Starting /dee2/code/volunteer_pipeline.sh SRR6958287 current disk space = 1550205112320 free memory = 1603478024 SRR6958287 SRAfilesize ee875e7f9dd7e87842a4a01412160173 SRR6958287.sra SRR6958287.sra file validated SRR6958287 is paired end SRR6958287 is conventional basespace SRR6958287 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958287_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.3105 18.0 18.0 18.0 18.0 18.0 2 27.42825 27.0 27.0 29.0 25.0 30.0 3 28.7175 29.0 28.0 31.0 18.0 33.0 4 31.758 33.0 31.0 33.0 29.0 33.0 5 32.64475 33.0 33.0 33.0 32.0 33.0 6 36.597 38.0 37.0 38.0 34.0 38.0 7 37.24375 38.0 38.0 38.0 36.0 38.0 8 37.288 38.0 38.0 38.0 36.0 38.0 9 37.5425 38.0 38.0 38.0 37.0 38.0 10-14 37.598850000000006 38.0 38.0 38.0 37.6 38.0 15-19 37.49565 38.0 38.0 38.0 37.4 38.0 20-24 37.35225 38.0 38.0 38.0 36.8 38.0 25-29 37.50645 38.0 38.0 38.0 37.4 38.0 30-34 37.4661 38.0 38.0 38.0 37.6 38.0 35-39 37.57505 38.0 38.0 38.0 38.0 38.0 40-44 37.5566 38.0 38.0 38.0 38.0 38.0 45-49 37.50905 38.0 38.0 38.0 37.8 38.0 50-54 37.339 38.0 38.0 38.0 36.8 38.0 55-59 37.2624 38.0 38.0 38.0 36.6 38.0 60-64 37.326 38.0 38.0 38.0 36.4 38.0 65-69 37.2179 38.0 38.0 38.0 36.2 38.0 70-74 37.112399999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.843650000000004 38.0 38.0 38.0 35.0 38.0 80-84 35.496 38.0 35.4 38.0 29.2 38.0 85-89 36.8091 38.0 38.0 38.0 34.8 38.0 90-94 36.74515 38.0 38.0 38.0 35.0 38.0 95-99 36.56535 38.0 38.0 38.0 34.2 38.0 100-104 36.370549999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.3153 38.0 37.6 38.0 34.0 38.0 110-114 36.1618 38.0 37.4 38.0 33.4 38.0 115-119 35.88065 38.0 36.8 38.0 32.2 38.0 120-124 35.609 38.0 36.2 38.0 31.4 38.0 125-129 35.4818 38.0 35.8 38.0 30.4 38.0 130-134 35.1447 38.0 35.2 38.0 28.6 38.0 135-139 34.98495 38.0 35.2 38.0 28.8 38.0 140-144 34.44665 38.0 33.8 38.0 26.6 38.0 145-149 33.7983 38.0 33.4 38.0 22.8 38.0 150-151 28.961375 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 2.0 17 3.0 18 2.0 19 3.0 20 3.0 21 1.0 22 2.0 23 6.0 24 9.0 25 6.0 26 13.0 27 15.0 28 15.0 29 27.0 30 38.0 31 63.0 32 71.0 33 128.0 34 214.0 35 349.0 36 1098.0 37 1929.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 16.12565445026178 7.329842931937172 47.35602094240838 29.18848167539267 2 26.1 11.4 33.025 29.475 3 22.225 19.225 25.825 32.725 4 25.924999999999997 26.174999999999997 23.325000000000003 24.575 5 25.1 30.349999999999998 23.25 21.3 6 22.025 31.85 24.0 22.125 7 18.025 23.549999999999997 39.800000000000004 18.625 8 18.8 24.2 30.3 26.700000000000003 9 20.525 20.45 33.575 25.45 10-14 22.515 26.735 25.974999999999998 24.775 15-19 23.23 25.56 26.165 25.045 20-24 22.73 26.275 26.605 24.39 25-29 22.705000000000002 26.340000000000003 26.345000000000002 24.610000000000003 30-34 22.82 26.41 25.905 24.865000000000002 35-39 22.955000000000002 25.555 26.75 24.740000000000002 40-44 22.695 25.82 26.540000000000003 24.945 45-49 22.96 25.415 26.32 25.305 50-54 22.55 25.790000000000003 26.55 25.11 55-59 23.07 25.580000000000002 26.615 24.735 60-64 22.66 25.695 25.81 25.835 65-69 22.675 25.77 26.31 25.245 70-74 22.935 26.38 25.82 24.865000000000002 75-79 23.085 25.795 25.480000000000004 25.64 80-84 22.975 25.695 26.145000000000003 25.185000000000002 85-89 23.195 25.374999999999996 25.96 25.47 90-94 23.165 25.729999999999997 26.405 24.7 95-99 23.080000000000002 