Starting /dee2/code/volunteer_pipeline.sh SRR6958282 current disk space = 1550122582016 free memory = 1602344208 SRR6958282 SRAfilesize 8cfcf9402ef408100e27249fb73e0762 SRR6958282.sra SRR6958282.sra file validated SRR6958282 is paired end SRR6958282 is conventional basespace SRR6958282 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958282_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.5015 32.0 30.0 33.0 18.0 33.0 2 30.34975 31.0 29.0 33.0 25.0 34.0 3 30.85675 33.0 29.0 33.0 27.0 33.0 4 30.806 33.0 31.0 33.0 27.0 33.0 5 32.042 33.0 32.0 33.0 31.0 34.0 6 36.52475 38.0 37.0 38.0 34.0 38.0 7 36.906 38.0 38.0 38.0 35.0 38.0 8 37.173 38.0 38.0 38.0 36.0 38.0 9 37.38975 38.0 38.0 38.0 37.0 38.0 10-14 37.3692 38.0 38.0 38.0 37.0 38.0 15-19 37.37415 38.0 38.0 38.0 37.0 38.0 20-24 37.420100000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.272349999999996 38.0 38.0 38.0 36.6 38.0 30-34 37.20185 38.0 38.0 38.0 36.4 38.0 35-39 37.119899999999994 38.0 38.0 38.0 36.2 38.0 40-44 36.9493 38.0 38.0 38.0 35.4 38.0 45-49 37.1049 38.0 38.0 38.0 36.0 38.0 50-54 37.075 38.0 38.0 38.0 36.0 38.0 55-59 36.7498 38.0 38.0 38.0 34.6 38.0 60-64 36.810849999999995 38.0 38.0 38.0 34.8 38.0 65-69 36.864200000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.824149999999996 38.0 38.0 38.0 34.8 38.0 75-79 36.648199999999996 38.0 38.0 38.0 34.4 38.0 80-84 36.2856 38.0 37.4 38.0 33.2 38.0 85-89 36.2016 38.0 37.0 38.0 32.6 38.0 90-94 36.285000000000004 38.0 37.2 38.0 33.4 38.0 95-99 36.28000000000001 38.0 37.0 38.0 33.4 38.0 100-104 36.1656 38.0 37.0 38.0 33.0 38.0 105-109 35.80995 38.0 36.4 38.0 31.6 38.0 110-114 35.443200000000004 38.0 35.8 38.0 29.4 38.0 115-119 35.340050000000005 38.0 35.4 38.0 29.0 38.0 120-124 35.1283 38.0 35.0 38.0 28.4 38.0 125-129 34.90355 38.0 35.0 38.0 27.6 38.0 130-134 34.62134999999999 38.0 35.0 38.0 26.2 38.0 135-139 34.64390000000001 38.0 35.0 38.0 27.2 38.0 140-144 33.9337 38.0 34.2 38.0 23.2 38.0 145-149 32.3274 37.2 33.0 38.0 15.2 38.0 150-151 28.057875000000003 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 4.0 20 1.0 21 6.0 22 2.0 23 4.0 24 8.0 25 18.0 26 12.0 27 23.0 28 39.0 29 44.0 30 63.0 31 79.0 32 117.0 33 180.0 34 267.0 35 416.0 36 930.0 37 1785.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.96670135275754 9.833506763787721 9.027055150884495 44.172736732570236 2 23.35 12.2 37.425000000000004 27.025 3 20.775 15.125 25.525 38.574999999999996 4 23.925 23.275000000000002 21.8 31.0 5 25.212606303151574 27.01350675337669 25.662831415707853 22.11105552776388 6 23.625 32.95 22.225 21.2 7 17.75 26.025 38.625 17.599999999999998 8 21.05 22.95 31.025000000000002 24.975 9 19.2 21.975 34.449999999999996 24.375 10-14 22.040000000000003 27.1 25.95 24.91 15-19 22.45 25.81 26.35 25.39 20-24 22.759999999999998 25.505 26.995 24.740000000000002 25-29 22.59 25.81 26.26 25.34 30-34 22.705000000000002 25.985000000000003 26.36 24.95 35-39 22.605 25.71 26.229999999999997 25.455 40-44 22.775000000000002 26.145000000000003 25.88 25.2 45-49 22.52 25.575 26.255 25.650000000000002 50-54 22.919999999999998 25.729999999999997 26.165 25.185000000000002 55-59 22.785 26.05 25.840000000000003 25.324999999999996 60-64 22.66 25.715 26.064999999999998 25.56 65-69 22.745 25.755 26.174999999999997 25.324999999999996 70-74 22.900000000000002 25.555 26.665 24.88 75-79 23.275000000000002 26.035000000000004 