Starting /dee2/code/volunteer_pipeline.sh SRR6958288 current disk space = 1550185943040 free memory = 1598496284 SRR6958288 SRAfilesize 83692c52b9c3448bf4ef7de2cc3eabcc SRR6958288.sra SRR6958288.sra file validated SRR6958288 is paired end SRR6958288 is conventional basespace SRR6958288 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958288_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.99475 32.0 18.0 33.0 18.0 34.0 2 30.7075 31.0 29.0 33.0 27.0 34.0 3 32.4265 33.0 33.0 33.0 30.0 34.0 4 32.8685 33.0 33.0 34.0 31.0 34.0 5 33.1945 33.0 33.0 34.0 33.0 34.0 6 36.686 38.0 37.0 38.0 35.0 38.0 7 37.29425 38.0 38.0 38.0 36.0 38.0 8 37.53425 38.0 38.0 38.0 37.0 38.0 9 37.413 38.0 38.0 38.0 37.0 38.0 10-14 37.362300000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.494150000000005 38.0 38.0 38.0 37.4 38.0 20-24 37.44475 38.0 38.0 38.0 37.0 38.0 25-29 37.59425 38.0 38.0 38.0 37.8 38.0 30-34 37.6126 38.0 38.0 38.0 37.8 38.0 35-39 37.60755 38.0 38.0 38.0 38.0 38.0 40-44 37.613150000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.34685 38.0 38.0 38.0 37.0 38.0 50-54 37.3952 38.0 38.0 38.0 37.0 38.0 55-59 37.1594 38.0 38.0 38.0 36.2 38.0 60-64 37.26365 38.0 38.0 38.0 36.6 38.0 65-69 37.29 38.0 38.0 38.0 36.4 38.0 70-74 36.90835 38.0 38.0 38.0 35.6 38.0 75-79 37.06275 38.0 38.0 38.0 35.8 38.0 80-84 37.15415 38.0 38.0 38.0 36.0 38.0 85-89 37.1029 38.0 38.0 38.0 36.0 38.0 90-94 37.020399999999995 38.0 38.0 38.0 35.8 38.0 95-99 36.9601 38.0 38.0 38.0 35.4 38.0 100-104 36.837300000000006 38.0 38.0 38.0 35.0 38.0 105-109 36.67745 38.0 38.0 38.0 34.2 38.0 110-114 36.602450000000005 38.0 38.0 38.0 34.2 38.0 115-119 36.40305 38.0 37.6 38.0 34.0 38.0 120-124 36.235049999999994 38.0 37.4 38.0 33.6 38.0 125-129 36.17145 38.0 37.0 38.0 33.6 38.0 130-134 35.96815 38.0 36.6 38.0 33.0 38.0 135-139 35.677949999999996 38.0 36.0 38.0 31.6 38.0 140-144 35.4608 38.0 35.6 38.0 31.2 38.0 145-149 34.78075 38.0 35.0 38.0 29.2 38.0 150-151 30.738124999999997 35.5 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 3.0 21 3.0 22 1.0 23 2.0 24 3.0 25 7.0 26 9.0 27 8.0 28 12.0 29 18.0 30 27.0 31 38.0 32 57.0 33 77.0 34 152.0 35 282.0 36 817.0 37 2481.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.14336193841494 12.165572942958102 8.758202927814235 42.93286219081272 2 19.375 14.174999999999999 39.775 26.674999999999997 3 19.529882470617654 16.079019754938734 27.081770442610654 37.30932733183296 4 24.325 24.375 24.625 26.674999999999997 5 25.174999999999997 29.775000000000002 24.175 20.875 6 20.9 33.650000000000006 25.3 20.150000000000002 7 16.650000000000002 25.900000000000002 39.225 18.224999999999998 8 19.85 24.55 32.625 22.975 9 19.15 22.475 35.25 23.125 10-14 21.23 27.834999999999997 27.92 23.015 15-19 21.42 26.450000000000003 28.165000000000003 23.965 20-24 21.011050552527628 26.94634731736587 28.121406070303518 23.92119605980299 25-29 21.725 27.46 27.755000000000003 23.06 30-34 21.065 27.365000000000002 27.845 23.724999999999998 35-39 21.21 27.334999999999997 28.055000000000003 23.400000000000002 40-44 21.515 27.065 28.299999999999997 23.119999999999997 45-49 20.745 26.779999999999998 28.22 24.255 50-54 20.86 27.315 27.515 24.310000000000002 55-59 21.32 27.310000000000002 27.77 