25.979999999999997 26.055 24.884999999999998 100-104 23.053458018702806 25.373806070910636 26.47397109566435 25.09876481472221 105-109 23.1 25.96 26.064999999999998 24.875 110-114 23.195 25.89 26.889999999999997 24.025 115-119 23.23 25.869999999999997 25.785000000000004 25.115 120-124 22.655 26.045 26.125 25.174999999999997 125-129 22.78 26.384999999999998 26.419999999999998 24.415 130-134 23.195 26.155 26.13 24.52 135-139 23.175 26.14 25.775 24.91 140-144 23.46 25.96 25.305 25.275 145-149 23.1 26.505000000000003 24.85 25.545 150-151 23.5125 25.8125 24.9 25.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 1.5 27 1.0 28 1.5 29 4.5 30 8.5 31 16.0 32 24.0 33 27.0 34 34.5 35 43.0 36 53.5 37 75.0 38 95.5 39 115.5 40 143.0 41 165.5 42 188.5 43 203.0 44 210.5 45 222.5 46 222.0 47 203.5 48 201.0 49 188.0 50 165.0 51 153.5 52 139.0 53 135.0 54 118.5 55 95.5 56 77.5 57 75.0 58 77.0 59 75.5 60 58.0 61 47.5 62 48.5 63 39.0 64 42.0 65 41.5 66 29.5 67 20.0 68 19.0 69 20.0 70 18.0 71 14.5 72 12.5 73 11.5 74 8.0 75 4.0 76 2.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.35167043456417985 0.7000000000000001 3 0.025119316754584273 0.075 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.8 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.8499999999999996 0.0 0.0 0.0 0.0 120-121 3.0875000000000004 0.0 0.0 0.0 0.0 122-123 3.2125 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.9749999999999996 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 6.025 0.0 0.0 0.0 0.0 136-137 6.5875 0.0 0.0 0.0 0.0 138-139 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAGAG 10 0.0068343505 144.975 2 >>END_MODULE SRR6958287 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958287_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14875 33.0 33.0 34.0 33.0 34.0 2 33.27525 34.0 33.0 34.0 33.0 34.0 3 33.27225 34.0 33.0 34.0 33.0 34.0 4 33.233 34.0 33.0 34.0 33.0 34.0 5 33.31125 34.0 33.0 34.0 33.0 34.0 6 37.4665 38.0 38.0 38.0 38.0 38.0 7 37.48675 38.0 38.0 38.0 38.0 38.0 8 37.41275 38.0 38.0 38.0 38.0 38.0 9 37.4435 38.0 38.0 38.0 38.0 38.0 10-14 37.45295 38.0 38.0 38.0 38.0 38.0 15-19 36.2159 38.0 36.8 38.0 31.2 38.0 20-24 36.0799 38.0 36.6 38.0 30.4 38.0 25-29 37.276799999999994 38.0 38.0 38.0 37.4 38.0 30-34 37.4009 38.0 38.0 38.0 38.0 38.0 35-39 37.350100000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.373599999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.363749999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.20165 38.0 38.0 38.0 37.6 38.0 55-59 37.17435 38.0 38.0 38.0 37.2 38.0 60-64 37.18745 38.0 38.0 38.0 37.0 38.0 65-69 37.164049999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.10635 38.0 38.0 38.0 37.0 38.0 75-79 37.06845 38.0 38.0 38.0 37.0 38.0 80-84 36.9525 38.0 38.0 38.0 36.8 38.0 85-89 36.92905 38.0 38.0 38.0 36.4 38.0 90-94 35.588049999999996 38.0 36.4 38.0 29.8 38.0 95-99 33.98225 37.6 32.8 38.0 23.0 38.0 100-104 34.28135 37.8 33.4 38.0 26.0 38.0 105-109 36.364850000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.16755 38.0 37.8 38.0 33.0 38.0 115-119 35.5541 38.0 36.8 38.0 29.6 38.0 120-124 35.37955 38.0 37.0 38.0 29.8 38.0 125-129 35.42515 38.0 36.6 38.0 31.0 38.0 130-134 33.32635 37.4 29.6 38.0 24.4 38.0 135-139 34.197649999999996 38.0 34.2 38.0 25.0 38.0 140-144 33.611349999999995 38.0 34.0 38.0 21.2 38.0 145-149 33.95735 38.0 34.2 38.0 25.0 38.0 150-151 29.68625 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 0.0 12 0.0 13 8.0 14 3.0 15 3.0 16 3.0 17 1.0 18 3.0 19 3.0 20 8.0 21 6.0 22 7.0 23 7.0 24 8.0 25 10.0 26 6.0 27 10.0 28 18.0 29 25.0 30 44.0 31 40.0 32 67.0 33 99.0 34 191.0 35 357.0 36 1127.0 37 1927.