Starting /dee2/code/volunteer_pipeline.sh SRR6958290 current disk space = 1550075174912 free memory = 1596365864 SRR6958290 SRAfilesize 7fe6f738e4797ec84fa9ea98faa56615 SRR6958290.sra SRR6958290.sra file validated SRR6958290 is paired end SRR6958290 is conventional basespace SRR6958290 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958290_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.56425 31.0 18.0 32.0 18.0 33.0 2 30.397 31.0 29.0 33.0 27.0 33.0 3 31.14475 33.0 31.0 33.0 27.0 33.0 4 31.362 33.0 32.0 33.0 28.0 33.0 5 32.15975 33.0 32.0 33.0 31.0 34.0 6 36.09175 38.0 36.0 38.0 33.0 38.0 7 37.0475 38.0 38.0 38.0 36.0 38.0 8 37.32325 38.0 38.0 38.0 36.0 38.0 9 37.3095 38.0 38.0 38.0 37.0 38.0 10-14 37.311949999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.3252 38.0 38.0 38.0 37.0 38.0 20-24 37.38365 38.0 38.0 38.0 37.0 38.0 25-29 37.3235 38.0 38.0 38.0 37.0 38.0 30-34 37.18845 38.0 38.0 38.0 36.6 38.0 35-39 36.927049999999994 38.0 38.0 38.0 35.4 38.0 40-44 37.007999999999996 38.0 38.0 38.0 35.8 38.0 45-49 37.113099999999996 38.0 38.0 38.0 36.0 38.0 50-54 37.02015 38.0 38.0 38.0 35.8 38.0 55-59 36.8505 38.0 38.0 38.0 35.0 38.0 60-64 36.89855 38.0 38.0 38.0 35.0 38.0 65-69 36.8831 38.0 38.0 38.0 35.0 38.0 70-74 36.9594 38.0 38.0 38.0 35.4 38.0 75-79 36.703950000000006 38.0 38.0 38.0 34.0 38.0 80-84 36.32495 38.0 37.6 38.0 33.6 38.0 85-89 36.26145 38.0 37.2 38.0 33.2 38.0 90-94 36.385600000000004 38.0 37.4 38.0 33.6 38.0 95-99 36.4426 38.0 38.0 38.0 34.0 38.0 100-104 36.1671 38.0 37.0 38.0 33.2 38.0 105-109 35.74825 38.0 36.2 38.0 31.0 38.0 110-114 35.703799999999994 38.0 36.0 38.0 30.8 38.0 115-119 35.6048 38.0 36.0 38.0 30.6 38.0 120-124 35.3495 38.0 35.6 38.0 30.0 38.0 125-129 34.8513 38.0 35.0 38.0 27.6 38.0 130-134 34.6827 38.0 35.0 38.0 27.4 38.0 135-139 34.328799999999994 38.0 34.6 38.0 25.0 38.0 140-144 34.0683 38.0 34.4 38.0 23.6 38.0 145-149 32.796049999999994 38.0 33.6 38.0 16.6 38.0 150-151 28.0295 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 2.0 20 3.0 21 6.0 22 1.0 23 5.0 24 9.0 25 7.0 26 25.0 27 31.0 28 30.0 29 47.0 30 60.0 31 81.0 32 102.0 33 150.0 34 238.0 35 427.0 36 923.0 37 1849.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.46606914212548 8.937259923175416 11.241997439180537 43.35467349551856 2 21.3 13.3 37.2 28.199999999999996 3 20.200000000000003 14.75 25.5 39.550000000000004 4 24.025 23.724999999999998 21.75 30.5 5 25.900000000000002 27.250000000000004 25.25 21.6 6 22.45 32.05 24.05 21.45 7 18.2 24.175 39.0 18.625 8 20.974999999999998 23.549999999999997 29.299999999999997 26.174999999999997 9 20.1 20.3 34.925 24.675 10-14 23.005 26.340000000000003 26.105 24.55 15-19 22.994999999999997 25.53 26.075 25.4 20-24 22.99 25.724999999999998 26.185000000000002 25.1 25-29 22.66 26.055 26.424999999999997 24.86 30-34 23.025000000000002 25.885 25.935000000000002 25.155 35-39 22.45 25.77 26.450000000000003 25.330000000000002 40-44 22.485 25.924999999999997 26.36 25.230000000000004 45-49 22.485 25.45 26.224999999999998 25.840000000000003 50-54 23.265 24.85 26.174999999999997 25.71 55-59 22.655 25.83 25.91 25.605 60-64 22.82 24.995 25.979999999999997 26.205000000000002 65-69 22.785 25.755 25.735000000000003 25.724999999999998 70-74 23.36 25.4 26.015 25.224999999999998 75-79 