Starting /dee2/code/volunteer_pipeline.sh SRR6958286 current disk space = 1550193717248 free memory = 1332246288 SRR6958286 SRAfilesize 3ad54a7aaae0e3df2f08503b910c9c82 SRR6958286.sra SRR6958286.sra file validated SRR6958286 is paired end SRR6958286 is conventional basespace SRR6958286 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958286_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.995 32.0 25.0 33.0 18.0 33.0 2 31.12375 33.0 30.0 33.0 27.0 34.0 3 31.5935 33.0 31.0 33.0 28.0 34.0 4 32.311 33.0 33.0 33.0 31.0 34.0 5 32.27125 33.0 33.0 33.0 31.0 34.0 6 36.54025 38.0 37.0 38.0 34.0 38.0 7 36.90525 38.0 38.0 38.0 35.0 38.0 8 37.02425 38.0 38.0 38.0 36.0 38.0 9 37.2095 38.0 38.0 38.0 37.0 38.0 10-14 37.278749999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.2885 38.0 38.0 38.0 36.8 38.0 20-24 37.3369 38.0 38.0 38.0 37.0 38.0 25-29 37.27735 38.0 38.0 38.0 37.0 38.0 30-34 37.10465 38.0 38.0 38.0 36.2 38.0 35-39 36.84125 38.0 38.0 38.0 35.2 38.0 40-44 36.962399999999995 38.0 38.0 38.0 35.8 38.0 45-49 37.029849999999996 38.0 38.0 38.0 35.8 38.0 50-54 36.9074 38.0 38.0 38.0 35.4 38.0 55-59 36.77505000000001 38.0 38.0 38.0 34.8 38.0 60-64 36.86565 38.0 38.0 38.0 34.8 38.0 65-69 36.9088 38.0 38.0 38.0 35.0 38.0 70-74 36.8964 38.0 38.0 38.0 35.0 38.0 75-79 36.589 38.0 38.0 38.0 34.0 38.0 80-84 36.2695 38.0 37.6 38.0 33.2 38.0 85-89 36.25345 38.0 37.6 38.0 33.2 38.0 90-94 36.363499999999995 38.0 37.4 38.0 33.8 38.0 95-99 36.4013 38.0 37.6 38.0 34.0 38.0 100-104 36.09349999999999 38.0 37.0 38.0 33.2 38.0 105-109 35.62575 38.0 36.2 38.0 30.2 38.0 110-114 35.624100000000006 38.0 36.0 38.0 30.6 38.0 115-119 35.6475 38.0 36.2 38.0 31.2 38.0 120-124 35.38484999999999 38.0 35.6 38.0 29.8 38.0 125-129 34.798899999999996 38.0 35.0 38.0 27.2 38.0 130-134 34.6064 38.0 35.0 38.0 26.2 38.0 135-139 34.42745 38.0 34.8 38.0 26.2 38.0 140-144 34.05415000000001 38.0 34.4 38.0 24.4 38.0 145-149 32.655 38.0 33.4 38.0 16.6 38.0 150-151 27.608875 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 4.0 20 2.0 21 3.0 22 2.0 23 7.0 24 9.0 25 10.0 26 24.0 27 32.0 28 31.0 29 51.0 30 60.0 31 93.0 32 120.0 33 152.0 34 235.0 35 403.0 36 885.0 37 1873.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.153945666235444 9.857697283311772 8.952134540750322 44.03622250970246 2 21.575 12.7 37.275000000000006 28.449999999999996 3 19.425 15.6 25.624999999999996 39.35 4 25.1 24.65 22.1 28.15 5 26.35 28.249999999999996 23.075000000000003 22.325 6 23.075000000000003 32.175 23.225 21.525 7 17.849999999999998 24.325 39.35 18.475 8 20.724999999999998 22.875 29.625 26.775 9 21.099999999999998 20.775 33.35 24.775 10-14 22.96 26.369999999999997 25.71 24.959999999999997 15-19 22.935 24.66 26.32 26.085 20-24 22.49 25.515 26.16 25.835 25-29 22.645 25.4 26.44 25.515 30-34 22.259999999999998 25.525 26.174999999999997 26.040000000000003 35-39 23.28 25.650000000000002 25.5 25.569999999999997 40-44 23.315 25.419999999999998 25.900000000000002 25.365 45-49 22.52 25.369999999999997 25.985000000000003 26.125 50-54 23.3 25.56 25.230000000000004 25.91 55-59 23.419999999999998 26.075 25.929999999999996 24.575 60-64 23.355 25.480000000000004 25.509999999999998 25.655 65-69 22.975 25.455 26.179999999999996 25.39 70-74 23.655 25.255 25.314999999999998 25.775 75-79 23.32 24.915000000000003 25.715 