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.725 21.15 8.175 21.95 2 29.825000000000003 23.200000000000003 27.55 19.425 3 22.375 26.375 27.975 23.275000000000002 4 26.150000000000002 32.1 20.525 21.224999999999998 5 26.05 34.8 19.525000000000002 19.625 6 24.0 35.475 20.925 19.6 7 22.025 19.75 36.1 22.125 8 22.900000000000002 25.374999999999996 24.099999999999998 27.625 9 23.5 23.1 26.75 26.650000000000002 10-14 26.07 26.215 23.82 23.895 15-19 25.314999999999998 25.990000000000002 25.275 23.419999999999998 20-24 25.119999999999997 26.82 25.05 23.01 25-29 25.155 26.595000000000002 25.230000000000004 23.02 30-34 25.130000000000003 27.055 24.625 23.189999999999998 35-39 24.43 26.52 25.205 23.845 40-44 25.295 26.105 25.205 23.395 45-49 25.174999999999997 26.284999999999997 24.990000000000002 23.549999999999997 50-54 25.01877158732542 26.395354657856533 25.36416879411323 23.221704960704812 55-59 25.291731356738616 26.098061801973255 24.86602894776381 23.744177893524316 60-64 25.6197105513546 26.10045570634483 25.08388001402173 23.19595372827883 65-69 25.00375431746508 26.019922911348047 25.63447965159934 23.341843119587526 70-74 24.982470199338877 26.535109686466996 25.35810878493439 23.124311329259744 75-79 25.086375244103955 26.298132291823144 25.19152771518702 23.423964748885883 80-84 25.352112676056336 26.73048969976442 24.890982908124908 23.026414716054333 85-89 25.129001553028406 26.65698111317068 25.214167626872403 22.99984970692851 90-94 25.522970673606242 26.34871384245821 24.917425683114804 23.210889800820738 95-99 25.142628365528974 25.963367030327294 25.497948153338 23.396056450805723 100-104 24.914914914914917 26.876876876876878 25.245245245245247 22.962962962962962 105-109 24.772249474421866 26.218840724797275 26.053659024927423 22.95525077585344 110-114 24.69728810167117 26.638647052937053 25.8180726508556 22.845992194536173 115-119 25.36416879411323 26.95099364268909 25.168944285928816 22.51589327726886 120-124 26.182018311902738 26.38715164857157 25.046280082053336 22.38454995747236 125-129 25.63050440352282 27.00160128102482 24.689751801441155 22.67814251401121 130-134 25.641538692411586 27.132209494272423 25.146315842128956 22.079935971187034 135-139 26.449094003403744 26.86455100610672 25.052557813594955 21.633797176894586 140-144 26.704061701807984 27.09470626533781 24.440326538789 21.76090549406521 145-149 26.487379807692307 27.023237179487182 24.479166666666664 22.010216346153847 150-151 26.327655310621246 27.530060120240478 25.0501002004008 21.092184368737474 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 1.5 24 1.0 25 1.5 26 2.0 27 1.5 28 1.5 29 6.0 30 9.0 31 9.5 32 14.5 33 20.5 34 30.0 35 34.0 36 39.5 37 61.0 38 90.0 39 110.5 40 132.0 41 158.0 42 174.5 43 196.5 44 208.5 45 208.0 46 210.5 47 210.0 48 209.0 49 195.0 50 168.0 51 140.0 52 130.0 53 125.0 54 104.5 55 97.5 56 100.0 57 95.5 58 88.0 59 83.0 60 70.5 61 63.0 62 60.5 63 51.0 64 45.0 65 34.0 66 31.5 67 36.5 68 33.0 69 26.0 70 24.5 71 21.0 72 11.5 73 6.0 74 5.0 75 3.0 76 2.0 77 2.