Starting /dee2/code/volunteer_pipeline.sh SRR6958284 current disk space = 1550182940672 free memory = 1601695788 SRR6958284 SRAfilesize d29245f5bf49eb35ef485469e98fe2f1 SRR6958284.sra SRR6958284.sra file validated SRR6958284 is paired end SRR6958284 is conventional basespace SRR6958284 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958284_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.7105 25.0 18.0 32.0 18.0 33.0 2 23.55675 25.0 18.0 28.0 18.0 31.0 3 28.09325 29.0 27.0 31.0 25.0 33.0 4 30.6635 31.0 29.0 33.0 27.0 33.0 5 31.77225 33.0 31.0 33.0 29.0 33.0 6 35.75475 37.0 36.0 38.0 31.0 38.0 7 36.61275 38.0 37.0 38.0 34.0 38.0 8 37.17425 38.0 38.0 38.0 36.0 38.0 9 37.4095 38.0 38.0 38.0 37.0 38.0 10-14 37.1048 38.0 38.0 38.0 35.6 38.0 15-19 37.45525 38.0 38.0 38.0 37.2 38.0 20-24 37.5735 38.0 38.0 38.0 37.8 38.0 25-29 37.60865 38.0 38.0 38.0 38.0 38.0 30-34 37.58239999999999 38.0 38.0 38.0 37.8 38.0 35-39 37.47240000000001 38.0 38.0 38.0 37.4 38.0 40-44 37.63805 38.0 38.0 38.0 38.0 38.0 45-49 37.47279999999999 38.0 38.0 38.0 37.6 38.0 50-54 37.47315 38.0 38.0 38.0 37.4 38.0 55-59 37.3209 38.0 38.0 38.0 36.8 38.0 60-64 37.46315 38.0 38.0 38.0 37.2 38.0 65-69 37.21835 38.0 38.0 38.0 36.4 38.0 70-74 37.242149999999995 38.0 38.0 38.0 36.6 38.0 75-79 37.01415000000001 38.0 38.0 38.0 35.6 38.0 80-84 37.2946 38.0 38.0 38.0 36.6 38.0 85-89 37.2826 38.0 38.0 38.0 36.4 38.0 90-94 37.14675 38.0 38.0 38.0 36.0 38.0 95-99 37.0678 38.0 38.0 38.0 35.8 38.0 100-104 36.966950000000004 38.0 38.0 38.0 35.6 38.0 105-109 36.7724 38.0 38.0 38.0 34.8 38.0 110-114 36.67014999999999 38.0 38.0 38.0 34.2 38.0 115-119 36.4842 38.0 38.0 38.0 34.0 38.0 120-124 36.3524 38.0 37.4 38.0 33.8 38.0 125-129 36.2741 38.0 37.8 38.0 33.6 38.0 130-134 36.067600000000006 38.0 36.8 38.0 32.4 38.0 135-139 35.2611 38.0 35.6 38.0 28.8 38.0 140-144 32.8908 36.8 30.0 38.0 21.2 38.0 145-149 34.60850000000001 38.0 34.0 38.0 29.2 38.0 150-151 29.9425 35.5 27.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 2.0 20 1.0 21 1.0 22 3.0 23 3.0 24 1.0 25 8.0 26 5.0 27 11.0 28 13.0 29 18.0 30 26.0 31 35.0 32 60.0 33 96.0 34 159.0 35 379.0 36 1173.0 37 2003.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.412371134020617 21.185567010309278 8.015463917525773 45.38659793814433 2 18.0 16.7 35.25 30.049999999999997 3 21.224999999999998 17.125 23.775 37.875 4 27.1 22.625 22.425 27.85 5 26.125 29.775000000000002 22.425 21.675 6 21.65 32.5 24.2 21.65 7 16.525000000000002 26.200000000000003 39.725 17.549999999999997 8 19.025 24.725 30.375000000000004 25.874999999999996 9 18.025 23.0 34.875 24.099999999999998 10-14 21.605 27.49 26.584999999999997 24.32 15-19 22.235 26.21 27.375 24.18 20-24 21.987198719871987 26.48264826482648 27.19271927192719 24.337433743374337 25-29 22.509999999999998 27.055 26.685 23.75 30-34 22.52 26.384999999999998 26.479999999999997 24.615000000000002 35-39 22.105 26.229999999999997 26.905 24.759999999999998 40-44 22.465 26.56 26.77 24.205 45-49 22.605 27.04 26.0 24.355 50-54 22.105 26.700000000000003 27.139999999999997 24.055 55-59 22.485 26.33 26.57 24.615000000000002 60-64 21.94 26.490000000000002 26.619999999999997 24.95 65-69 22.13 26.534999999999997 26.775 24.560000000000002 70-74 22.15 26.465 26.950000000000003 24.435000000000002 75-79 22.61 26.369999999999997 26.72 24.3 80-84 23.005 25.935000000000002 26.534999999999997 24.525 