26.05 80-84 23.335 24.685000000000002 26.27 25.71 85-89 23.28 25.39 25.6 25.729999999999997 90-94 23.79 25.180000000000003 25.15 25.88 95-99 22.975 25.89 25.865 25.27 100-104 22.875 25.35 25.945 25.83 105-109 23.64 24.795 26.064999999999998 25.5 110-114 23.375 25.064999999999998 25.205 26.355 115-119 23.494999999999997 24.8 26.245 25.46 120-124 24.19 25.085 25.31 25.415 125-129 23.71 25.085 25.77 25.435000000000002 130-134 23.95 24.63 25.305 26.115 135-139 23.965 24.635 25.564999999999998 25.835 140-144 23.7 25.52 25.395 25.385 145-149 23.845 25.89 25.165 25.1 150-151 24.52806600825103 25.815726965870734 24.62807850981373 25.028128516064506 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.5 28 4.5 29 5.5 30 7.5 31 11.5 32 13.5 33 21.0 34 25.0 35 32.5 36 52.5 37 65.5 38 77.0 39 109.0 40 137.5 41 149.0 42 162.5 43 185.5 44 203.5 45 220.5 46 218.0 47 207.5 48 178.0 49 155.5 50 165.0 51 163.0 52 144.0 53 122.5 54 106.5 55 92.5 56 87.5 57 88.0 58 90.0 59 78.0 60 73.5 61 71.0 62 60.5 63 56.0 64 50.0 65 48.5 66 51.0 67 41.5 68 35.0 69 31.0 70 27.0 71 20.5 72 15.5 73 12.5 74 8.5 75 4.5 76 2.5 77 2.5 78 2.0 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.6000000000000001 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.4375 0.0 0.0 0.0 0.0 122-123 1.6749999999999998 0.0 0.0 0.0 0.0 124-125 1.9 0.0 0.0 0.0 0.0 126-127 2.2375 0.0 0.0 0.0 0.0 128-129 2.475 0.0 0.0 0.0 0.0 130-131 2.6 0.0 0.0 0.0 0.0 132-133 2.8125 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.2125 0.0 0.0 0.0 0.0 138-139 3.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958286 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958286_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85875 33.0 33.0 34.0 32.0 34.0 2 32.90275 33.0 33.0 34.0 32.0 34.0 3 32.9535 34.0 33.0 34.0 32.0 34.0 4 32.9375 34.0 33.0 34.0 32.0 34.0 5 32.90175 34.0 33.0 34.0 32.0 34.0 6 37.058 38.0 38.0 38.0 36.0 38.0 7 37.0395 38.0 38.0 38.0 36.0 38.0 8 36.897 38.0 38.0 38.0 36.0 38.0 9 36.9065 38.0 38.0 38.0 36.0 38.0 10-14 36.8352 38.0 38.0 38.0 35.4 38.0 15-19 36.8832 38.0 38.0 38.0 35.6 38.0 20-24 36.9065 38.0 38.0 38.0 36.0 38.0 25-29 37.0005 38.0 38.0 38.0 36.0 38.0 30-34 36.95465 38.0 38.0 38.0 36.0 38.0 35-39 36.87715000000001 38.0 38.0 38.0 35.6 38.0 40-44 36.80585 38.0 38.0 38.0 35.0 38.0 45-49 36.83955 38.0 38.0 38.0 35.4 38.0 50-54 36.80874999999999 38.0 38.0 38.0 35.2 38.0 55-59 36.7208 38.0 38.0 38.0 34.6 38.0 60-64 36.7468 38.0 38.0 38.0 35.0 38.0 65-69 36.63244999999999 38.0 38.0 38.0 34.4 38.0 70-74 36.4249 38.0 38.0 38.0 34.0 38.0 75-79 36.2376 38.0 38.0 38.0 33.2 38.0 80-84 36.25165 38.0 38.0 38.0 33.6 38.0 85-89 36.13715 38.0 37.6 38.0 33.2 38.0 90-94 36.13099999999999 38.0 37.8 38.0 33.4 38.0 95-99 35.94384999999999 38.0 37.0 38.0 32.8 38.0 100-104 35.732150000000004 38.0 37.0 38.0 31.4 38.0 105-109 35.58315 38.0 36.8 38.0 30.6 38.0 110-114 35.32594999999999 38.0 36.0 38.0 29.2 38.0 115-119 34.947649999999996 38.0 35.0 38.0 27.2 38.0 120-124 35.0522 38.0 35.4 38.0 28.0 38.0 125-129 34.72215 38.0 35.0 38.0 27.2 38.0 130-134 34.285000000000004 38.0 34.8 38.0 24.2 38.0 135-139 33.7449 38.0 34.0 38.0 21.0 38.0 140-144 33.53345 38.0 33.6 38.0 21.8 38.0 145-149 32.543549999999996 38.0 32.8 38.0 14.8 38.0 150-151 27.721125 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 2.0 11 1.0 12 2.0 13 0.0 14 2.0 15 4.0 16 2.0 17 1.0 18 1.0 19 4.0 20 5.0 21 5.0 22 13.0 23 14.0 24 13.0 25 19.0 26 31.0 27 38.0 28 46.0 29 38.0 30 62.0 31 90.0 32 105.0 33 154.0 34 194.0 35 345.0 36 746.0 37 2052.