaligned [quant] estimated average fragment length: 259.36 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR6958281.ke.tsv 35125 SRR6958281.se.tsv 88098 total ==> SRR6958281.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.115 0 0 PNS24247 1044 785.64 57.7504 5.43751 PNS24249 1928 1669.64 53.2931 2.36111 PNS24246 1044 785.64 57.7504 5.43751 PNS24248 1044 785.64 57.7504 5.43751 PNS24244 1471 1212.64 53.4556 3.26084 PNS24243 293 85.0255 0 0 KQK14069 1603 1344.64 4101.89 225.656 KQK14071 474 228.52 84.0568 27.2093 ==> SRR6958281.se.tsv <== BRADI_1g14170v3 4863 BRADI_1g53295v3 1578 BRADI_1g59795v3 103 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 418 BRADI_1g74790v3 128 BRADI_1g09890v3 0 BRADI_1g77505v3 292 BRADI_1g48960v3 0 SRR6958281 completed mapping pipeline successfully