23.599999999999998 60-64 20.905 27.355 27.73 24.01 65-69 21.095 26.669999999999998 28.155 24.08 70-74 20.93 27.315 27.235 24.52 75-79 20.78 27.445000000000004 27.66 24.115000000000002 80-84 21.295 26.619999999999997 28.335 23.75 85-89 21.17 27.485 27.98 23.365 90-94 21.47 26.840000000000003 27.66 24.03 95-99 21.85 26.674999999999997 27.845 23.630000000000003 100-104 21.693253988098217 27.044056608491275 27.48412261839276 23.778566785017752 105-109 21.365000000000002 27.305 27.455000000000002 23.875 110-114 22.261678503551067 26.72801840552166 28.048414524357305 22.96188856656997 115-119 21.697357886309046 28.33767013610889 27.19175340272218 22.77321857485989 120-124 21.709999999999997 26.619999999999997 27.27 24.4 125-129 21.610530003503328 26.74040338321405 27.391021470396876 24.25804514288574 130-134 21.942068137475612 27.19995997798789 27.39506728700786 23.46290459752864 135-139 21.87 26.490000000000002 27.27 24.37 140-144 21.485000000000003 27.125 26.474999999999998 24.915000000000003 145-149 21.9 26.97 26.884999999999998 24.245 150-151 22.4375 27.125 26.0625 24.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 1.5 26 1.0 27 3.5 28 4.5 29 7.0 30 13.0 31 19.0 32 24.5 33 29.0 34 42.5 35 58.5 36 74.5 37 90.5 38 129.0 39 163.5 40 190.0 41 213.0 42 233.0 43 259.5 44 278.5 45 276.0 46 241.5 47 221.5 48 208.0 49 181.0 50 149.0 51 133.5 52 115.0 53 95.0 54 82.5 55 65.5 56 63.5 57 59.5 58 48.5 59 41.0 60 35.0 61 29.5 62 26.0 63 20.0 64 11.5 65 13.0 66 11.5 67 5.0 68 4.0 69 4.5 70 3.5 71 3.5 72 4.5 73 3.5 74 1.5 75 0.5 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.03 115-119 0.08 120-124 0.0 125-129 0.095 130-134 0.055 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34525308486528 98.625 2 0.579199194157643 1.15 3 0.07554772097708386 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.825 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.4375 0.0 0.0 0.0 0.0 126-127 2.6375 0.0 0.0 0.0 0.0 128-129 2.9875 0.0 0.0 0.0 0.0 130-131 3.3875 0.0 0.0 0.0 0.0 132-133 3.625 0.0 0.0 0.0 0.0 134-135 3.9749999999999996 0.0 0.0 0.0 0.0 136-137 4.4 0.0 0.0 0.0 0.0 138-139 4.800000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACTTT 10 0.0065806094 146.79747 3 CCCATAC 10 0.006836113 144.9625 9 >>END_MODULE SRR6958288 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958288_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2825 33.0 33.0 34.0 33.0 34.0 2 33.3515 34.0 33.0 34.0 33.0 34.0 3 33.3975 34.0 33.0 34.0 33.0 34.0 4 33.386 34.0 33.0 34.0 33.0 34.0 5 33.43525 34.0 33.0 34.0 33.0 34.0 6 37.64 38.0 38.0 38.0 38.0 38.0 7 37.67375 38.0 38.0 38.0 38.0 38.0 8 37.6575 38.0 38.0 38.0 38.0 38.0 9 37.603 38.0 38.0 38.0 38.0 38.0 10-14 37.21535 38.0 38.0 38.0 36.2 38.0 15-19 37.133950000000006 38.0 38.0 38.0 35.8 38.0 20-24 37.6219 38.0 38.0 38.0 38.0 38.0 25-29 37.6177 38.0 38.0 38.0 38.0 38.0 30-34 37.65145 38.0 38.0 38.0 38.0 38.0 35-39 37.1323 38.0 38.0 38.0 36.8 38.0 40-44 37.50835 38.0 38.0 38.0 37.8 38.0 45-49 37.2064 38.0 38.0 38.0 36.8 38.0 50-54 37.210300000000004 38.0 38.0 38.0 36.8 38.0 55-59 36.8369 38.0 38.0 38.0 34.4 38.0 60-64 37.53615 38.0 38.0 38.0 38.0 38.0 65-69 37.2923 38.0 38.0 38.0 37.2 38.0 70-74 37.508399999999995 38.0 38.0 38.0 37.8 38.0 75-79 