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.075 16.925 12.8 35.199999999999996 2 30.957739434858716 22.330582645661416 27.731932983245812 18.97974493623406 3 21.405351337834457 26.206551637909474 27.25681420355089 25.131282820705174 4 26.276276276276278 30.455455455455454 20.82082082082082 22.44744744744745 5 29.804804804804807 31.58158158158158 19.66966966966967 18.943943943943946 6 22.1 36.575 21.25 20.075000000000003 7 23.3 20.05 33.35 23.3 8 23.625 23.724999999999998 25.275 27.375 9 22.85 22.7 29.2 25.25 10-14 25.515 26.215 23.3 24.97 15-19 25.365 25.365 24.915000000000003 24.355 20-24 26.419999999999998 25.169999999999998 24.315 24.095 25-29 25.990000000000002 25.69 24.325 23.995 30-34 25.505 26.38 23.93 24.185000000000002 35-39 25.71 25.629999999999995 24.095 24.565 40-44 25.755 25.6 24.04 24.605 45-49 25.515 25.195 24.834999999999997 24.455 50-54 25.82 25.52 24.21 24.45 55-59 25.535000000000004 25.345000000000002 25.235000000000003 23.885 60-64 25.605 25.72 24.4 24.275 65-69 25.46 25.75 25.06 23.73 70-74 25.919999999999998 25.169999999999998 24.8 24.11 75-79 25.105 25.424999999999997 25.130000000000003 24.34 80-84 25.69 25.569999999999997 24.975 23.765 85-89 25.974999999999998 25.540000000000003 24.755 23.73 90-94 26.21 25.365 24.985 23.44 95-99 25.945 25.365 25.035 23.655 100-104 25.665 25.995 24.305 24.035 105-109 25.374999999999996 25.495 24.975 24.154999999999998 110-114 26.0 25.96 24.565 23.474999999999998 115-119 25.645 26.200000000000003 24.165 23.990000000000002 120-124 26.22 25.45 24.925 23.405 125-129 26.479999999999997 25.855 24.865000000000002 22.8 130-134 26.924999999999997 25.95 23.855 23.27 135-139 26.3 26.155 24.33 23.215 140-144 26.555 25.974999999999998 24.605 22.865 145-149 26.665 26.029999999999998 24.51 22.795 150-151 27.678459807475935 25.84073009126141 23.87798474809351 22.602825353169145 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 2.5 26 1.5 27 0.5 28 3.0 29 8.5 30 10.5 31 11.0 32 14.5 33 19.0 34 23.0 35 34.5 36 43.5 37 47.0 38 70.0 39 89.0 40 105.0 41 142.0 42 163.5 43 181.5 44 201.5 45 204.5 46 208.5 47 191.0 48 176.0 49 163.0 50 154.0 51 168.5 52 153.0 53 105.5 54 85.5 55 98.5 56 96.5 57 84.5 58 79.0 59 85.5 60 92.0 61 89.0 62 70.0 63 57.5 64 57.5 65 59.5 66 61.5 67 47.5 68 42.5 69 44.5 70 43.0 71 35.5 72 24.5 73 16.0 74 10.5 75 7.5 76 4.5 77 3.0 78 2.0 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14076320444781 98.075 2 0.7076067728076826 1.4000000000000001 3 0.10108668182966893 0.3 4 0.025271670457417232 0.1 5 0.025271670457417232 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0125 0.0 0.0 60-61 0.025 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.05 0.0 0.025 0.0 0.0 66-67 0.05 0.0 0.025 0.0 0.0 68-69 0.05 0.0 0.025 0.0 0.0 70-71 0.05 0.0 0.025 0.0 0.0 72-73 0.05 0.0 0.025 0.0 0.0 74-75 0.05 0.0 0.025 0.0 0.0 76-77 0.05 0.0 0.025 0.0 0.0 78-79 0.0625 0.0 0.025 0.0 0.0 80-81 0.1 0.0 0.025 0.0 0.0 82-83 0.1125 0.0 0.025 0.0 0.0 84-85 0.125 0.0 0.025 0.0 0.0 86-87 0.125 0.0 0.025 0.0 0.0 88-89 0.15 0.0 0.025 0.0 0.0 90-91 0.175 0.0 0.025 0.0 0.0 92-93 0.1875 