Starting /dee2/code/volunteer_pipeline.sh SRR6958285 current disk space = 1550184288256 free memory = 1601699320 SRR6958285 SRAfilesize 39232d113cc3e1333dae9cb3dd77b8c3 SRR6958285.sra SRR6958285.sra file validated SRR6958285 is paired end SRR6958285 is conventional basespace SRR6958285 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958285_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.923 18.0 18.0 25.0 18.0 32.0 2 28.15925 29.0 27.0 31.0 18.0 33.0 3 28.87625 29.0 27.0 33.0 18.0 33.0 4 31.59625 33.0 31.0 33.0 29.0 33.0 5 32.58225 33.0 33.0 33.0 31.0 33.0 6 37.0045 38.0 37.0 38.0 35.0 38.0 7 37.388 38.0 38.0 38.0 36.0 38.0 8 37.10575 38.0 38.0 38.0 36.0 38.0 9 37.47425 38.0 38.0 38.0 37.0 38.0 10-14 37.46535 38.0 38.0 38.0 37.6 38.0 15-19 37.48479999999999 38.0 38.0 38.0 37.8 38.0 20-24 37.58905 38.0 38.0 38.0 38.0 38.0 25-29 37.496050000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.33925 38.0 38.0 38.0 37.2 38.0 35-39 37.501400000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.60195 38.0 38.0 38.0 38.0 38.0 45-49 37.55845 38.0 38.0 38.0 38.0 38.0 50-54 37.373450000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.39345 38.0 38.0 38.0 37.0 38.0 60-64 37.54555 38.0 38.0 38.0 37.8 38.0 65-69 37.56195 38.0 38.0 38.0 37.8 38.0 70-74 37.18155 38.0 38.0 38.0 36.4 38.0 75-79 37.4982 38.0 38.0 38.0 37.2 38.0 80-84 37.37925 38.0 38.0 38.0 37.0 38.0 85-89 37.193200000000004 38.0 38.0 38.0 36.2 38.0 90-94 35.91005 38.0 37.0 38.0 31.0 38.0 95-99 36.143449999999994 38.0 37.4 38.0 32.6 38.0 100-104 36.23525 38.0 37.6 38.0 33.2 38.0 105-109 36.3826 38.0 38.0 38.0 33.8 38.0 110-114 36.22685 38.0 38.0 38.0 33.2 38.0 115-119 36.71169999999999 38.0 38.0 38.0 34.4 38.0 120-124 36.7946 38.0 38.0 38.0 35.0 38.0 125-129 36.838449999999995 38.0 38.0 38.0 35.0 38.0 130-134 36.7619 38.0 38.0 38.0 35.0 38.0 135-139 36.67565 38.0 38.0 38.0 34.6 38.0 140-144 36.2649 38.0 38.0 38.0 33.8 38.0 145-149 35.813649999999996 38.0 36.6 38.0 33.0 38.0 150-151 29.13525 34.5 19.0 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 1.0 22 3.0 23 5.0 24 4.0 25 4.0 26 6.0 27 10.0 28 17.0 29 14.0 30 29.0 31 44.0 32 49.0 33 87.0 34 141.0 35 256.0 36 746.0 37 2581.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.60162601626016 9.64769647696477 9.214092140921409 38.53658536585366 2 25.5 13.825000000000001 33.35 27.325 3 22.7 17.349999999999998 24.975 34.975 4 26.825 25.15 21.625 26.400000000000002 5 26.625 29.025000000000002 23.549999999999997 20.8 6 21.875 32.6 23.599999999999998 21.925 7 16.925 22.225 41.3 19.55 8 20.075000000000003 23.1 28.675 28.15 9 19.475 21.725 33.074999999999996 25.724999999999998 10-14 22.915 26.32 26.314999999999998 24.45 15-19 23.445 25.16 26.035000000000004 25.36 20-24 22.92917166866747 25.7202881152461 25.660264105642256 25.690276110444177 25-29 23.435 25.55 25.624999999999996 25.39 30-34 22.830000000000002 25.215 26.445 25.509999999999998 35-39 23.57 24.959999999999997 25.735000000000003 25.735000000000003 40-44 23.330000000000002 24.93 26.284999999999997 25.455 45-49 22.945 25.014999999999997 25.990000000000002 26.05 50-54 22.865 25.264999999999997 26.115 25.755 55-59 22.91 25.53 25.56 26.0 60-64 23.605 25.145 25.759999999999998 25.490000000000002 65-69 23.455000000000002 25.34 25.5 25.705 70-74 