Starting /dee2/code/volunteer_pipeline.sh SRR6958289 current disk space = 1550188810240 free memory = 1599939976 SRR6958289 SRAfilesize ff92ae021b0cf2ebdf81ff3064658a22 SRR6958289.sra SRR6958289.sra file validated SRR6958289 is paired end SRR6958289 is conventional basespace SRR6958289 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958289_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.31175 25.0 18.0 32.0 18.0 33.0 2 30.2035 31.0 28.0 33.0 27.0 33.0 3 31.062 33.0 31.0 33.0 27.0 33.0 4 31.93175 33.0 31.0 33.0 29.0 34.0 5 32.18175 33.0 32.0 33.0 31.0 34.0 6 36.27675 38.0 36.0 38.0 33.0 38.0 7 37.0555 38.0 38.0 38.0 35.0 38.0 8 37.3415 38.0 38.0 38.0 36.0 38.0 9 37.41375 38.0 38.0 38.0 37.0 38.0 10-14 37.418899999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.4812 38.0 38.0 38.0 37.4 38.0 20-24 37.50465 38.0 38.0 38.0 37.8 38.0 25-29 37.41105 38.0 38.0 38.0 37.0 38.0 30-34 37.37865000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.30575 38.0 38.0 38.0 37.0 38.0 40-44 37.23115 38.0 38.0 38.0 36.6 38.0 45-49 37.2496 38.0 38.0 38.0 36.8 38.0 50-54 37.2448 38.0 38.0 38.0 36.8 38.0 55-59 37.068 38.0 38.0 38.0 36.0 38.0 60-64 36.97525 38.0 38.0 38.0 35.6 38.0 65-69 37.07065 38.0 38.0 38.0 36.0 38.0 70-74 37.1093 38.0 38.0 38.0 36.0 38.0 75-79 37.06225 38.0 38.0 38.0 35.6 38.0 80-84 36.67525 38.0 38.0 38.0 34.2 38.0 85-89 36.7005 38.0 38.0 38.0 34.2 38.0 90-94 36.620050000000006 38.0 38.0 38.0 34.2 38.0 95-99 36.56145 38.0 38.0 38.0 34.0 38.0 100-104 36.40365 38.0 37.2 38.0 33.8 38.0 105-109 36.285700000000006 38.0 37.2 38.0 33.4 38.0 110-114 35.99995 38.0 36.8 38.0 32.6 38.0 115-119 35.94355 38.0 36.8 38.0 32.4 38.0 120-124 35.78295 38.0 36.0 38.0 31.0 38.0 125-129 35.460249999999995 38.0 36.0 38.0 30.6 38.0 130-134 35.4225 38.0 35.6 38.0 30.6 38.0 135-139 35.068650000000005 38.0 35.0 38.0 28.2 38.0 140-144 34.76415 38.0 35.0 38.0 27.8 38.0 145-149 33.85085 38.0 34.4 38.0 22.8 38.0 150-151 29.512 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 1.0 19 1.0 20 3.0 21 2.0 22 5.0 23 3.0 24 2.0 25 5.0 26 15.0 27 22.0 28 27.0 29 35.0 30 37.0 31 60.0 32 74.0 33 126.0 34 190.0 35 358.0 36 944.0 37 2087.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.535343035343036 14.319126819126819 7.6923076923076925 47.45322245322245 2 18.75937968984492 13.431715857928964 36.51825912956478 31.29064532266133 3 19.0 15.25 26.5 39.25 4 24.9 21.975 22.875 30.25 5 24.187093546773387 28.51425712856428 24.487243621810904 22.811405702851424 6 22.400000000000002 31.65 24.275 21.675 7 16.825000000000003 24.275 39.175 19.725 8 19.6 25.124999999999996 29.9 25.374999999999996 9 19.225 21.75 33.525 25.5 10-14 21.965 27.025 26.235000000000003 24.775 15-19 22.075 25.740000000000002 26.405 25.779999999999998 20-24 21.32 25.86 26.939999999999998 25.88 25-29 21.92 26.465 26.169999999999998 25.445 30-34 22.08 25.95 26.634999999999998 25.335 35-39 22.5 25.595000000000002 26.669999999999998 25.235000000000003 40-44 22.255 25.974999999999998 25.695 26.075 45-49 22.555 25.724999999999998 26.090000000000003 25.629999999999995 50-54 22.54 26.179999999999996 25.955000000000002 