85-89 23.0 25.990000000000002 26.365 24.645 90-94 22.685 26.009999999999998 26.805 24.5 95-99 22.61 26.795 26.174999999999997 24.42 100-104 22.716135806790337 26.356317815890794 26.241312065603278 24.686234311715584 105-109 22.845 26.41 26.5 24.245 110-114 23.2161608080404 27.231361568078405 26.336316815840792 23.2161608080404 115-119 22.898739243546128 26.620972583550127 25.94056433860316 24.53972383430058 120-124 22.935 26.334999999999997 25.924999999999997 24.805 125-129 22.89247096515819 26.471766119343208 25.545654785742894 25.090108129755706 130-134 22.255 26.834999999999997 25.874999999999996 25.035 135-139 22.55 26.445 25.635 25.369999999999997 140-144 22.39 26.669999999999998 25.585 25.355 145-149 22.650000000000002 26.44 25.455 25.455 150-151 21.987499999999997 26.437500000000004 25.5375 26.0375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 3.5 28 6.0 29 10.0 30 15.0 31 16.0 32 20.0 33 31.5 34 33.0 35 44.5 36 69.0 37 84.0 38 110.0 39 136.0 40 150.5 41 168.5 42 202.0 43 234.5 44 227.5 45 227.5 46 228.0 47 214.0 48 208.5 49 181.5 50 163.0 51 150.5 52 120.5 53 103.0 54 92.0 55 86.0 56 85.0 57 79.5 58 67.5 59 57.5 60 51.5 61 38.5 62 35.5 63 38.0 64 36.0 65 31.0 66 25.0 67 22.5 68 16.5 69 14.5 70 16.0 71 11.0 72 10.0 73 7.0 74 4.0 75 3.5 76 2.0 77 2.0 78 2.0 79 1.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.005 115-119 0.06 120-124 0.0 125-129 0.12 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.30000000000000004 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.5375 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 0.8875 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3875 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.8125 0.0 0.0 0.0 0.0 104-105 2.1375 0.0 0.0 0.0 0.0 106-107 2.4875 0.0 0.0 0.0 0.0 108-109 2.925 0.0 0.0 0.0 0.0 110-111 3.2 0.0 0.0 0.0 0.0 112-113 3.625 0.0 0.0 0.0 0.0 114-115 4.1375 0.0 0.0 0.0 0.0 116-117 4.6875 0.0 0.0 0.0 0.0 118-119 5.2625 0.0 0.0 0.0 0.0 120-121 5.862500000000001 0.0 0.0 0.0 0.0 122-123 6.512499999999999 0.0 0.0 0.0 0.0 124-125 7.1125 0.0 0.0 0.0 0.0 126-127 7.75 0.0 0.0 0.0 0.0 128-129 8.45 0.0 0.0 0.0 0.0 130-131 9.162500000000001 0.0 0.0 0.0 0.0 132-133 9.9125 0.0 0.0 0.0 0.0 134-135 10.6375 0.0 0.0 0.0 0.0 136-137 11.275 0.0 0.0 0.0 0.0 138-139 12.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGCGC 10 0.0068573058 144.8125 145 >>END_MODULE SRR6958284 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958284_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2275 33.0 33.0 34.0 33.0 34.0 2 33.30725 34.0 33.0 34.0 33.0 34.0 3 33.358 34.0 33.0 34.0 33.0 34.0 4 33.35275 34.0 33.0 34.0 33.0 34.0 5 33.3605 34.0 33.0 34.0 33.0 34.0 6 37.54475 38.0 38.0 38.0 38.0 38.0 7 37.6255 38.0 38.0 38.0 38.0 38.0 8 37.545 38.0 38.0 38.0 38.0 38.0 9 37.554 38.0 38.0 38.0 38.0 38.0 10-14 37.036249999999995 38.0 38.0 38.0 35.4 38.0 15-19 36.721000000000004 38.0 37.6 38.0 34.0 38.0 20-24 37.452349999999996 38.0 38.0 38.0 37.6 38.0 25-29 37.54025 38.0 38.0 38.0 38.0 38.0 30-34 37.59245 38.0 38.0 38.0 38.0 38.0 35-39 36.78995 38.0 37.8 38.0 34.4 38.0 40-44 37.485350000000004 38.0 38.0 38.0 37.8 38.0 45-49 37.49915 38.0 38.0 38.0 37.8 38.0 50-54 37.4765 38.0 38.0 38.0 38.0 38.0 55-59 37.50205 38.0 38.0 38.0 38.0 38.0 60-64 37.40375 38.0 38.0 38.0 37.6 38.0 65-69 37.366350000000004 38.0 38.0 38.0 37.2 38.0 70-74 37.34905 38.0 38.0 