Starting /dee2/code/volunteer_pipeline.sh SRR6958283 current disk space = 1550252638208 free memory = 1599952348 SRR6958283 SRAfilesize 2f452038c74fb32d99ed2b4345670aae SRR6958283.sra SRR6958283.sra file validated SRR6958283 is paired end SRR6958283 is conventional basespace SRR6958283 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958283_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.94725 30.0 18.0 33.0 18.0 34.0 2 30.389 31.0 29.0 33.0 27.0 34.0 3 32.064 33.0 31.0 33.0 29.0 34.0 4 32.67875 33.0 33.0 34.0 31.0 34.0 5 33.14425 33.0 33.0 34.0 33.0 34.0 6 37.07075 38.0 37.0 38.0 36.0 38.0 7 37.4865 38.0 38.0 38.0 37.0 38.0 8 37.594 38.0 38.0 38.0 38.0 38.0 9 37.649 38.0 38.0 38.0 38.0 38.0 10-14 37.6842 38.0 38.0 38.0 38.0 38.0 15-19 37.621950000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.51115 38.0 38.0 38.0 37.4 38.0 25-29 37.600100000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.55995 38.0 38.0 38.0 37.8 38.0 35-39 37.6625 38.0 38.0 38.0 38.0 38.0 40-44 37.66355 38.0 38.0 38.0 38.0 38.0 45-49 37.602850000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.43925 38.0 38.0 38.0 37.2 38.0 55-59 37.40325 38.0 38.0 38.0 37.0 38.0 60-64 37.41275 38.0 38.0 38.0 37.0 38.0 65-69 37.33775 38.0 38.0 38.0 37.0 38.0 70-74 37.270300000000006 38.0 38.0 38.0 36.6 38.0 75-79 36.967499999999994 38.0 38.0 38.0 35.6 38.0 80-84 35.8154 38.0 36.0 38.0 29.8 38.0 85-89 37.0503 38.0 38.0 38.0 35.8 38.0 90-94 36.94755 38.0 38.0 38.0 35.2 38.0 95-99 36.8181 38.0 38.0 38.0 35.0 38.0 100-104 36.6884 38.0 38.0 38.0 34.8 38.0 105-109 36.6594 38.0 38.0 38.0 34.2 38.0 110-114 36.5541 38.0 38.0 38.0 34.0 38.0 115-119 36.3551 38.0 37.8 38.0 33.8 38.0 120-124 36.0766 38.0 37.2 38.0 33.0 38.0 125-129 35.94185 38.0 36.6 38.0 32.8 38.0 130-134 35.7447 38.0 36.0 38.0 31.6 38.0 135-139 35.5135 38.0 36.0 38.0 31.0 38.0 140-144 35.1491 38.0 35.4 38.0 30.2 38.0 145-149 34.60385 38.0 35.6 38.0 28.4 38.0 150-151 29.916375000000002 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 3.0 20 2.0 21 4.0 22 2.0 23 5.0 24 6.0 25 7.0 26 6.0 27 9.0 28 13.0 29 21.0 30 23.0 31 35.0 32 65.0 33 82.0 34 158.0 35 311.0 36 814.0 37 2431.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.25848563968668 9.556135770234988 7.336814621409922 35.84856396866841 2 25.5 12.8 34.1 27.6 3 21.224999999999998 17.424999999999997 23.9 37.45 4 26.700000000000003 25.474999999999998 21.175 26.650000000000002 5 25.974999999999998 30.075000000000003 23.3 20.65 6 21.275 34.449999999999996 22.375 21.9 7 16.875 24.925 41.5 16.7 8 20.175 25.6 30.175 24.05 9 19.975 21.925 33.4 24.7 10-14 22.7 26.605 26.88 23.815 15-19 23.0 26.495 26.534999999999997 23.97 20-24 22.61 26.685 26.815 23.89 25-29 22.28 26.650000000000002 26.505000000000003 24.565 30-34 22.994999999999997 26.51 26.779999999999998 23.715 35-39 22.415 26.57 26.815 24.2 40-44 23.44 26.240000000000002 26.32 24.0 45-49 23.105 26.63 25.83 24.435000000000002 50-54 22.675 26.700000000000003 26.645000000000003 23.98 55-59 22.74 26.384999999999998 26.51 24.365000000000002 60-64 22.485 25.895000000000003 26.33 25.290000000000003 65-69 22.575 26.06 26.575 24.79 70-74 22.264999999999997 26.529999999999998 26.875 24.33 75-79 22.605 25.95 26.97 24.474999999999998 80-84 22.455 26.085 26.75 24.709999999999997 85-89 23.225 26.655 25.91 24.21 90-94 22.770000000000003 26.55 25.919999999999998 24.759999999999998 95-99 22.759999999999998 26.174999999999997 26.555 24.51 100-104 22.909581916383274 