25.324999999999996 55-59 22.28 25.88 26.63 25.21 60-64 22.325 25.945 26.46 25.27 65-69 22.825 25.900000000000002 25.88 25.395 70-74 22.5 25.629999999999995 25.885 25.985000000000003 75-79 22.384999999999998 25.365 26.755000000000003 25.495 80-84 22.814999999999998 25.485000000000003 25.595000000000002 26.105 85-89 22.665 25.430000000000003 25.96 25.945 90-94 22.765 25.374999999999996 26.284999999999997 25.575 95-99 23.325000000000003 25.28 26.334999999999997 25.06 100-104 22.755 26.31 26.229999999999997 24.705 105-109 22.88 25.75 26.415 24.955 110-114 22.845 25.81 26.43 24.915000000000003 115-119 22.895 25.740000000000002 26.125 25.240000000000002 120-124 22.795 25.965 26.165 25.074999999999996 125-129 23.0 25.929999999999996 26.02 25.05 130-134 23.305 25.485000000000003 25.515 25.695 135-139 23.205000000000002 25.39 25.629999999999995 25.775 140-144 22.795 25.75 26.3 25.155 145-149 22.82 25.47 25.805 25.905 150-151 22.661330665332667 25.41270635317659 26.163081540770385 25.76288144072036 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 2.5 28 2.5 29 3.5 30 7.0 31 9.0 32 10.0 33 24.5 34 35.0 35 39.5 36 50.0 37 70.0 38 103.5 39 116.5 40 134.0 41 160.5 42 175.5 43 185.0 44 220.5 45 239.5 46 226.5 47 214.0 48 197.5 49 188.0 50 174.0 51 148.5 52 130.5 53 116.5 54 101.5 55 110.5 56 97.0 57 78.5 58 72.0 59 63.0 60 61.5 61 67.0 62 60.0 63 40.5 64 42.5 65 40.5 66 33.5 67 30.0 68 27.5 69 20.0 70 12.0 71 13.0 72 12.0 73 9.5 74 7.0 75 6.0 76 4.0 77 2.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8 2 0.05 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.825 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.2 0.0 0.0 0.0 0.0 134-135 2.4625 0.0 0.0 0.0 0.0 136-137 2.6500000000000004 0.0 0.0 0.0 0.0 138-139 2.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958289 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958289_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94625 33.0 33.0 34.0 32.0 34.0 2 32.88475 34.0 33.0 34.0 32.0 34.0 3 33.02625 34.0 33.0 34.0 32.0 34.0 4 32.99 34.0 33.0 34.0 32.0 34.0 5 33.035 34.0 33.0 34.0 32.0 34.0 6 37.133 38.0 38.0 38.0 37.0 38.0 7 37.11975 38.0 38.0 38.0 37.0 38.0 8 37.1115 38.0 38.0 38.0 37.0 38.0 9 37.14 38.0 38.0 38.0 37.0 38.0 10-14 37.044700000000006 38.0 38.0 38.0 36.4 38.0 15-19 36.8849 38.0 38.0 38.0 35.8 38.0 20-24 37.0466 38.0 38.0 38.0 36.4 38.0 25-29 37.161649999999995 38.0 38.0 38.0 36.8 38.0 30-34 37.1013 38.0 38.0 38.0 36.6 38.0 35-39 37.09785 38.0 38.0 38.0 37.0 38.0 40-44 37.0584 38.0 38.0 38.0 36.4 38.0 45-49 36.98655 38.0 38.0 38.0 36.0 38.0 50-54 36.8509 38.0 38.0 38.0 35.6 38.0 55-59 36.952 38.0 38.0 38.0 35.8 38.0 60-64 36.8897 38.0 38.0 38.0 35.6 38.0 65-69 36.7981 38.0 38.0 38.0 35.2 38.0 70-74 36.61995 38.0 38.0 38.0 34.4 38.0 75-79 36.43845 38.0 38.0 38.0 34.0 38.0 80-84 36.50005 38.0 38.0 38.0 34.0 38.0 85-89 36.35325 38.0 38.0 38.0 34.0 38.0 90-94 36.378949999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.24185000000001 38.0 37.8 38.0 33.8 38.0 100-104 36.0678 38.0 37.2 38.0 33.0 38.0 105-109 35.92605 38.0 37.0 38.0 32.6 38.0 110-114 35.61375 38.0 36.4 38.0 31.2 38.0 115-119 