37.199349999999995 38.0 38.0 38.0 37.0 38.0 80-84 37.4647 38.0 38.0 38.0 38.0 38.0 85-89 37.4576 38.0 38.0 38.0 38.0 38.0 90-94 37.3356 38.0 38.0 38.0 37.2 38.0 95-99 37.35645 38.0 38.0 38.0 37.4 38.0 100-104 36.321400000000004 38.0 37.4 38.0 33.0 38.0 105-109 36.48 38.0 37.6 38.0 33.4 38.0 110-114 36.97905 38.0 38.0 38.0 35.6 38.0 115-119 37.09615 38.0 38.0 38.0 36.0 38.0 120-124 36.96 38.0 38.0 38.0 35.4 38.0 125-129 36.83155000000001 38.0 38.0 38.0 35.0 38.0 130-134 36.6821 38.0 38.0 38.0 35.0 38.0 135-139 36.4535 38.0 38.0 38.0 34.4 38.0 140-144 35.868449999999996 38.0 37.8 38.0 32.6 38.0 145-149 35.501850000000005 38.0 37.2 38.0 31.4 38.0 150-151 28.810375 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 3.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.0 23 3.0 24 5.0 25 4.0 26 9.0 27 13.0 28 19.0 29 18.0 30 18.0 31 19.0 32 49.0 33 48.0 34 89.0 35 182.0 36 575.0 37 2937.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.325 19.725 12.125 31.825 2 26.75 26.450000000000003 31.5 15.299999999999999 3 22.0 26.174999999999997 29.825000000000003 22.0 4 23.9 34.0 21.325 20.775 5 26.1 35.275 20.925 17.7 6 20.925 38.3 22.2 18.575 7 20.8 21.025 36.975 21.2 8 22.475 25.45 26.674999999999997 25.4 9 23.674999999999997 22.8 28.775000000000002 24.75 10-14 24.27 28.7 24.88 22.15 15-19 24.82 26.83 26.505000000000003 21.845 20-24 24.310000000000002 27.694999999999997 26.35 21.645 25-29 24.22 27.58 26.56 21.64 30-34 24.38 27.689999999999998 26.35 21.58 35-39 24.505 27.589999999999996 25.895000000000003 22.009999999999998 40-44 24.075 27.955000000000002 25.83 22.14 45-49 24.32 27.255000000000003 26.919999999999998 21.505 50-54 24.275 27.634999999999998 26.529999999999998 21.560000000000002 55-59 24.349999999999998 27.279999999999998 26.775 21.595 60-64 24.58 26.705000000000002 27.355 21.36 65-69 24.01 27.939999999999998 26.245 21.805 70-74 24.81 27.33 26.615 21.245 75-79 24.3 27.325 27.029999999999998 21.345 80-84 23.919999999999998 27.68 26.545 21.855 85-89 24.825 27.245 26.565 21.365000000000002 90-94 23.585 27.860000000000003 26.52 22.035 95-99 24.265 27.57 26.185000000000002 21.98 100-104 24.224999999999998 27.715 26.840000000000003 21.22 105-109 23.895 27.884999999999998 26.450000000000003 21.77 110-114 24.11 27.725 27.16 21.005 115-119 24.07 27.700000000000003 26.91 21.32 120-124 24.305 28.02 26.395000000000003 21.279999999999998 125-129 24.265 28.07 26.06 21.605 130-134 24.59 27.994999999999997 26.935 20.48 135-139 24.935 27.800000000000004 26.455000000000002 20.810000000000002 140-144 24.57 27.779999999999998 26.555 21.095 145-149 25.174999999999997 27.91 26.369999999999997 20.544999999999998 150-151 25.4625 27.500000000000004 26.5875 20.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 2.5 27 4.0 28 5.5 29 4.5 30 6.0 31 11.5 32 15.0 33 18.5 34 32.5 35 49.0 36 63.5 37 83.0 38 105.0 39 130.0 40 174.5 41 213.5 42 239.0 43 245.0 44 270.0 45 292.0 46 241.0 47 210.0 48 207.5 49 191.5 50 176.5 51 164.5 52 128.0 53 92.0 54 87.5 55 82.5 56 69.0 57 61.5 58 49.5 59 40.5 60 42.0 61 40.0 62 31.5 63 21.0 64 19.5 65 17.5 66 15.0 67 12.0 68 7.5 69 5.0 70 4.0 71 4.0 72 3.0 73 2.5 74 2.5 75 1.