25.45 25.240000000000002 80-84 23.200000000000003 25.905 25.805 25.09 85-89 23.119999999999997 25.295 25.865 25.72 90-94 23.625 25.374999999999996 25.805 25.195 95-99 22.93 25.55 26.02 25.5 100-104 23.02 25.52 26.169999999999998 25.290000000000003 105-109 22.79 25.585 25.695 25.929999999999996 110-114 23.115 25.44 26.11 25.335 115-119 23.69 25.435000000000002 25.419999999999998 25.455 120-124 22.75 25.44 26.05 25.759999999999998 125-129 22.95 25.424999999999997 25.595000000000002 26.029999999999998 130-134 23.265 25.45 26.005 25.28 135-139 23.294999999999998 25.195 26.375 25.135 140-144 23.32 25.155 25.845000000000002 25.679999999999996 145-149 23.095 25.39 26.165 25.35 150-151 23.020142624796698 25.359689728512446 25.55986488177155 26.060302764919303 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 2.0 27 2.0 28 3.0 29 3.5 30 4.5 31 12.5 32 15.0 33 20.0 34 34.0 35 44.5 36 56.0 37 63.0 38 81.0 39 102.0 40 125.0 41 159.5 42 186.0 43 216.0 44 231.5 45 215.5 46 203.5 47 214.0 48 212.0 49 186.5 50 172.0 51 158.5 52 138.0 53 119.0 54 98.0 55 82.5 56 83.0 57 85.0 58 78.5 59 75.5 60 65.5 61 56.0 62 55.0 63 50.0 64 46.0 65 49.5 66 34.5 67 24.5 68 27.0 69 24.0 70 17.5 71 15.0 72 18.5 73 13.5 74 8.0 75 4.0 76 3.5 77 2.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.9 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0125 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.037500000000000006 0.0 0.0 0.025 0.0 90-91 0.07500000000000001 0.0 0.0 0.025 0.0 92-93 0.175 0.0 0.0 0.025 0.0 94-95 0.175 0.0 0.0 0.025 0.0 96-97 0.1875 0.0 0.0 0.025 0.0 98-99 0.2 0.0 0.0 0.025 0.0 100-101 0.21250000000000002 0.0 0.0 0.025 0.0 102-103 0.3 0.0 0.0 0.025 0.0 104-105 0.425 0.0 0.0 0.025 0.0 106-107 0.5 0.0 0.0 0.025 0.0 108-109 0.5874999999999999 0.0 0.0 0.025 0.0 110-111 0.6625000000000001 0.0 0.0 0.025 0.0 112-113 0.6875 0.0 0.0 0.025 0.0 114-115 0.7875000000000001 0.0 0.0 0.025 0.0 116-117 0.9375 0.0 0.0 0.025 0.0 118-119 1.075 0.0 0.0 0.025 0.0 120-121 1.225 0.0 0.0 0.025 0.0 122-123 1.3624999999999998 0.0 0.0 0.025 0.0 124-125 1.5125000000000002 0.0 0.0 0.025 0.0 126-127 1.75 0.0 0.0 0.025 0.0 128-129 2.0 0.0 0.0 0.025 0.0 130-131 2.1875 0.0 0.0 0.025 0.0 132-133 2.375 0.0 0.0 0.025 0.0 134-135 2.6500000000000004 0.0 0.0 0.025 0.0 136-137 2.875 0.0 0.0 0.025 0.0 138-139 3.1125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGAGA 10 0.0068343505 144.975 7 >>END_MODULE SRR6958282 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958282_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86475 33.0 33.0 34.0 32.0 34.0 2 32.88225 33.0 33.0 34.0 32.0 34.0 3 32.7365 33.0 33.0 34.0 32.0 34.0 4 32.791 33.0 33.0 34.0 32.0 34.0 5 32.8335 33.0 33.0 34.0 32.0 34.0 6 36.915 38.0 38.0 38.0 36.0 38.0 7 36.86075 38.0 38.0 38.0 36.0 38.0 8 36.9235 38.0 38.0 38.0 36.0 38.0 9 36.79975 38.0 38.0 38.0 35.0 38.0 10-14 36.78815 38.0 38.0 38.0 34.8 38.0 15-19 36.71925 38.0 38.0 38.0 34.8 38.0 20-24 36.837700000000005 38.0 38.0 38.0 35.4 38.0 25-29 36.8558 38.0 38.0 38.0 35.6 38.0 30-34 36.926 38.0 38.0 38.0 35.8 38.0 35-39 36.720749999999995 38.0 38.0 38.0 34.8 38.0 40-44 36.6871 38.0 38.0 38.0 34.8 38.0 45-49 36.632149999999996 38.0 38.0 38.0 34.4 38.0 50-54 36.63155 38.0 38.0 38.0 34.6 38.0 55-59 36.5754 38.0 38.0 38.0 34.2 38.0 60-64 36.622400000000006 38.0 38.0 38.0 34.2 38.0 65-69 36.3798 38.0 38.0 38.0 