23.365 24.83 26.005 25.8 75-79 23.715 24.73 26.06 25.495 80-84 23.285 25.52 25.585 25.61 85-89 23.21 25.080000000000002 25.650000000000002 26.06 90-94 22.96 25.259999999999998 25.685000000000002 26.095000000000002 95-99 23.525 24.759999999999998 26.095000000000002 25.619999999999997 100-104 23.435 24.92 25.424999999999997 26.22 105-109 24.145 24.560000000000002 25.95 25.345000000000002 110-114 23.59 24.865000000000002 25.865 25.679999999999996 115-119 23.9 24.9 25.61 25.590000000000003 120-124 23.435 25.55 25.009999999999998 26.005 125-129 23.78 25.324999999999996 25.47 25.424999999999997 130-134 24.25 25.455 24.97 25.324999999999996 135-139 23.200000000000003 24.98 25.669999999999998 26.150000000000002 140-144 24.16 25.405 25.019999999999996 25.415 145-149 23.915 25.855 24.985 25.245 150-151 24.3 24.4 26.237500000000004 25.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 1.0 27 2.0 28 2.5 29 2.0 30 3.0 31 9.0 32 13.5 33 18.0 34 24.5 35 38.0 36 50.0 37 60.0 38 80.5 39 98.0 40 121.0 41 153.0 42 167.0 43 183.5 44 215.0 45 227.5 46 218.5 47 189.5 48 183.5 49 197.5 50 187.0 51 163.5 52 127.0 53 110.5 54 106.5 55 95.5 56 89.5 57 92.0 58 87.5 59 77.5 60 69.5 61 55.0 62 64.0 63 63.5 64 49.0 65 49.5 66 42.5 67 36.5 68 38.0 69 32.0 70 28.0 71 22.0 72 15.5 73 12.5 74 8.5 75 6.5 76 4.0 77 3.0 78 2.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.04 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.025 0.025 0.0 0.0 0.0 92-93 0.037500000000000006 0.025 0.0 0.0 0.0 94-95 0.1 0.025 0.0 0.0 0.0 96-97 0.125 0.025 0.0 0.0 0.0 98-99 0.15 0.025 0.0 0.0 0.0 100-101 0.21250000000000002 0.025 0.0 0.0 0.0 102-103 0.2375 0.025 0.0 0.0 0.0 104-105 0.30000000000000004 0.025 0.0 0.0 0.0 106-107 0.3875 0.025 0.0 0.0 0.0 108-109 0.48750000000000004 0.025 0.0 0.0 0.0 110-111 0.55 0.025 0.0 0.0 0.0 112-113 0.7 0.025 0.0 0.0 0.0 114-115 0.775 0.025 0.0 0.0 0.0 116-117 0.925 0.025 0.0 0.0 0.0 118-119 1.1375 0.025 0.0 0.0 0.0 120-121 1.275 0.025 0.0 0.0 0.0 122-123 1.45 0.025 0.0 0.0 0.0 124-125 1.5750000000000002 0.025 0.0 0.0 0.0 126-127 1.6875 0.025 0.0 0.0 0.0 128-129 1.8 0.025 0.0 0.0 0.0 130-131 2.0 0.025 0.0 0.0 0.0 132-133 2.25 0.025 0.0 0.0 0.0 134-135 2.6 0.025 0.0 0.0 0.0 136-137 2.8499999999999996 0.025 0.0 0.0 0.0 138-139 3.2874999999999996 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958285 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958285_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.08675 33.0 33.0 34.0 32.0 34.0 2 33.20875 34.0 33.0 34.0 33.0 34.0 3 33.2095 34.0 33.0 34.0 33.0 34.0 4 33.24 34.0 33.0 34.0 33.0 34.0 5 33.19825 34.0 33.0 34.0 33.0 34.0 6 37.24225 38.0 38.0 38.0 37.0 38.0 7 37.20125 38.0 38.0 38.0 37.0 38.0 8 37.274 38.0 38.0 38.0 37.0 38.0 9 37.154 38.0 38.0 38.0 37.0 38.0 10-14 37.10025 38.0 38.0 38.0 36.8 38.0 15-19 37.0923 38.0 38.0 38.0 36.8 38.0 20-24 37.1619 38.0 38.0 38.0 37.0 38.0 25-29 37.16935 38.0 38.0 38.0 37.0 38.0 30-34 37.297000000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.3751 38.0 38.0 38.0 37.8 38.0 40-44 37.398700000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.3023 38.0 38.0 38.0 37.6 38.0 50-54 37.2198 38.0 38.0 38.0 37.0 38.0 55-59 36.880449999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.357899999999994 38.0 37.8 38.0 33.6 38.0 