26.57031406281256 26.390278055611123 24.12982596519304 105-109 23.51 26.075 26.325 24.09 110-114 22.89 26.314999999999998 26.38 24.415 115-119 23.315 27.0 25.674999999999997 24.01 120-124 23.25 25.990000000000002 26.13 24.63 125-129 22.814999999999998 26.8 25.585 24.8 130-134 22.555 26.025 25.8 25.619999999999997 135-139 23.305 26.755000000000003 25.41 24.529999999999998 140-144 22.884999999999998 26.52 25.790000000000003 24.805 145-149 22.63 27.089999999999996 24.825 25.455 150-151 23.200000000000003 26.5625 25.3 24.9375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 4.0 27 5.5 28 5.5 29 12.0 30 15.0 31 15.5 32 16.0 33 24.5 34 36.5 35 43.5 36 61.5 37 76.5 38 92.0 39 124.5 40 145.0 41 163.0 42 201.5 43 240.0 44 244.0 45 232.5 46 215.0 47 199.0 48 195.0 49 174.0 50 157.5 51 155.5 52 144.0 53 118.5 54 101.0 55 89.5 56 77.5 57 65.5 58 57.5 59 60.5 60 53.0 61 51.0 62 49.5 63 38.0 64 38.0 65 35.0 66 27.0 67 28.0 68 26.0 69 20.5 70 18.0 71 12.5 72 10.0 73 7.5 74 5.5 75 4.5 76 2.5 77 1.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.9500000000000002 0.0 0.0 0.0 0.0 110-111 2.0875 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.7874999999999996 0.0 0.0 0.0 0.0 116-117 3.2249999999999996 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 4.025 0.0 0.0 0.0 0.0 122-123 4.5 0.0 0.0 0.0 0.0 124-125 5.025 0.0 0.0 0.0 0.0 126-127 5.4625 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.425 0.0 0.0 0.0 0.0 132-133 7.125 0.0 0.0 0.0 0.0 134-135 7.675 0.0 0.0 0.0 0.0 136-137 8.4875 0.0 0.0 0.0 0.0 138-139 9.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCTC 10 0.0068378756 144.95 2 TCAATGC 10 0.0068378756 144.95 3 >>END_MODULE SRR6958283 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958283_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.25175 33.0 33.0 34.0 33.0 34.0 2 33.30875 34.0 33.0 34.0 33.0 34.0 3 33.333 34.0 33.0 34.0 33.0 34.0 4 33.349 34.0 33.0 34.0 33.0 34.0 5 33.34575 34.0 33.0 34.0 33.0 34.0 6 37.5665 38.0 38.0 38.0 38.0 38.0 7 37.55225 38.0 38.0 38.0 38.0 38.0 8 37.4935 38.0 38.0 38.0 38.0 38.0 9 37.5265 38.0 38.0 38.0 38.0 38.0 10-14 37.5354 38.0 38.0 38.0 38.0 38.0 15-19 36.310849999999995 38.0 36.8 38.0 31.4 38.0 20-24 36.23355 38.0 36.8 38.0 30.4 38.0 25-29 37.37415 38.0 38.0 38.0 37.4 38.0 30-34 37.556050000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.48460000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.51655 38.0 38.0 38.0 38.0 38.0 45-49 37.5009 38.0 38.0 38.0 38.0 38.0 50-54 37.3686 38.0 38.0 38.0 37.6 38.0 55-59 37.3523 38.0 38.0 38.0 38.0 38.0 60-64 37.34085 38.0 38.0 38.0 38.0 38.0 65-69 37.2946 38.0 38.0 38.0 37.4 38.0 70-74 37.267199999999995 38.0 38.0 38.0 37.2 38.0 75-79 37.267500000000005 38.0 38.0 38.0 37.2 38.0 80-84 37.134350000000005 38.0 38.0 38.0 37.0 38.0 85-89 37.12295 38.0 38.0 38.0 37.0 38.0 90-94 35.848749999999995 38.0 36.8 38.0 30.0 38.0 95-99 34.28625 37.8 33.0 38.0 23.2 38.0 100-104 34.48235 37.8 33.2 38.0 26.8 38.0 105-109 36.60175 38.0 38.0 38.0 34.6 38.0 110-114 36.408100000000005 38.0 38.0 38.0 33.6 38.0 115-119 35.69445 38.0 37.2 38.0 30.2 38.0 120-124 35.56315 38.0 37.0 38.0 30.2 38.0 125-129 35.670849999999994 38.0 37.0 38.0 31.6 38.0 130-134 33.705799999999996 37.6 31.6 38.0 25.0 38.0 135-139 34.40385 38.0 34.8 38.0 25.4 38.0 140-144 34.01695 38.0 34.2 38.0 23.4 38.0 145-149 34.1681 38.0 35.0 38.0 25.8 38.0 150-151 29.673250000000003 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 2.0 10 1.0 11 0.0 12 1.0 13 6.0 14 3.0 15 3.0 16 4.0 17 2.0 18 1.0 19 5.0 20 2.0 21 3.0 22 7.0 23 6.0 24 7.0 25 12.0 26 11.0 27 12.0 28 20.0 29 23.0 30 34.0 31 45.0 32 66.0 33 81.0 34 173.0 35 357.0 36 1073.0 37 2036.