33.6 38.0 70-74 36.3444 38.0 38.0 38.0 34.0 38.0 75-79 36.12405 38.0 37.4 38.0 33.2 38.0 80-84 36.01049999999999 38.0 37.2 38.0 32.6 38.0 85-89 35.93285 38.0 37.0 38.0 32.2 38.0 90-94 35.76195 38.0 37.0 38.0 31.0 38.0 95-99 35.7218 38.0 37.0 38.0 31.0 38.0 100-104 35.60635 38.0 36.6 38.0 30.2 38.0 105-109 35.2368 38.0 35.8 38.0 28.6 38.0 110-114 34.97935 38.0 35.6 38.0 27.2 38.0 115-119 34.839999999999996 38.0 35.0 38.0 27.4 38.0 120-124 34.64665 38.0 35.0 38.0 26.2 38.0 125-129 34.57064999999999 38.0 35.0 38.0 25.8 38.0 130-134 34.11815 38.0 34.6 38.0 22.8 38.0 135-139 33.5226 38.0 34.0 38.0 20.2 38.0 140-144 33.03525 38.0 33.4 38.0 18.2 38.0 145-149 32.05815 38.0 31.6 38.0 11.0 38.0 150-151 27.365875000000003 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 3.0 5 1.0 6 1.0 7 2.0 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 2.0 15 3.0 16 5.0 17 3.0 18 5.0 19 8.0 20 7.0 21 4.0 22 7.0 23 17.0 24 15.0 25 19.0 26 30.0 27 38.0 28 52.0 29 40.0 30 69.0 31 96.0 32 132.0 33 175.0 34 227.0 35 378.0 36 747.0 37 1905.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.990995497748877 17.158579289644823 14.082041020510255 36.76838419209605 2 30.275000000000002 21.7 28.925 19.1 3 21.68584292146073 26.988494247123562 27.613806903451728 23.71185592796398 4 26.375 31.324999999999996 20.225 22.075 5 26.281570392598148 33.458364591147784 21.50537634408602 18.754688672168044 6 22.525000000000002 38.15 20.4 18.925 7 22.375 18.65 36.375 22.6 8 23.075000000000003 23.375 26.674999999999997 26.875 9 22.95 21.65 28.549999999999997 26.85 10-14 25.705 26.1 24.345 23.849999999999998 15-19 25.745 26.015 24.715 23.525 20-24 25.369999999999997 25.775 25.005 23.849999999999998 25-29 25.074999999999996 25.795 24.575 24.555 30-34 25.330000000000002 25.374999999999996 25.319999999999997 23.974999999999998 35-39 25.324999999999996 26.340000000000003 24.545 23.79 40-44 25.72 26.075 24.58 23.625 45-49 25.605 25.965 24.875 23.555 50-54 25.509999999999998 25.759999999999998 25.505 23.225 55-59 25.95 25.985000000000003 24.11 23.955000000000002 60-64 25.790000000000003 25.705 24.595 23.91 65-69 25.130000000000003 25.64 25.05 24.18 70-74 25.47 25.385 25.2 23.945 75-79 25.22 25.61 25.06 24.11 80-84 25.355 25.805 25.05 23.79 85-89 25.290000000000003 25.509999999999998 25.83 23.369999999999997 90-94 25.915 25.590000000000003 25.11 23.385 95-99 25.345000000000002 26.040000000000003 25.009999999999998 23.605 100-104 25.36 25.835 24.955 23.849999999999998 105-109 25.71 26.375 24.915000000000003 23.0 110-114 25.64 26.27 25.31 22.78 115-119 25.755 25.905 25.169999999999998 23.169999999999998 120-124 26.284999999999997 25.650000000000002 24.81 23.255 125-129 25.650000000000002 26.290000000000003 24.64 23.419999999999998 130-134 25.77 26.305 24.795 23.13 135-139 25.865 26.615 24.834999999999997 22.685 140-144 25.869999999999997 25.745 25.7 22.685 145-149 26.345000000000002 25.775 25.119999999999997 22.759999999999998 150-151 27.561616414362568 25.84761666458151 24.659076692105593 21.93169022895033 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.5 26 1.5 27 1.0 28 3.5 29 6.0 30 9.0 31 10.5 32 11.5 33 16.5 34 22.0 35 31.5 36 44.5 37 70.0 38 85.5 39 95.0 40 120.0 41 139.5 42 171.0 43 202.0 44 203.5 45 207.0 46 212.5 47 213.5 48 197.0 49 178.5 50 167.5 51 154.5 52 128.5 53 106.0 54 101.0 55 92.5 56 92.0 57 84.0 58 74.0 59 73.5 60 78.0 