38.0 37.2 38.0 75-79 37.350249999999996 38.0 38.0 38.0 37.0 38.0 80-84 36.638549999999995 38.0 37.4 38.0 32.6 38.0 85-89 36.812 38.0 37.8 38.0 34.4 38.0 90-94 36.197649999999996 38.0 37.4 38.0 31.0 38.0 95-99 34.82485 37.8 34.4 38.0 24.0 38.0 100-104 35.7575 38.0 36.4 38.0 29.0 38.0 105-109 36.662200000000006 38.0 38.0 38.0 34.6 38.0 110-114 36.67145000000001 38.0 38.0 38.0 34.2 38.0 115-119 36.439299999999996 38.0 38.0 38.0 33.0 38.0 120-124 36.16785 38.0 38.0 38.0 33.0 38.0 125-129 33.88565 38.0 33.2 38.0 22.6 38.0 130-134 35.704100000000004 38.0 37.6 38.0 31.8 38.0 135-139 35.10435 38.0 36.0 38.0 28.4 38.0 140-144 33.405649999999994 37.6 32.4 38.0 23.2 38.0 145-149 28.650299999999998 35.2 20.2 38.0 6.0 38.0 150-151 19.022 16.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 2.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 1.0 19 3.0 20 3.0 21 9.0 22 5.0 23 1.0 24 3.0 25 6.0 26 13.0 27 21.0 28 13.0 29 32.0 30 39.0 31 65.0 32 78.0 33 123.0 34 227.0 35 504.0 36 1298.0 37 1545.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.875 18.425 12.15 33.550000000000004 2 28.625 24.55 29.5 17.325 3 22.05 25.650000000000002 29.625 22.675 4 26.775 30.65 20.775 21.8 5 27.224999999999998 33.5 20.65 18.625 6 22.55 38.3 20.025000000000002 19.125 7 22.05 21.075 36.7 20.175 8 24.275 24.099999999999998 25.224999999999998 26.400000000000002 9 24.075 22.5 28.7 24.725 10-14 25.040000000000003 27.47 24.185000000000002 23.305 15-19 24.87 26.39 25.369999999999997 23.369999999999997 20-24 24.525 26.85 25.885 22.74 25-29 25.014999999999997 26.724999999999998 25.145 23.115 30-34 24.63 26.61 25.7 23.06 35-39 24.310000000000002 26.284999999999997 26.085 23.32 40-44 24.385 26.384999999999998 26.290000000000003 22.939999999999998 45-49 25.095 26.57 25.7 22.634999999999998 50-54 24.565 26.47 26.484999999999996 22.48 55-59 24.79 26.369999999999997 25.605 23.235 60-64 24.135 26.36 25.965 23.54 65-69 25.005 26.61 25.61 22.775000000000002 70-74 24.915000000000003 26.75 25.97 22.365 75-79 24.32 26.77 25.679999999999996 23.23 80-84 25.025 26.474999999999998 25.974999999999998 22.525000000000002 85-89 24.59 25.869999999999997 26.605 22.935 90-94 24.715 26.555 26.150000000000002 22.58 95-99 24.7 26.75 26.525 22.025 100-104 25.169999999999998 26.19 26.125 22.515 105-109 24.89 26.305 26.07 22.735 110-114 25.240000000000002 27.41 25.465 21.884999999999998 115-119 25.415 27.529999999999998 25.035 22.02 120-124 25.515 27.305 25.41 21.77 125-129 25.935000000000002 27.505000000000003 24.685000000000002 21.875 130-134 25.97 27.089999999999996 25.16 21.78 135-139 25.965 27.089999999999996 25.580000000000002 21.365000000000002 140-144 26.755000000000003 26.85 25.435000000000002 20.96 145-149 26.825 26.290000000000003 25.779999999999998 21.105 150-151 26.437500000000004 26.787499999999998 25.1875 21.587500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 2.5 26 2.0 27 2.0 28 3.0 29 5.5 30 10.5 31 18.5 32 23.0 33 26.0 34 26.5 35 34.5 36 55.5 37 72.0 38 102.5 39 128.5 40 145.5 41 183.5 42 204.0 43 197.0 44 194.0 45 203.0 46 217.0 47 224.0 48 211.0 49 190.5 50 166.0 51 146.5 52 132.5 53 118.0 54 106.0 55 95.5 56 92.0 57 86.5 58 72.5 59 66.5 60 60.5 61 53.0 62 49.0 63 41.5 64 43.0 65 36.0 66 29.5 67 27.5 68 19.5 69 15.5 70 17.0 71 14.0 72 9.0 73 7.5 74 4.5 75 2.0 76 2.0 77 2.