35.50655 38.0 36.0 38.0 30.6 38.0 120-124 35.329049999999995 38.0 36.0 38.0 29.8 38.0 125-129 35.2367 38.0 35.8 38.0 30.2 38.0 130-134 34.822100000000006 38.0 35.2 38.0 27.4 38.0 135-139 34.467949999999995 38.0 35.0 38.0 26.0 38.0 140-144 34.0736 38.0 34.6 38.0 23.6 38.0 145-149 33.457499999999996 38.0 33.8 38.0 20.2 38.0 150-151 28.44325 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 3.0 13 0.0 14 1.0 15 3.0 16 5.0 17 2.0 18 6.0 19 6.0 20 4.0 21 3.0 22 9.0 23 5.0 24 11.0 25 24.0 26 21.0 27 23.0 28 27.0 29 36.0 30 59.0 31 74.0 32 58.0 33 118.0 34 197.0 35 310.0 36 708.0 37 2278.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.34167083541771 17.333666833416707 12.331165582791396 36.99349674837419 2 28.95723930982746 22.655663915978995 30.08252063015754 18.30457614403601 3 21.955488872218055 26.25656414103526 27.45686421605401 24.33108277069267 4 25.124999999999996 31.225 20.674999999999997 22.975 5 28.632158039509875 31.882970742685675 19.72993248312078 19.754938734683673 6 22.975 37.35 20.45 19.225 7 22.55 20.125 35.675000000000004 21.65 8 24.65 22.55 26.200000000000003 26.6 9 23.674999999999997 22.45 28.799999999999997 25.074999999999996 10-14 25.4 26.650000000000002 23.7 24.25 15-19 24.224999999999998 25.82 25.69 24.265 20-24 25.074999999999996 26.405 24.795 23.724999999999998 25-29 25.485000000000003 25.924999999999997 25.025 23.565 30-34 25.11 26.314999999999998 24.779999999999998 23.794999999999998 35-39 24.765 26.779999999999998 24.385 24.07 40-44 25.665 25.75 24.89 23.695 45-49 25.27 25.46 25.36 23.91 50-54 26.075 25.97 24.98 22.975 55-59 25.735000000000003 26.669999999999998 24.48 23.115 60-64 25.45 25.95 25.374999999999996 23.225 65-69 24.82 25.874999999999996 25.71 23.595 70-74 25.645 26.284999999999997 24.605 23.465 75-79 25.445 25.779999999999998 25.569999999999997 23.205000000000002 80-84 25.655 26.584999999999997 25.025 22.735 85-89 25.855 25.624999999999996 25.180000000000003 23.34 90-94 25.515 26.284999999999997 24.834999999999997 23.365 95-99 26.08 26.26 24.9 22.759999999999998 100-104 25.650000000000002 25.979999999999997 25.324999999999996 23.044999999999998 105-109 25.75 25.929999999999996 25.135 23.185 110-114 26.005 26.69 24.3 23.005 115-119 25.6 26.33 25.44 22.63 120-124 25.835 25.805 25.66 22.7 125-129 25.905 25.89 25.119999999999997 23.085 130-134 26.195 25.545 25.540000000000003 22.720000000000002 135-139 26.6 26.46 24.779999999999998 22.16 140-144 26.155 26.51 25.135 22.2 145-149 26.26 26.35 24.985 22.405 150-151 26.409903713892707 27.372764786795052 25.071901963236215 21.14542953607603 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 3.0 27 3.0 28 2.0 29 3.5 30 3.0 31 6.5 32 18.0 33 24.0 34 23.5 35 32.0 36 51.0 37 63.5 38 75.5 39 106.0 40 136.0 41 147.0 42 177.5 43 205.5 44 206.0 45 209.0 46 208.5 47 199.0 48 198.0 49 192.5 50 161.0 51 142.0 52 131.5 53 123.5 54 108.5 55 93.0 56 87.0 57 84.0 58 85.5 59 79.5 60 75.5 61 67.0 62 57.0 63 52.0 64 48.5 65 47.0 66 45.0 67 44.0 68 40.5 69 30.0 70 25.0 71 22.0 72 19.0 73 14.0 74 8.0 75 3.5 76 1.5 77 2.5 78 2.5 79 2.