65-69 36.79545 38.0 38.0 38.0 35.6 38.0 70-74 36.914500000000004 38.0 38.0 38.0 35.8 38.0 75-79 36.922999999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.764300000000006 38.0 38.0 38.0 35.4 38.0 85-89 36.511849999999995 38.0 38.0 38.0 34.6 38.0 90-94 36.4951 38.0 38.0 38.0 34.4 38.0 95-99 36.9326 38.0 38.0 38.0 35.8 38.0 100-104 36.95095 38.0 38.0 38.0 36.0 38.0 105-109 36.861450000000005 38.0 38.0 38.0 35.6 38.0 110-114 36.7185 38.0 38.0 38.0 35.0 38.0 115-119 36.4239 38.0 38.0 38.0 34.2 38.0 120-124 36.23195 38.0 38.0 38.0 33.8 38.0 125-129 34.19685 38.0 34.0 38.0 23.6 38.0 130-134 36.12325 38.0 38.0 38.0 34.0 38.0 135-139 36.067949999999996 38.0 38.0 38.0 33.6 38.0 140-144 35.93415 38.0 38.0 38.0 33.2 38.0 145-149 35.567449999999994 38.0 36.8 38.0 32.6 38.0 150-151 31.763875 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 0.0 5 3.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 1.0 12 3.0 13 2.0 14 1.0 15 2.0 16 0.0 17 0.0 18 1.0 19 2.0 20 3.0 21 4.0 22 6.0 23 8.0 24 7.0 25 7.0 26 12.0 27 11.0 28 18.0 29 35.0 30 28.0 31 51.0 32 68.0 33 70.0 34 111.0 35 203.0 36 512.0 37 2819.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.45 18.0 11.0 32.550000000000004 2 28.449999999999996 24.025 26.875 20.65 3 22.25 25.424999999999997 26.35 25.974999999999998 4 24.15 33.324999999999996 20.125 22.400000000000002 5 26.075 33.75 20.200000000000003 19.975 6 23.35 34.849999999999994 20.275000000000002 21.525 7 23.275000000000002 19.400000000000002 34.9 22.425 8 24.275 23.150000000000002 23.3 29.275000000000002 9 24.5 23.075000000000003 26.200000000000003 26.224999999999998 10-14 25.515 25.91 23.25 25.324999999999996 15-19 25.724999999999998 25.935000000000002 23.65 24.69 20-24 25.7 24.955 25.130000000000003 24.215 25-29 25.46 25.380000000000003 24.605 24.555 30-34 25.205 25.650000000000002 25.005 24.14 35-39 25.795 25.665 24.51 24.03 40-44 26.11 25.064999999999998 24.4 24.425 45-49 26.174999999999997 25.590000000000003 24.265 23.97 50-54 25.35 25.474999999999998 25.124999999999996 24.05 55-59 25.52 25.5 24.45 24.529999999999998 60-64 25.44 25.715 24.775 24.07 65-69 25.929999999999996 25.974999999999998 24.315 23.78 70-74 25.869999999999997 24.66 25.135 24.335 75-79 26.07 25.124999999999996 24.775 24.03 80-84 26.21 25.345000000000002 24.445 24.0 85-89 25.555 25.525 24.81 24.11 90-94 26.424999999999997 25.575 23.995 24.005000000000003 95-99 25.665 25.71 25.045 23.580000000000002 100-104 26.07 25.040000000000003 24.965 23.925 105-109 25.46 26.265 24.22 24.055 110-114 26.064999999999998 26.22 24.555 23.16 115-119 26.595000000000002 24.905 24.685000000000002 23.815 120-124 26.195 25.66 24.455 23.69 125-129 25.805 26.145000000000003 24.44 23.61 130-134 25.855 25.825 25.040000000000003 23.28 135-139 26.195 25.535000000000004 24.7 23.57 140-144 26.779999999999998 25.900000000000002 24.04 23.28 145-149 26.325 26.490000000000002 23.935000000000002 23.25 150-151 26.3125 26.05 24.4875 23.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 2.0 27 2.0 28 2.5 29 5.5 30 6.0 31 5.5 32 10.5 33 18.5 34 23.0 35 24.0 36 34.0 37 52.0 38 69.0 39 85.0 40 108.5 41 149.0 42 175.0 43 171.0 44 180.0 45 202.0 46 209.5 47 195.5 48 180.5 49 179.5 50 174.5 51 162.5 52 138.5 53 124.5 54 110.5 55 90.0 56 88.0 57 94.0 58 91.5 59 77.5 60 82.0 61 82.5 62 72.0 63 69.0 64 65.5 65 62.0 66 46.0 67 40.0 68 48.5 69 44.0 70 33.5 71 30.0 72 27.5 73 18.5 74 11.5 75 8.0 76 5.0 77 3.0 78 2.0 79 2.