61 67.5 62 60.0 63 64.5 64 60.5 65 52.5 66 42.5 67 41.5 68 46.5 69 43.0 70 31.5 71 26.5 72 19.0 73 8.0 74 8.0 75 8.0 76 6.5 77 5.0 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.05 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1409802930773 98.1 2 0.6568974229408793 1.3 3 0.202122283981809 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.7875000000000001 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.075 0.0 0.0 0.0 0.0 120-121 1.2 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.7374999999999998 0.0 0.0 0.0 0.0 128-129 1.9875 0.0 0.0 0.0 0.0 130-131 2.2125 0.0 0.0 0.0 0.0 132-133 2.4000000000000004 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 2.95 0.0 0.0 0.0 0.0 138-139 3.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGAAT 10 0.006830828 145.0 1 >>END_MODULE Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159648 spots for SRR6958282.sra Written 1159648 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra Read 1159640 spots for SRR6958282.sra Written 1159640 spots for SRR6958282.sra SRR ids: ['SRR6958282.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__hfe027i SRR6958282.sra spots: 23192808 blocks: [[1, 1159640], [1159641, 2319280], [2319281, 3478920], [3478921, 4638560], [4638561, 5798200], [5798201, 6957840], [6957841, 8117480], [8117481, 9277120], [9277121, 10436760], [10436761, 11596400], [11596401, 12756040], [12756041, 13915680], [13915681, 15075320], [15075321, 16234960], [16234961, 17394600], [17394601, 18554240], [18554241, 19713880], [19713881, 20873520], [20873521, 22033160], [22033161, 23192808]] SRR6958282 file size 7837581 SRR6958282 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958282 SRR6958282_1.fastq SRR6958282_2.fastq Input file: SRR6958282_1.fastq Paired file: SRR6958282_2.fastq trimmed: SRR6958282-trimmed-pair1.fastq, SRR6958282-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:35:28 2024 >> started Fri Dec 6 18:35:54 2024 >> done (25.520s) 23192808 read pairs processed; of these: 9399 ( 0.04%) short read pairs filtered out after trimming by size control 5985 ( 0.03%) empty read pairs filtered out after trimming by size control 23177424 (99.93%) read pairs available; of these: 8361374 (36.08%) trimmed read pairs available after processing 14816050 (63.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 7 0.00% 21 9 0.00% 22 6 0.00% 23 6 0.00% 24 3 0.00% 25 6 0.00% 26 6 0.00% 27 8 0.00% 28 8 0.00% 29 4 0.00% 30 9 0.00% 31 4 0.00% 32 8 0.00% 33 8 0.00% 34 12 0.00% 35 8 0.00% 36 9 0.00% 37 6 0.00% 38 7 0.00% 39 15 0.00% 40 12 0.00% 41 14 0.00% 42 14 0.00% 43 15 0.00% 44 16 0.00% 45 21 0.00% 46 18 0.00% 47 21 0.00% 48 14 0.00% 49 21 0.00% 50 31 0.00% 51 24 0.00% 52 25 0.00% 53 42 0.00% 54 47 0.00% 55 64 0.00% 56 48 0.00% 57 72 0.00% 58 88 0.00% 59 77 0.00% 60 106 0.00% 61 118 0.00% 62 143 0.00% 63 146 0.00% 64 205 0.00% 65 165 0.00% 66 224 0.00% 67 190 0.00% 68 232 0.00% 69 266 0.00% 70 340 0.00% 71 388 0.00% 72 385 0.00% 73 441 0.00% 74 491 0.00% 75 541 0.00% 76 604 0.00% 77 697 0.00% 78 716 0.00% 79 897 0.00% 80 999 0.00% 81 1039 0.00% 82 1257 0.01% 83 1519 0.01% 84 1996 0.01% 85 2488 0.01% 86 2579 0.01% 87 2860 0.01% 88 2997 0.01% 89 3307 0.01% 90 3585 0.02% 91 4063 0.02% 92 3955 0.02% 93 4262 0.02% 94 4962 0.02% 95 5065 0.02% 96 5395 0.02% 97 5901 0.03% 98 6223 0.03% 99 6672 0.03% 100 7235 0.03% 101 7529 