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.11499999999999999 55-59 0.165 60-64 0.155 65-69 0.11499999999999999 70-74 0.16999999999999998 75-79 0.145 80-84 0.245 85-89 0.19499999999999998 90-94 0.09 95-99 0.09 100-104 0.1 105-109 0.11 110-114 0.06999999999999999 115-119 0.11499999999999999 120-124 0.065 125-129 0.08 130-134 0.045 135-139 0.11 140-144 0.165 145-149 0.16 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42036290322581 98.625 2 0.45362903225806456 0.8999999999999999 3 0.05040322580645161 0.15 4 0.05040322580645161 0.2 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.6875 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.5250000000000004 0.0 0.0 0.0 0.0 128-129 3.8375 0.0 0.0 0.0 0.0 130-131 4.35 0.0 0.0 0.0 0.0 132-133 4.9375 0.0 0.0 0.0 0.0 134-135 5.45 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643937 spots for SRR6958287.sra Written 643937 spots for SRR6958287.sra Read 643948 spots for SRR6958287.sra Written 643948 spots for SRR6958287.sra SRR ids: ['SRR6958287.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gl_mxyac SRR6958287.sra spots: 12878751 blocks: [[1, 643937], [643938, 1287874], [1287875, 1931811], [1931812, 2575748], [2575749, 3219685], [3219686, 3863622], [3863623, 4507559], [4507560, 5151496], [5151497, 5795433], [5795434, 6439370], [6439371, 7083307], [7083308, 7727244], [7727245, 8371181], [8371182, 9015118], [9015119, 9659055], [9659056, 10302992], [10302993, 10946929], [10946930, 11590866], [11590867, 12234803], [12234804, 12878751]] SRR6958287 file size 4342485 SRR6958287 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958287 SRR6958287_1.fastq SRR6958287_2.fastq Input file: SRR6958287_1.fastq Paired file: SRR6958287_2.fastq trimmed: SRR6958287-trimmed-pair1.fastq, SRR6958287-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:47:58 2024 >> started Fri Dec 6 18:48:11 2024 >> done (13.114s) 12878751 read pairs processed; of these: 11297 ( 0.09%) short read pairs filtered out after trimming by size control 16541 ( 0.13%) empty read pairs filtered out after trimming by size control 12850913 (99.78%) read pairs available; of these: 7622173 (59.31%) trimmed read pairs available after processing 5228740 (40.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 9 0.00% 21 14 0.00% 22 6 0.00% 23 14 0.00% 24 9 0.00% 25 13 0.00% 26 14 0.00% 27 3 0.00% 28 19 0.00% 29 13 0.00% 30 14 0.00% 31 19 0.00% 32 11 0.00% 33 11 0.00% 34 14 0.00% 35 17 0.00% 36 18 0.00% 37 8 0.00% 38 14 0.00% 39 23 0.00% 40 18 0.00% 41 20 0.00% 42 38 0.00% 43 20 0.00% 44 24 0.00% 45 32 0.00% 46 34 0.00% 47 39 0.00% 48 43 0.00% 49 68 0.00% 50 77 0.00% 51 59 0.00% 52 72 0.00% 53 68 0.00% 54 71 0.00% 55 84 0.00% 56 120 0.00% 57 141 0.00% 58 159 0.00% 59 153 0.00% 60 176 0.00% 61 235 0.00% 62 226 0.00% 63 280 0.00% 64 286 0.00% 65 321 0.00% 66 364 0.00% 67 412 0.00% 68 437 0.00% 69 487 0.00% 70 632 0.00% 71 700 0.01% 72 819 0.01% 73 919 0.01% 74 985 0.01% 75 1242 0.01% 76 1525 0.01% 77 1576 0.01% 78 1539 0.01% 79 1781 0.01% 80 2296 0.02% 81 2266 0.02% 82 2589 0.02% 83 2751 0.02% 84 3480 0.03% 85 4014 0.03% 86 4453 0.03% 87 4661 0.04% 88 4924 0.04% 89 5167 0.04% 90 5767 0.04% 91 6127 0.05% 92 6775 0.05% 93 7368 0.06% 94 8071 0.06% 95 8372 0.07% 96 9035 0.07% 97 9697 0.08% 98 10447 0.08% 99 11816 0.09% 100 15036 0.12% 101 15789 0.12% 102 12514 0.10% 103 12996 0.10% 104 14215 0.11% 105 14856 0.12% 106 15559 0.12% 107 