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.41919191919192 98.425 2 0.3282828282828283 0.65 3 0.12626262626262627 0.375 4 0.07575757575757576 0.3 5 0.050505050505050504 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 5 0.125 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.3875 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTGCG 10 0.006830828 145.0 2 >>END_MODULE Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982881 spots for SRR6958289.sra Written 982881 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra Read 982862 spots for SRR6958289.sra Written 982862 spots for SRR6958289.sra SRR ids: ['SRR6958289.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f7dwkxd9 SRR6958289.sra spots: 19657259 blocks: [[1, 982862], [982863, 1965724], [1965725, 2948586], [2948587, 3931448], [3931449, 4914310], [4914311, 5897172], [5897173, 6880034], [6880035, 7862896], [7862897, 8845758], [8845759, 9828620], [9828621, 10811482], [10811483, 11794344], [11794345, 12777206], [12777207, 13760068], [13760069, 14742930], [14742931, 15725792], [15725793, 16708654], [16708655, 17691516], [17691517, 18674378], [18674379, 19657259]] SRR6958289 file size 6639499 SRR6958289 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958289 SRR6958289_1.fastq SRR6958289_2.fastq Input file: SRR6958289_1.fastq Paired file: SRR6958289_2.fastq trimmed: SRR6958289-trimmed-pair1.fastq, SRR6958289-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:51:01 2024 >> started Fri Dec 6 18:51:21 2024 >> done (20.370s) 19657259 read pairs processed; of these: 8039 ( 0.04%) short read pairs filtered out after trimming by size control 5005 ( 0.03%) empty read pairs filtered out after trimming by size control 19644215 (99.93%) read pairs available; of these: 6841414 (34.83%) trimmed read pairs available after processing 12802801 (65.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 9 0.00% 20 3 0.00% 21 4 0.00% 22 2 0.00% 23 2 0.00% 24 4 0.00% 25 5 0.00% 26 5 0.00% 27 7 0.00% 28 7 0.00% 29 9 0.00% 30 5 0.00% 31 6 0.00% 32 6 0.00% 33 8 0.00% 34 10 0.00% 35 10 0.00% 36 8 0.00% 37 8 0.00% 38 16 0.00% 39 11 0.00% 40 11 0.00% 41 8 0.00% 42 11 0.00% 43 16 0.00% 44 12 0.00% 45 21 0.00% 46 14 0.00% 47 15 0.00% 48 20 0.00% 49 20 0.00% 50 31 0.00% 51 32 0.00% 52 28 0.00% 53 53 0.00% 54 43 0.00% 55 44 0.00% 56 42 0.00% 57 46 0.00% 58 65 0.00% 59 73 0.00% 60 81 0.00% 61 100 0.00% 62 81 0.00% 63 104 0.00% 64 140 0.00% 65 141 0.00% 66 130 0.00% 67 178 0.00% 68 218 0.00% 69 214 0.00% 70 264 0.00% 71 273 0.00% 72 343 0.00% 73 354 0.00% 74 399 0.00% 75 518 0.00% 76 534 0.00% 77 602 0.00% 78 689 0.00% 79 766 0.00% 80 796 0.00% 81 914 0.00% 82 1092 0.01% 83 1209 0.01% 84 1690 0.01% 85 1945 0.01% 86 2206 0.01% 87 2392 0.01% 88 2417 0.01% 89 2684 0.01% 90 2784 0.01% 91 3104 0.02% 92 3298 0.02% 93 3678 0.02% 94 3916 0.02% 95 4334 0.02% 96 4446 0.02% 97 4887 0.02% 98 5230 0.03% 99 5328 0.03% 100 6004 0.03% 101 6402 0.03% 102 6856 0.03% 103 7192 0.04% 104 7758 0.04% 105 8129 0.04% 106 8843 0.05% 107 9382 0.05% 108 9789 0.05% 109 10602 0.05% 110 11052 0.06% 111 11650 0.06% 112 12472 0.06% 113 13097 0.07% 114 14009 0.07% 115 14532 0.07% 116 15437 0.08% 117 16644 