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.75 20.674999999999997 11.175 28.4 2 32.300000000000004 24.675 26.55 16.475 3 22.375 25.95 28.799999999999997 22.875 4 25.3 34.025 20.875 19.8 5 26.700000000000003 33.625 20.525 19.15 6 22.375 36.9 21.675 19.05 7 21.4 19.575 37.1 21.925 8 22.900000000000002 24.7 25.074999999999996 27.325 9 23.05 22.275 29.849999999999998 24.825 10-14 25.1 27.045 24.759999999999998 23.095 15-19 24.665 26.435 25.424999999999997 23.474999999999998 20-24 24.63 27.205000000000002 25.324999999999996 22.84 25-29 24.959999999999997 26.88 25.509999999999998 22.650000000000002 30-34 24.505 26.02 25.75 23.724999999999998 35-39 24.529999999999998 26.265 25.785000000000004 23.419999999999998 40-44 25.16 25.790000000000003 25.445 23.605 45-49 24.195 27.015 25.8 22.99 50-54 24.902373085010513 26.449384199459296 25.76349254030239 22.884750175227797 55-59 25.04258943781942 26.686040685439423 25.48852590439924 22.78284397234192 60-64 24.609218436873746 26.54809619238477 25.90681362725451 22.935871743486974 65-69 24.70711925503154 25.80855111645139 26.389306097927307 23.095023530589767 70-74 24.870985520316648 26.0083170499524 25.923142442006114 23.197554987724835 75-79 24.426525092657517 26.094360412701594 26.149454071922268 23.32966042271862 80-84 24.298175255664727 26.58913174253058 25.942450370964508 23.170242630840185 85-89 25.05136557253821 26.730142821348036 25.367075920821847 22.851415685291908 90-94 24.72213878041454 26.07389606488435 26.29918894562932 22.90477620907179 95-99 24.202833258246983 26.535515843219702 26.300245282074385 22.961405616458926 100-104 25.0100120144173 26.661994393271925 25.861033239887867 22.46696035242291 105-109 25.225315441618267 27.26817544562387 25.110154215902263 22.3963548968556 110-114 25.461734821562644 26.63796986836178 25.73702387506882 22.163271435006756 115-119 25.987682139101697 26.097841870712536 25.81743528115768 22.09704070902809 120-124 25.957063503978382 27.007956763248764 25.031276585097334 22.003703147675523 125-129 25.72072072072072 26.746746746746748 25.55055055055055 21.98198198198198 130-134 25.60152068430794 27.152218498324242 25.141313591116006 22.104947226251813 135-139 26.141826923076923 26.79286858974359 25.796274038461537 21.26903044871795 140-144 26.10590651770953 27.13791894193678 25.239216472120635 21.516958068233055 145-149 26.05711422845691 27.119238476953907 25.495991983967937 21.327655310621243 150-151 26.97318967677274 26.8479077925332 25.35705337008269 20.821849160611375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 4.0 25 3.0 26 1.5 27 4.5 28 6.0 29 6.5 30 10.0 31 12.0 32 19.5 33 26.0 34 29.5 35 40.0 36 57.0 37 79.0 38 96.0 39 127.0 40 151.0 41 164.5 42 199.5 43 210.5 44 205.0 45 198.5 46 210.5 47 213.5 48 189.0 49 183.5 50 180.5 51 164.5 52 136.5 53 103.5 54 87.0 55 90.5 56 92.5 57 89.5 58 74.0 59 61.0 60 59.0 61 53.0 62 48.5 63 45.5 64 38.5 65 40.0 66 40.5 67 31.5 68 23.0 69 21.0 70 22.0 71 15.5 72 9.5 73 7.5 74 4.0 75 4.0 76 4.0 77 2.