0.0 0.025 0.0 0.0 94-95 0.225 0.0 0.025 0.0 0.0 96-97 0.225 0.0 0.025 0.0 0.0 98-99 0.2875 0.0 0.025 0.0 0.0 100-101 0.3375 0.0 0.025 0.0 0.0 102-103 0.4 0.0 0.025 0.0 0.0 104-105 0.44999999999999996 0.0 0.025 0.0 0.0 106-107 0.575 0.0 0.025 0.0 0.0 108-109 0.6625000000000001 0.0 0.025 0.0 0.0 110-111 0.8 0.0 0.025 0.0 0.0 112-113 0.9874999999999999 0.0 0.025 0.0 0.0 114-115 1.1 0.0 0.025 0.0 0.0 116-117 1.2 0.0 0.025 0.0 0.0 118-119 1.3125 0.0 0.025 0.0 0.0 120-121 1.4375 0.0 0.025 0.0 0.0 122-123 1.6375000000000002 0.0 0.025 0.0 0.0 124-125 1.85 0.0 0.025 0.0 0.0 126-127 2.1875 0.0 0.025 0.0 0.0 128-129 2.425 0.0 0.025 0.0 0.0 130-131 2.55 0.0 0.025 0.0 0.0 132-133 2.7375 0.0 0.025 0.0 0.0 134-135 2.9125 0.0 0.025 0.0 0.0 136-137 3.1375 0.0 0.025 0.0 0.0 138-139 3.5 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra Read 1527730 spots for SRR6958286.sra Written 1527730 spots for SRR6958286.sra Read 1527727 spots for SRR6958286.sra Written 1527727 spots for SRR6958286.sra SRR ids: ['SRR6958286.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1mrtjwpy SRR6958286.sra spots: 30554543 blocks: [[1, 1527727], [1527728, 3055454], [3055455, 4583181], [4583182, 6110908], [6110909, 7638635], [7638636, 9166362], [9166363, 10694089], [10694090, 12221816], [12221817, 13749543], [13749544, 15277270], [15277271, 16804997], [16804998, 18332724], [18332725, 19860451], [19860452, 21388178], [21388179, 22915905], [22915906, 24443632], [24443633, 25971359], [25971360, 27499086], [27499087, 29026813], [29026814, 30554543]] SRR6958286 file size 10332231 SRR6958286 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958286 SRR6958286_1.fastq SRR6958286_2.fastq Input file: SRR6958286_1.fastq Paired file: SRR6958286_2.fastq trimmed: SRR6958286-trimmed-pair1.fastq, SRR6958286-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:48:45 2024 >> started Fri Dec 6 18:49:24 2024 >> done (39.763s) 30554543 read pairs processed; of these: 22019 ( 0.07%) short read pairs filtered out after trimming by size control 25347 ( 0.08%) empty read pairs filtered out after trimming by size control 30507177 (99.84%) read pairs available; of these: 11164580 (36.60%) trimmed read pairs available after processing 19342597 (63.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 9 0.00% 21 3 0.00% 22 4 0.00% 23 7 0.00% 24 16 0.00% 25 9 0.00% 26 13 0.00% 27 14 0.00% 28 10 0.00% 29 8 0.00% 30 15 0.00% 31 5 0.00% 32 12 0.00% 33 12 0.00% 34 23 0.00% 35 15 0.00% 36 11 0.00% 37 19 0.00% 38 20 0.00% 39 18 0.00% 40 19 0.00% 41 14 0.00% 42 20 0.00% 43 27 0.00% 44 31 0.00% 45 35 0.00% 46 38 0.00% 47 37 0.00% 48 42 0.00% 49 49 0.00% 50 53 0.00% 51 61 0.00% 52 59 0.00% 53 78 0.00% 54 90 0.00% 55 85 0.00% 56 94 0.00% 57 145 0.00% 58 146 0.00% 59 151 0.00% 60 170 0.00% 61 192 0.00% 62 211 0.00% 63 210 0.00% 64 250 0.00% 65 304 0.00% 66 336 0.00% 67 362 0.00% 68 449 0.00% 69 495 0.00% 70 538 0.00% 71 562 0.00% 72 697 0.00% 73 780 0.00% 74 873 0.00% 75 958 0.00% 76 1135 0.00% 77 1277 0.00% 78 1451 0.00% 79 1602 0.01% 80 1765 0.01% 81 1935 0.01% 82 2250 0.01% 83 2705 0.01% 84 3867 0.01% 85 4644 0.02% 86 4785 0.02% 87 4993 0.02% 88 5210 0.02% 89 5444 0.02% 90 5783 0.02% 91 6324 0.02% 92 6948 0.02% 93 7361 0.02% 94 7949 0.03% 95 8286 0.03% 96 8741 0.03% 97 9521 0.03% 98 10193 0.03% 99 10645 0.03% 