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.775 0.0 0.0 0.0 0.0 122-123 2.125 0.0 0.0 0.0 0.0 124-125 2.4 0.0 0.0 0.0 0.0 126-127 2.6375 0.0 0.0 0.0 0.0 128-129 2.9875 0.0 0.0 0.0 0.0 130-131 3.3875 0.0 0.0 0.0 0.0 132-133 3.625 0.0 0.0 0.0 0.0 134-135 3.9749999999999996 0.0 0.0 0.0 0.0 136-137 4.425000000000001 0.0 0.0 0.0 0.0 138-139 4.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGACT 10 0.006830828 145.0 2 CTGGTTC 10 0.006830828 145.0 7 AAGACTG 10 0.006830828 145.0 3 TGAAGAC 10 0.006830828 145.0 1 GACTGGT 10 0.006830828 145.0 5 ACTGGTT 10 0.006830828 145.0 6 CTACCTC 10 0.006830828 145.0 8 AGGAGAT 10 0.006830828 145.0 4 >>END_MODULE Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558863 spots for SRR6958288.sra Written 558863 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra Read 558860 spots for SRR6958288.sra Written 558860 spots for SRR6958288.sra SRR ids: ['SRR6958288.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_djz4b28j SRR6958288.sra spots: 11177203 blocks: [[1, 558860], [558861, 1117720], [1117721, 1676580], [1676581, 2235440], [2235441, 2794300], [2794301, 3353160], [3353161, 3912020], [3912021, 4470880], [4470881, 5029740], [5029741, 5588600], [5588601, 6147460], [6147461, 6706320], [6706321, 7265180], [7265181, 7824040], [7824041, 8382900], [8382901, 8941760], [8941761, 9500620], [9500621, 10059480], [10059481, 10618340], [10618341, 11177203]] SRR6958288 file size 3765886 SRR6958288 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958288 SRR6958288_1.fastq SRR6958288_2.fastq Input file: SRR6958288_1.fastq Paired file: SRR6958288_2.fastq trimmed: SRR6958288-trimmed-pair1.fastq, SRR6958288-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:48:29 2024 >> started Fri Dec 6 18:48:40 2024 >> done (11.169s) 11177203 read pairs processed; of these: 5868 ( 0.05%) short read pairs filtered out after trimming by size control 2851 ( 0.03%) empty read pairs filtered out after trimming by size control 11168484 (99.92%) read pairs available; of these: 3893752 (34.86%) trimmed read pairs available after processing 7274732 (65.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 4 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 0 0.00% 28 3 0.00% 29 5 0.00% 30 2 0.00% 31 2 0.00% 32 1 0.00% 33 3 0.00% 34 1 0.00% 35 6 0.00% 36 2 0.00% 37 2 0.00% 38 3 0.00% 39 7 0.00% 40 6 0.00% 41 5 0.00% 42 5 0.00% 43 10 0.00% 44 8 0.00% 45 7 0.00% 46 9 0.00% 47 9 0.00% 48 10 0.00% 49 10 0.00% 50 14 0.00% 51 19 0.00% 52 19 0.00% 53 18 0.00% 54 17 0.00% 55 22 0.00% 56 17 0.00% 57 21 0.00% 58 27 0.00% 59 40 0.00% 60 45 0.00% 61 49 0.00% 62 50 0.00% 63 54 0.00% 64 76 0.00% 65 82 0.00% 66 117 0.00% 67 94 0.00% 68 113 0.00% 69 133 0.00% 70 158 0.00% 71 177 0.00% 72 210 0.00% 73 236 0.00% 74 270 0.00% 75 304 0.00% 76 316 0.00% 77 405 0.00% 78 436 0.00% 79 471 0.00% 80 562 0.01% 81 630 0.01% 82 757 0.01% 83 857 0.01% 84 1052 0.01% 85 1187 0.01% 86 1377 0.01% 87 1538 0.01% 88 1662 0.01% 89 1711 0.02% 90 1926 0.02% 91 2181 0.02% 92 2355 0.02% 93 2418 0.02% 94 2761 0.02% 95 3015 0.03% 96 3194 0.03% 97 3299 0.03% 98 3622 0.03% 99 3976 0.04% 100 4299 0.04% 101 4522 0.04% 102 4954 0.04% 103 5391 0.05% 104 5545 0.05% 105 5911 0.05% 106 6316 0.06% 107 6873 0.06% 108 7154 0.06% 109 7446 0.07% 110 7973 0.07% 111 8188 0.07% 112 8616 0.08% 113 9158 0.08% 114 