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.13 55-59 0.21 60-64 0.2 65-69 0.13 70-74 0.20500000000000002 75-79 0.16999999999999998 80-84 0.26 85-89 0.22499999999999998 90-94 0.13 95-99 0.11499999999999999 100-104 0.12 105-109 0.13999999999999999 110-114 0.105 115-119 0.145 120-124 0.08499999999999999 125-129 0.1 130-134 0.045 135-139 0.16 140-144 0.19499999999999998 145-149 0.2 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39363314805458 98.35000000000001 2 0.37897928246589185 0.75 3 0.1010611419909045 0.3 4 0.07579585649317837 0.3 5 0.025265285497726126 0.125 6 0.0 0.0 7 0.025265285497726126 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 7 0.17500000000000002 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.1500000000000004 0.0 0.0 0.0 0.0 120-121 3.5374999999999996 0.0 0.0 0.0 0.0 122-123 3.975 0.0 0.0 0.0 0.0 124-125 4.449999999999999 0.0 0.0 0.0 0.0 126-127 4.8375 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.675 0.0 0.0 0.0 0.0 132-133 6.3875 0.0 0.0 0.0 0.0 134-135 6.925 0.0 0.0 0.0 0.0 136-137 7.699999999999999 0.0 0.0 0.0 0.0 138-139 8.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTGTC 10 0.0068555363 144.825 4 GCTGTCA 10 0.0068555363 144.825 5 >>END_MODULE Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701127 spots for SRR6958283.sra Written 701127 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra Read 701122 spots for SRR6958283.sra Written 701122 spots for SRR6958283.sra SRR ids: ['SRR6958283.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_twjcm79n SRR6958283.sra spots: 14022445 blocks: [[1, 701122], [701123, 1402244], [1402245, 2103366], [2103367, 2804488], [2804489, 3505610], [3505611, 4206732], [4206733, 4907854], [4907855, 5608976], [5608977, 6310098], [6310099, 7011220], [7011221, 7712342], [7712343, 8413464], [8413465, 9114586], [9114587, 9815708], [9815709, 10516830], [10516831, 11217952], [11217953, 11919074], [11919075, 12620196], [12620197, 13321318], [13321319, 14022445]] SRR6958283 file size 4730046 SRR6958283 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958283 SRR6958283_1.fastq SRR6958283_2.fastq Input file: SRR6958283_1.fastq Paired file: SRR6958283_2.fastq trimmed: SRR6958283-trimmed-pair1.fastq, SRR6958283-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:41:14 2024 >> started Fri Dec 6 18:41:29 2024 >> done (15.622s) 14022445 read pairs processed; of these: 5507 ( 0.04%) short read pairs filtered out after trimming by size control 9148 ( 0.07%) empty read pairs filtered out after trimming by size control 14007790 (99.90%) read pairs available; of these: 8117208 (57.95%) trimmed read pairs available after processing 5890582 (42.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 3 0.00% 21 4 0.00% 22 9 0.00% 23 14 0.00% 24 8 0.00% 25 8 0.00% 26 6 0.00% 27 8 0.00% 28 9 0.00% 29 8 0.00% 30 11 0.00% 31 11 0.00% 32 12 0.00% 33 11 0.00% 34 10 0.00% 35 11 0.00% 36 11 0.00% 37 12 0.00% 38 17 0.00% 39 16 0.00% 40 14 0.00% 41 30 0.00% 42 23 0.00% 43 34 0.00% 44 35 0.00% 45 34 0.00% 46 34 0.00% 47 41 0.00% 48 42 0.00% 49 65 0.00% 50 55 0.00% 51 56 0.00% 52 87 0.00% 53 85 0.00% 54 83 0.00% 55 105 0.00% 56 94 0.00% 57 134 0.00% 58 158 0.00% 59 162 0.00% 60 178 0.00% 61 208 0.00% 62 254 0.00% 63 253 0.00% 64 291 0.00% 65 340 0.00% 66 343 0.00% 67 436 0.00% 68 507 0.00% 69 519 0.00% 70 608 0.00% 71 771 0.01% 72 866 0.01% 73 967 0.01% 74 1178 0.01% 75 1377 0.01% 76 1454 0.01% 77 1565 0.01% 78 1601 0.01% 79 2018 0.01% 80 2299 0.02% 81 2362 0.02% 82 2616 0.02% 83 2920 0.02% 84 3481 0.02% 85 4014 0.03% 86 4438 0.03% 87 4734 0.03% 88 5248 0.04% 89 5628 0.04% 90 6134 0.04% 91 6690 0.05% 92 7305 0.05% 93 7845 0.06% 94 8751 0.06% 95 9673 0.07% 96 10163 0.07% 97 