0.03% 102 8194 0.04% 103 8956 0.04% 104 9225 0.04% 105 9892 0.04% 106 10677 0.05% 107 11499 0.05% 108 12006 0.05% 109 12723 0.05% 110 13264 0.06% 111 14176 0.06% 112 15307 0.07% 113 16484 0.07% 114 16888 0.07% 115 18667 0.08% 116 19328 0.08% 117 19982 0.09% 118 21450 0.09% 119 22702 0.10% 120 23163 0.10% 121 24832 0.11% 122 25934 0.11% 123 27116 0.12% 124 28880 0.12% 125 30549 0.13% 126 31905 0.14% 127 33944 0.15% 128 35766 0.15% 129 37673 0.16% 130 39658 0.17% 131 42338 0.18% 132 44428 0.19% 133 47737 0.21% 134 50085 0.22% 135 53382 0.23% 136 57071 0.25% 137 61271 0.26% 138 65806 0.28% 139 70945 0.31% 140 77176 0.33% 141 83605 0.36% 142 94412 0.41% 143 107659 0.46% 144 125710 0.54% 145 153326 0.66% 146 197890 0.85% 147 261772 1.13% 148 409978 1.77% 149 872147 3.76% 150 4789778 20.67% 151 14816050 63.92% 23177424 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=22 prefix-density=0.64 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=52.64 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.6 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=26 prefix-density=0.50 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=141.11 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.0 sequence=CCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR6958282 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:36:38 Started mapping on | Dec 06 18:36:39 Finished on | Dec 06 18:38:46 Mapping speed, Million of reads per hour | 657.00 Number of input reads | 23177424 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 22764041 Uniquely mapped reads % | 98.22% Average mapped length | 297.60 Number of splices: Total | 27519717 Number of splices: Annotated (sjdb) | 25981348 Number of splices: GT/AG | 27154276 Number of splices: GC/AG | 322572 Number of splices: AT/AC | 11330 Number of splices: Non-canonical | 31539 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.01% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 194977 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 13330 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 224973 224973 224973 N_multimapping 194977 194977 194977 N_noFeature 776265 22146531 950583 N_ambiguous 533079 2888 91390 UnstrandedReadsAssigned:21454697 PositiveStrandReadsAssigned:614622 NegativeStrandReadsAssigned:21722068 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958282 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958282-trimmed-pair1.fastq SRR6958282-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,177,424 reads, 21,728,008 reads pseudoaligned [quant] estimated average fragment length: 269.171 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52973 SRR6958282.ke.tsv 35125 SRR6958282.se.tsv 88098 total ==> SRR6958282.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.326 0 0 PNS24247 1044 775.829 65.081 5.90988 PNS24249 1928 1659.83 47.3013 2.00771 PNS24246 1044 775.829 65.081 5.90988 PNS24248 1044 775.829 65.081 5.90988 PNS24244 1471 1202.83 11.4558 0.670985 PNS24243 293 80.1255 0 0 KQK14069 1603 1334.83 3345.39 176.568 KQK14071 474 220.078 62.7658 20.0927 ==> SRR6958282.se.tsv <== BRADI_1g14170v3 3838 BRADI_1g53295v3 308 BRADI_1g59795v3 340 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 358 BRADI_1g74790v3 98 BRADI_1g09890v3 0 BRADI_1g77505v3 328 BRADI_1g48960v3 0 SRR6958282 completed mapping pipeline successfully