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26749179085628 98.25 2 0.5809547865622632 1.15 3 0.10103561505430665 0.3 4 0.0 0.0 5 0.0 0.0 6 0.050517807527153326 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.8999999999999999 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2375 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.6375000000000002 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.2874999999999996 0.0 0.0 0.0 0.0 108-109 2.7249999999999996 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.45 0.0 0.0 0.0 0.0 114-115 3.925 0.0 0.0 0.0 0.0 116-117 4.425000000000001 0.0 0.0 0.0 0.0 118-119 4.9375 0.0 0.0 0.0 0.0 120-121 5.525 0.0 0.0 0.0 0.0 122-123 6.137499999999999 0.0 0.0 0.0 0.0 124-125 6.725 0.0 0.0 0.0 0.0 126-127 7.375 0.0 0.0 0.0 0.0 128-129 8.075 0.0 0.0 0.0 0.0 130-131 8.8375 0.0 0.0 0.0 0.0 132-133 9.7 0.0 0.0 0.0 0.0 134-135 10.4 0.0 0.0 0.0 0.0 136-137 10.962499999999999 0.0 0.0 0.0 0.0 138-139 11.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596385 spots for SRR6958284.sra Written 596385 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra Read 596369 spots for SRR6958284.sra Written 596369 spots for SRR6958284.sra SRR ids: ['SRR6958284.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vtjngqjb SRR6958284.sra spots: 11927396 blocks: [[1, 596369], [596370, 1192738], [1192739, 1789107], [1789108, 2385476], [2385477, 2981845], [2981846, 3578214], [3578215, 4174583], [4174584, 4770952], [4770953, 5367321], [5367322, 5963690], [5963691, 6560059], [6560060, 7156428], [7156429, 7752797], [7752798, 8349166], [8349167, 8945535], [8945536, 9541904], [9541905, 10138273], [10138274, 10734642], [10734643, 11331011], [11331012, 11927396]] SRR6958284 file size 4020102 SRR6958284 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958284 SRR6958284_1.fastq SRR6958284_2.fastq Input file: SRR6958284_1.fastq Paired file: SRR6958284_2.fastq trimmed: SRR6958284-trimmed-pair1.fastq, SRR6958284-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:46:42 2024 >> started Fri Dec 6 18:46:57 2024 >> done (15.109s) 11927396 read pairs processed; of these: 4395 ( 0.04%) short read pairs filtered out after trimming by size control 7161 ( 0.06%) empty read pairs filtered out after trimming by size control 11915840 (99.90%) read pairs available; of these: 5193237 (43.58%) trimmed read pairs available after processing 6722603 (56.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 4 0.00% 21 3 0.00% 22 7 0.00% 23 5 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 11 0.00% 28 6 0.00% 29 7 0.00% 30 15 0.00% 31 13 0.00% 32 9 0.00% 33 11 0.00% 34 8 0.00% 35 11 0.00% 36 18 0.00% 37 15 0.00% 38 23 0.00% 39 21 0.00% 40 18 0.00% 41 19 0.00% 42 24 0.00% 43 27 0.00% 44 29 0.00% 45 30 0.00% 46 34 0.00% 47 41 0.00% 48 47 0.00% 49 50 0.00% 50 77 0.00% 51 77 0.00% 52 79 0.00% 53 78 0.00% 54 90 0.00% 55 105 0.00% 56 120 0.00% 57 128 0.00% 58 163 0.00% 59 193 0.00% 60 205 0.00% 61 243 0.00% 62 302 0.00% 63 282 0.00% 64 358 0.00% 65 393 0.00% 66 413 0.00% 67 518 0.00% 68 553 0.00% 69 636 0.01% 70 781 0.01% 71 842 0.01% 72 939 0.01% 73 1071 0.01% 74 1240 0.01% 75 1343 0.01% 76 1666 0.01% 77 1772 0.01% 78 1836 0.02% 79 2070 0.02% 80 2356 0.02% 81 2656 0.02% 82 3093 0.03% 83 3495 0.03% 84 4073 0.03% 85 4572 0.04% 86 4991 0.04% 87 5369 0.05% 88 5922 0.05% 89 6243 0.05% 90 6628 0.06% 91 7405 0.06% 92 8138 0.07% 93 8742 0.07% 94 9601 0.08% 95 10439 0.09% 96 11046 