100 11565 0.04% 101 11996 0.04% 102 12782 0.04% 103 13372 0.04% 104 14481 0.05% 105 15205 0.05% 106 16378 0.05% 107 16827 0.06% 108 17935 0.06% 109 19129 0.06% 110 19806 0.06% 111 21014 0.07% 112 22181 0.07% 113 23296 0.08% 114 24707 0.08% 115 26252 0.09% 116 27843 0.09% 117 29097 0.10% 118 30434 0.10% 119 31850 0.10% 120 33034 0.11% 121 34894 0.11% 122 36459 0.12% 123 38262 0.13% 124 40447 0.13% 125 42431 0.14% 126 44477 0.15% 127 46734 0.15% 128 48935 0.16% 129 51360 0.17% 130 54430 0.18% 131 57314 0.19% 132 60414 0.20% 133 64721 0.21% 134 68537 0.22% 135 72570 0.24% 136 77325 0.25% 137 82627 0.27% 138 88303 0.29% 139 95203 0.31% 140 102793 0.34% 141 112408 0.37% 142 125934 0.41% 143 141794 0.46% 144 166257 0.54% 145 200652 0.66% 146 250094 0.82% 147 343275 1.13% 148 532599 1.75% 149 1094005 3.59% 150 6416411 21.03% 151 19342597 63.40% 30507177 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=24 prefix-density=0.89 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=60.10 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=15 prefix-density=0.62 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=25.70 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958286 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:50:55 Started mapping on | Dec 06 18:50:55 Finished on | Dec 06 18:52:52 Mapping speed, Million of reads per hour | 938.68 Number of input reads | 30507177 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 30153303 Uniquely mapped reads % | 98.84% Average mapped length | 297.51 Number of splices: Total | 34785980 Number of splices: Annotated (sjdb) | 32779046 Number of splices: GT/AG | 34338743 Number of splices: GC/AG | 407616 Number of splices: AT/AC | 12572 Number of splices: Non-canonical | 27049 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 176063 % of reads mapped to multiple loci | 0.58% Number of reads mapped to too many loci | 15454 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.22% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 191107 191107 191107 N_multimapping 176063 176063 176063 N_noFeature 1049788 29230421 1319523 N_ambiguous 769110 3993 118049 UnstrandedReadsAssigned:28334405 PositiveStrandReadsAssigned:918889 NegativeStrandReadsAssigned:28715731 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958286 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958286-trimmed-pair1.fastq SRR6958286-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,507,177 reads, 28,727,229 reads pseudoaligned [quant] estimated average fragment length: 269.75 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,236 rounds 52973 SRR6958286.ke.tsv 35125 SRR6958286.se.tsv 88098 total ==> SRR6958286.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.699 0 0 PNS24247 1044 775.25 118.21 7.88455 PNS24249 1928 1659.25 65.919 2.0543 PNS24246 1044 775.25 118.21 7.88455 PNS24248 1044 775.25 118.21 7.88455 PNS24244 1471 1202.25 72.451 3.11612 PNS24243 293 80.3267 0 0 KQK14069 1603 1334.25 10989.6 425.901 KQK14071 474 220.726 128.174 30.0271 ==> SRR6958286.se.tsv <== BRADI_1g14170v3 12047 BRADI_1g53295v3 488 BRADI_1g59795v3 338 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 407 BRADI_1g74790v3 147 BRADI_1g09890v3 0 BRADI_1g77505v3 344 BRADI_1g48960v3 0 SRR6958286 completed mapping pipeline successfully