9894 0.09% 115 10607 0.09% 116 11229 0.10% 117 11222 0.10% 118 11733 0.11% 119 12300 0.11% 120 12986 0.12% 121 13544 0.12% 122 14166 0.13% 123 15023 0.13% 124 16027 0.14% 125 16621 0.15% 126 17338 0.16% 127 18102 0.16% 128 18623 0.17% 129 19582 0.18% 130 20615 0.18% 131 21592 0.19% 132 22287 0.20% 133 23977 0.21% 134 24959 0.22% 135 26047 0.23% 136 27588 0.25% 137 29395 0.26% 138 30925 0.28% 139 32690 0.29% 140 35343 0.32% 141 38433 0.34% 142 41859 0.37% 143 47092 0.42% 144 53388 0.48% 145 63524 0.57% 146 78136 0.70% 147 106588 0.95% 148 164908 1.48% 149 346813 3.11% 150 2292018 20.52% 151 7274732 65.14% 11168484 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=24 prefix-density=0.48 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=31.28 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=1.7 sequence=AAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCGACGAAG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=25 prefix-density=0.44 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=165.38 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.9 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958288 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:49:24 Started mapping on | Dec 06 18:49:24 Finished on | Dec 06 18:50:21 Mapping speed, Million of reads per hour | 705.38 Number of input reads | 11168484 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10780750 Uniquely mapped reads % | 96.53% Average mapped length | 297.36 Number of splices: Total | 12945532 Number of splices: Annotated (sjdb) | 12202013 Number of splices: GT/AG | 12771837 Number of splices: GC/AG | 152733 Number of splices: AT/AC | 5294 Number of splices: Non-canonical | 15668 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 154877 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 20937 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.63% % of reads unmapped: other | 1.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 235270 235270 235270 N_multimapping 154877 154877 154877 N_noFeature 437833 10482735 533144 N_ambiguous 243896 1554 41607 UnstrandedReadsAssigned:10099021 PositiveStrandReadsAssigned:296461 NegativeStrandReadsAssigned:10205999 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958288 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958288-trimmed-pair1.fastq SRR6958288-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,168,484 reads, 10,239,966 reads pseudoaligned [quant] estimated average fragment length: 232.698 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR6958288.ke.tsv 35125 SRR6958288.se.tsv 88098 total ==> SRR6958288.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 704.679 0 0 PNS24247 1044 812.302 30.8048 5.83613 PNS24249 1928 1696.3 40.7748 3.69925 PNS24246 1044 812.302 30.8048 5.83613 PNS24248 1044 812.302 30.8048 5.83613 PNS24244 1471 1239.3 19.8107 2.46007 PNS24243 293 86.6934 0 0 KQK14069 1603 1371.3 3472.83 389.74 KQK14071 474 245.73 75.4315 47.241 ==> SRR6958288.se.tsv <== BRADI_1g14170v3 4043 BRADI_1g53295v3 74 BRADI_1g59795v3 126 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 117 BRADI_1g74790v3 47 BRADI_1g09890v3 0 BRADI_1g77505v3 176 BRADI_1g48960v3 0 SRR6958288 completed mapping pipeline successfully