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96255060728745 97.775 2 0.9109311740890688 1.7999999999999998 3 0.07591093117408906 0.22499999999999998 4 0.05060728744939271 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.25 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.5125 0.0 0.0 0.0 0.0 126-127 1.6124999999999998 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.9249999999999998 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.525 0.0 0.0 0.0 0.0 136-137 2.7750000000000004 0.0 0.0 0.0 0.0 138-139 3.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAACC 10 0.006830828 145.0 7 >>END_MODULE Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895498 spots for SRR6958285.sra Written 895498 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra Read 895492 spots for SRR6958285.sra Written 895492 spots for SRR6958285.sra SRR ids: ['SRR6958285.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_426cnheh SRR6958285.sra spots: 17909846 blocks: [[1, 895492], [895493, 1790984], [1790985, 2686476], [2686477, 3581968], [3581969, 4477460], [4477461, 5372952], [5372953, 6268444], [6268445, 7163936], [7163937, 8059428], [8059429, 8954920], [8954921, 9850412], [9850413, 10745904], [10745905, 11641396], [11641397, 12536888], [12536889, 13432380], [13432381, 14327872], [14327873, 15223364], [15223365, 16118856], [16118857, 17014348], [17014349, 17909846]] SRR6958285 file size 6047358 SRR6958285 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958285 SRR6958285_1.fastq SRR6958285_2.fastq Input file: SRR6958285_1.fastq Paired file: SRR6958285_2.fastq trimmed: SRR6958285-trimmed-pair1.fastq, SRR6958285-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:46:42 2024 >> started Fri Dec 6 18:47:00 2024 >> done (18.759s) 17909846 read pairs processed; of these: 13501 ( 0.08%) short read pairs filtered out after trimming by size control 11348 ( 0.06%) empty read pairs filtered out after trimming by size control 17884997 (99.86%) read pairs available; of these: 5314984 (29.72%) trimmed read pairs available after processing 12570013 (70.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 3 0.00% 21 4 0.00% 22 10 0.00% 23 1 0.00% 24 4 0.00% 25 4 0.00% 26 4 0.00% 27 2 0.00% 28 4 0.00% 29 4 0.00% 30 4 0.00% 31 4 0.00% 32 2 0.00% 33 8 0.00% 34 10 0.00% 35 7 0.00% 36 7 0.00% 37 5 0.00% 38 7 0.00% 39 5 0.00% 40 8 0.00% 41 6 0.00% 42 11 0.00% 43 9 0.00% 44 6 0.00% 45 11 0.00% 46 18 0.00% 47 18 0.00% 48 14 0.00% 49 18 0.00% 50 22 0.00% 51 19 0.00% 52 22 0.00% 53 20 0.00% 54 26 0.00% 55 37 0.00% 56 29 0.00% 57 21 0.00% 58 40 0.00% 59 40 0.00% 60 48 0.00% 61 77 0.00% 62 53 0.00% 63 73 0.00% 64 98 0.00% 65 97 0.00% 66 111 0.00% 67 120 0.00% 68 153 0.00% 69 160 0.00% 70 187 0.00% 71 205 0.00% 72 242 0.00% 73 285 0.00% 74 331 0.00% 75 391 0.00% 76 382 0.00% 77 481 0.00% 78 494 0.00% 79 572 0.00% 80 661 0.00% 81 766 0.00% 82 868 0.00% 83 1093 0.01% 84 1728 0.01% 85 2241 0.01% 86 2350 0.01% 87 2334 0.01% 88 2432 0.01% 89 2609 0.01% 90 2933 0.02% 91 3159 0.02% 92 3356 0.02% 93 3645 0.02% 94 3841 0.02% 95 4368 0.02% 96 4561 0.03% 97 4807 0.03% 98 5077 0.03% 99 5436 0.03% 100 