15973 0.12% 108 17071 0.13% 109 17781 0.14% 110 18560 0.14% 111 19847 0.15% 112 20980 0.16% 113 22723 0.18% 114 24042 0.19% 115 24899 0.19% 116 25770 0.20% 117 26989 0.21% 118 27825 0.22% 119 28611 0.22% 120 29794 0.23% 121 31596 0.25% 122 33015 0.26% 123 35238 0.27% 124 37225 0.29% 125 39529 0.31% 126 40862 0.32% 127 42152 0.33% 128 43774 0.34% 129 46263 0.36% 130 48185 0.37% 131 49735 0.39% 132 53449 0.42% 133 55982 0.44% 134 60147 0.47% 135 64023 0.50% 136 67881 0.53% 137 72173 0.56% 138 76591 0.60% 139 81632 0.64% 140 88749 0.69% 141 97520 0.76% 142 107853 0.84% 143 122888 0.96% 144 142031 1.11% 145 174781 1.36% 146 221796 1.73% 147 297905 2.32% 148 434740 3.38% 149 827480 6.44% 150 3568510 27.77% 151 5228740 40.69% 12850913 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=32 prefix-density=0.59 prefix-fanout=2.3 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAGGAAGAAGATTAAGCTGAAGGCTTCTAGGCTTGTGTGTGCTTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=54.40 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.7 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=23 prefix-density=0.47 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=94.16 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.5 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCC SRR6958287 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:49:11 Started mapping on | Dec 06 18:49:11 Finished on | Dec 06 18:50:11 Mapping speed, Million of reads per hour | 771.05 Number of input reads | 12850913 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12559993 Uniquely mapped reads % | 97.74% Average mapped length | 292.40 Number of splices: Total | 13830370 Number of splices: Annotated (sjdb) | 12957564 Number of splices: GT/AG | 13639481 Number of splices: GC/AG | 164838 Number of splices: AT/AC | 4960 Number of splices: Non-canonical | 21091 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 117603 % of reads mapped to multiple loci | 0.92% Number of reads mapped to too many loci | 6619 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 182349 182349 182349 N_multimapping 117603 117603 117603 N_noFeature 468865 12187166 591751 N_ambiguous 299227 1708 49766 UnstrandedReadsAssigned:11791901 PositiveStrandReadsAssigned:371119 NegativeStrandReadsAssigned:11918476 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958287 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958287-trimmed-pair1.fastq SRR6958287-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,850,913 reads, 11,933,177 reads pseudoaligned [quant] estimated average fragment length: 230.196 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR6958287.ke.tsv 35125 SRR6958287.se.tsv 88098 total ==> SRR6958287.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.275 0.531057 0.0964502 PNS24247 1044 814.804 52.9738 8.35139 PNS24249 1928 1698.8 14.2305 1.07603 PNS24246 1044 814.804 52.9738 8.35139 PNS24248 1044 814.804 52.9738 8.35139 PNS24244 1471 1241.8 38.3171 3.96361 PNS24243 293 96.2087 0 0 KQK14069 1603 1373.8 5494.07 513.713 KQK14071 474 250.448 88.5353 45.4098 ==> SRR6958287.se.tsv <== BRADI_1g14170v3 6294 BRADI_1g53295v3 108 BRADI_1g59795v3 276 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 110 BRADI_1g74790v3 44 BRADI_1g09890v3 0 BRADI_1g77505v3 170 BRADI_1g48960v3 0 SRR6958287 completed mapping pipeline successfully