0.09% 97 12173 0.10% 98 12598 0.11% 99 13990 0.12% 100 15533 0.13% 101 17299 0.15% 102 16114 0.14% 103 17175 0.14% 104 17803 0.15% 105 18686 0.16% 106 19856 0.17% 107 21076 0.18% 108 22139 0.19% 109 22892 0.19% 110 23508 0.20% 111 24126 0.20% 112 25508 0.21% 113 26046 0.22% 114 27831 0.23% 115 29382 0.25% 116 30668 0.26% 117 31126 0.26% 118 32191 0.27% 119 33035 0.28% 120 33895 0.28% 121 34676 0.29% 122 35905 0.30% 123 37010 0.31% 124 38373 0.32% 125 39672 0.33% 126 40539 0.34% 127 42122 0.35% 128 42866 0.36% 129 44095 0.37% 130 45472 0.38% 131 46024 0.39% 132 47814 0.40% 133 49326 0.41% 134 50430 0.42% 135 51994 0.44% 136 53454 0.45% 137 54907 0.46% 138 56648 0.48% 139 58858 0.49% 140 61692 0.52% 141 64321 0.54% 142 69404 0.58% 143 73023 0.61% 144 79509 0.67% 145 88975 0.75% 146 102896 0.86% 147 132135 1.11% 148 190723 1.60% 149 374412 3.14% 150 2417442 20.29% 151 6722603 56.42% 11915840 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=21 prefix-density=0.73 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=34.17 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=19 prefix-density=0.45 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=99.58 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=7.2 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCC SRR6958284 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:47:43 Started mapping on | Dec 06 18:47:45 Finished on | Dec 06 18:48:50 Mapping speed, Million of reads per hour | 659.95 Number of input reads | 11915840 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11667792 Uniquely mapped reads % | 97.92% Average mapped length | 292.29 Number of splices: Total | 13215101 Number of splices: Annotated (sjdb) | 12376106 Number of splices: GT/AG | 13042802 Number of splices: GC/AG | 149983 Number of splices: AT/AC | 5128 Number of splices: Non-canonical | 17188 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 104818 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 8214 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.80% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 145776 145776 145776 N_multimapping 104818 104818 104818 N_noFeature 435964 11319299 561739 N_ambiguous 264660 1509 42529 UnstrandedReadsAssigned:10967168 PositiveStrandReadsAssigned:346984 NegativeStrandReadsAssigned:11063524 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958284 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958284-trimmed-pair1.fastq SRR6958284-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,915,840 reads, 11,084,664 reads pseudoaligned [quant] estimated average fragment length: 217.665 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 SRR6958284.ke.tsv 35125 SRR6958284.se.tsv 88098 total ==> SRR6958284.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 719.812 0 0 PNS24247 1044 827.335 33.2611 5.59457 PNS24249 1928 1711.34 34.2377 2.78408 PNS24246 1044 827.335 33.2611 5.59457 PNS24248 1044 827.335 33.2611 5.59457 PNS24244 1471 1254.34 10.9791 1.21805 PNS24243 293 103.956 0 0 KQK14069 1603 1386.34 2113.97 212.199 KQK14071 474 262.463 44.9977 23.8581 ==> SRR6958284.se.tsv <== BRADI_1g14170v3 2438 BRADI_1g53295v3 129 BRADI_1g59795v3 171 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 162 BRADI_1g74790v3 55 BRADI_1g09890v3 0 BRADI_1g77505v3 133 BRADI_1g48960v3 0 SRR6958284 completed mapping pipeline successfully