0.08% 118 17431 0.09% 119 18111 0.09% 120 19031 0.10% 121 19989 0.10% 122 20975 0.11% 123 21900 0.11% 124 23404 0.12% 125 24473 0.12% 126 25282 0.13% 127 26881 0.14% 128 28454 0.14% 129 29928 0.15% 130 31183 0.16% 131 32872 0.17% 132 35013 0.18% 133 36826 0.19% 134 39716 0.20% 135 41767 0.21% 136 44673 0.23% 137 47380 0.24% 138 50533 0.26% 139 55006 0.28% 140 59717 0.30% 141 64969 0.33% 142 73170 0.37% 143 82940 0.42% 144 96413 0.49% 145 116260 0.59% 146 151972 0.77% 147 203491 1.04% 148 320917 1.63% 149 673730 3.43% 150 4051927 20.63% 151 12802801 65.17% 19644215 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=26 prefix-density=0.64 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=64.06 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.8 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=24 prefix-density=0.51 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=29.80 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=5.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958289 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:52:08 Started mapping on | Dec 06 18:52:08 Finished on | Dec 06 18:53:33 Mapping speed, Million of reads per hour | 831.99 Number of input reads | 19644215 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19412270 Uniquely mapped reads % | 98.82% Average mapped length | 298.02 Number of splices: Total | 23210550 Number of splices: Annotated (sjdb) | 21891492 Number of splices: GT/AG | 22914899 Number of splices: GC/AG | 268090 Number of splices: AT/AC | 9288 Number of splices: Non-canonical | 18273 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 135252 % of reads mapped to multiple loci | 0.69% Number of reads mapped to too many loci | 8219 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.17% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 101324 101324 101324 N_multimapping 135252 135252 135252 N_noFeature 660290 18878107 805240 N_ambiguous 461217 2528 73346 UnstrandedReadsAssigned:18290763 PositiveStrandReadsAssigned:531635 NegativeStrandReadsAssigned:18533684 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958289 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958289-trimmed-pair1.fastq SRR6958289-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,644,215 reads, 18,561,156 reads pseudoaligned [quant] estimated average fragment length: 272.23 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52973 SRR6958289.ke.tsv 35125 SRR6958289.se.tsv 88098 total ==> SRR6958289.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.206 0 0 PNS24247 1044 772.77 57.3153 5.97284 PNS24249 1928 1656.77 33.1077 1.60926 PNS24246 1044 772.77 57.3153 5.97284 PNS24248 1044 772.77 57.3153 5.97284 PNS24244 1471 1199.77 20.9464 1.40595 PNS24243 293 78.548 0 0 KQK14069 1603 1331.77 5290.29 319.898 KQK14071 474 217.801 25.8578 9.56075 ==> SRR6958289.se.tsv <== BRADI_1g14170v3 5675 BRADI_1g53295v3 346 BRADI_1g59795v3 214 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 285 BRADI_1g74790v3 104 BRADI_1g09890v3 0 BRADI_1g77505v3 223 BRADI_1g48960v3 0 SRR6958289 completed mapping pipeline successfully