5883 0.03% 101 6352 0.04% 102 6802 0.04% 103 7433 0.04% 104 7756 0.04% 105 8654 0.05% 106 9151 0.05% 107 9429 0.05% 108 10012 0.06% 109 10672 0.06% 110 10953 0.06% 111 11731 0.07% 112 12969 0.07% 113 13466 0.08% 114 14365 0.08% 115 15448 0.09% 116 16157 0.09% 117 16904 0.09% 118 17275 0.10% 119 18070 0.10% 120 18795 0.11% 121 20104 0.11% 122 20661 0.12% 123 22310 0.12% 124 23409 0.13% 125 24838 0.14% 126 25930 0.14% 127 27064 0.15% 128 27592 0.15% 129 28945 0.16% 130 30286 0.17% 131 31054 0.17% 132 33165 0.19% 133 35021 0.20% 134 36816 0.21% 135 38563 0.22% 136 41094 0.23% 137 42395 0.24% 138 44495 0.25% 139 47398 0.27% 140 50241 0.28% 141 53629 0.30% 142 58422 0.33% 143 64374 0.36% 144 72837 0.41% 145 84569 0.47% 146 100758 0.56% 147 129780 0.73% 148 190866 1.07% 149 378019 2.11% 150 3218739 18.00% 151 12570013 70.28% 17884997 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=22 prefix-density=0.78 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=57.83 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=21 prefix-density=0.57 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=36.76 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=6.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958285 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:47:57 Started mapping on | Dec 06 18:47:58 Finished on | Dec 06 18:49:08 Mapping speed, Million of reads per hour | 919.80 Number of input reads | 17884997 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17510822 Uniquely mapped reads % | 97.91% Average mapped length | 297.99 Number of splices: Total | 20409117 Number of splices: Annotated (sjdb) | 19249215 Number of splices: GT/AG | 20147532 Number of splices: GC/AG | 237575 Number of splices: AT/AC | 8086 Number of splices: Non-canonical | 15924 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 124352 % of reads mapped to multiple loci | 0.70% Number of reads mapped to too many loci | 17330 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 258769 258769 258769 N_multimapping 124352 124352 124352 N_noFeature 573759 17027454 704152 N_ambiguous 416808 2345 64861 UnstrandedReadsAssigned:16520255 PositiveStrandReadsAssigned:481023 NegativeStrandReadsAssigned:16741809 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6958285 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958285-trimmed-pair1.fastq SRR6958285-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,884,997 reads, 16,757,126 reads pseudoaligned [quant] estimated average fragment length: 269.406 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52973 SRR6958285.ke.tsv 35125 SRR6958285.se.tsv 88098 total ==> SRR6958285.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.097 0 0 PNS24247 1044 775.594 47.0465 5.4367 PNS24249 1928 1659.59 32.1081 1.73402 PNS24246 1044 775.594 47.0465 5.4367 PNS24248 1044 775.594 47.0465 5.4367 PNS24244 1471 1202.59 35.7525 2.66459 PNS24243 293 83.8595 0 0 KQK14069 1603 1334.59 4226.44 283.837 KQK14071 474 223.601 59.2051 23.7317 ==> SRR6958285.se.tsv <== BRADI_1g14170v3 4740 BRADI_1g53295v3 196 BRADI_1g59795v3 200 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 274 BRADI_1g74790v3 102 BRADI_1g09890v3 0 BRADI_1g77505v3 172 BRADI_1g48960v3 0 SRR6958285 completed mapping pipeline successfully