11248 0.08% 98 12111 0.09% 99 13778 0.10% 100 17828 0.13% 101 18826 0.13% 102 14500 0.10% 103 15603 0.11% 104 16784 0.12% 105 17312 0.12% 106 18604 0.13% 107 19559 0.14% 108 20661 0.15% 109 21344 0.15% 110 22755 0.16% 111 23770 0.17% 112 25078 0.18% 113 26007 0.19% 114 27794 0.20% 115 29287 0.21% 116 30659 0.22% 117 31693 0.23% 118 32986 0.24% 119 33883 0.24% 120 35399 0.25% 121 36889 0.26% 122 38326 0.27% 123 39800 0.28% 124 42011 0.30% 125 44359 0.32% 126 45968 0.33% 127 47991 0.34% 128 48842 0.35% 129 51223 0.37% 130 53902 0.38% 131 55220 0.39% 132 57980 0.41% 133 60733 0.43% 134 63258 0.45% 135 67852 0.48% 136 71201 0.51% 137 74496 0.53% 138 79259 0.57% 139 84834 0.61% 140 92063 0.66% 141 100752 0.72% 142 110623 0.79% 143 123694 0.88% 144 142883 1.02% 145 172960 1.23% 146 216207 1.54% 147 293579 2.10% 148 431280 3.08% 149 835371 5.96% 150 3884567 27.73% 151 5890582 42.05% 14007790 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=4.23 fanout-score-rank=16 prefix-density=0.67 prefix-fanout=3.2 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=66.32 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=24 prefix-density=0.38 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=203.03 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=7.2 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958283 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:42:14 Started mapping on | Dec 06 18:42:15 Finished on | Dec 06 18:43:23 Mapping speed, Million of reads per hour | 741.59 Number of input reads | 14007790 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13734117 Uniquely mapped reads % | 98.05% Average mapped length | 292.45 Number of splices: Total | 15479683 Number of splices: Annotated (sjdb) | 14518731 Number of splices: GT/AG | 15268994 Number of splices: GC/AG | 182188 Number of splices: AT/AC | 6395 Number of splices: Non-canonical | 22106 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.01% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 135123 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 6371 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.70% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 143208 143208 143208 N_multimapping 135123 135123 135123 N_noFeature 607847 13331567 754063 N_ambiguous 310143 1833 54535 UnstrandedReadsAssigned:12816127 PositiveStrandReadsAssigned:400717 NegativeStrandReadsAssigned:12925519 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958283 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958283-trimmed-pair1.fastq SRR6958283-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,007,790 reads, 12,954,129 reads pseudoaligned [quant] estimated average fragment length: 229.445 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR6958283.ke.tsv 35125 SRR6958283.se.tsv 88098 total ==> SRR6958283.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.95 0 0 PNS24247 1044 815.555 38.9554 5.67163 PNS24249 1928 1699.55 28.2458 1.97339 PNS24246 1044 815.555 38.9554 5.67163 PNS24248 1044 815.555 38.9554 5.67163 PNS24244 1471 1242.55 27.8879 2.66498 PNS24243 293 97.9177 0 0 KQK14069 1603 1374.55 1976.97 170.778 KQK14071 474 251.673 59.4967 28.0705 ==> SRR6958283.se.tsv <== BRADI_1g14170v3 2395 BRADI_1g53295v3 230 BRADI_1g59795v3 446 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 272 BRADI_1g74790v3 80 BRADI_1g09890v3 0 BRADI_1g77505v3 242 BRADI_1g48960v3 0 SRR6958283 completed mapping pipeline successfully