23.175 25.55 26.174999999999997 25.1 80-84 22.585 25.27 26.16 25.985000000000003 85-89 23.135 25.455 25.56 25.85 90-94 23.189999999999998 26.115 25.735000000000003 24.959999999999997 95-99 23.18 25.019999999999996 26.584999999999997 25.215 100-104 23.59 25.009999999999998 26.235000000000003 25.165 105-109 23.28 25.929999999999996 25.415 25.374999999999996 110-114 22.665 25.650000000000002 26.179999999999996 25.505 115-119 23.665 25.405 25.419999999999998 25.509999999999998 120-124 23.315 24.85 25.96 25.874999999999996 125-129 23.255 25.515 25.619999999999997 25.61 130-134 23.48 25.314999999999998 25.515 25.69 135-139 23.294999999999998 24.91 26.275 25.52 140-144 23.605 25.569999999999997 25.629999999999995 25.195 145-149 23.465 25.345000000000002 25.915 25.275 150-151 23.380845211302827 24.76869217304326 25.49387346836709 26.356589147286826 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 2.5 26 2.0 27 1.0 28 1.5 29 4.5 30 9.0 31 12.5 32 17.5 33 20.5 34 22.5 35 30.5 36 44.0 37 67.0 38 81.0 39 102.5 40 134.0 41 161.5 42 182.5 43 190.0 44 213.0 45 215.0 46 197.0 47 191.5 48 197.5 49 194.0 50 176.5 51 165.5 52 152.0 53 125.5 54 112.0 55 105.5 56 91.0 57 86.5 58 77.0 59 73.0 60 73.0 61 69.0 62 62.5 63 51.5 64 49.0 65 43.5 66 35.5 67 31.0 68 29.5 69 26.0 70 18.0 71 13.0 72 11.0 73 8.0 74 4.5 75 5.5 76 3.0 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.37688442211055273 0.75 3 0.02512562814070352 0.075 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.6125 0.0 0.0 0.0 0.0 132-133 1.7 0.0 0.0 0.0 0.0 134-135 1.9625000000000001 0.0 0.0 0.0 0.0 136-137 2.2625 0.0 0.0 0.0 0.0 138-139 2.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTGTG 10 0.006836113 144.9625 4 CACACAC 20 0.005942617 28.992498 70-74 >>END_MODULE SRR6958290 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958290_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.876 33.0 33.0 34.0 32.0 34.0 2 32.9165 33.0 33.0 34.0 32.0 34.0 3 32.96875 34.0 33.0 34.0 32.0 34.0 4 32.95075 34.0 33.0 34.0 32.0 34.0 5 32.94275 34.0 33.0 34.0 32.0 34.0 6 37.027 38.0 38.0 38.0 36.0 38.0 7 36.95225 38.0 38.0 38.0 36.0 38.0 8 36.89825 38.0 38.0 38.0 35.0 38.0 9 36.954 38.0 38.0 38.0 36.0 38.0 10-14 36.902750000000005 38.0 38.0 38.0 35.6 38.0 15-19 36.848349999999996 38.0 38.0 38.0 35.4 38.0 20-24 36.92215 38.0 38.0 38.0 35.8 38.0 25-29 36.920249999999996 38.0 38.0 38.0 35.6 38.0 30-34 36.96425000000001 38.0 38.0 38.0 36.0 38.0 35-39 36.86835 38.0 38.0 38.0 35.4 38.0 40-44 36.8021 38.0 38.0 38.0 35.0 38.0 45-49 36.85015 38.0 38.0 38.0 35.0 38.0 50-54 36.761 38.0 38.0 38.0 35.2 38.0 55-59 36.744299999999996 38.0 38.0 38.0 35.0 38.0 60-64 36.828250000000004 38.0 38.0 38.0 35.2 38.0 65-69 36.69435 38.0 38.0 38.0 34.4 38.0 70-74 36.48095000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.28785 38.0 38.0 38.0 33.4 38.0 80-84 36.1553 38.0 37.8 38.0 33.2 38.0 85-89 36.0732 38.0 37.2 38.0 32.2 38.0 90-94 36.050349999999995 38.0 37.0 38.0 33.0 38.0 95-99 35.9173 38.0 37.0 38.0 32.2 38.0 100-104 35.6727 38.0 37.0 38.0 30.8 38.0 105-109 35.541549999999994 38.0 36.4 38.0 30.6 38.0 110-114 35.2885 38.0 36.0 38.0 29.0 38.0 115-119 34.89645 38.0 35.0 38.0 27.2 38.0 120-124 34.89795 38.0 35.0 38.0 27.6 38.0 125-129 34.56705 38.0 35.0 38.0 26.0 38.0 130-134 34.122 38.0 34.4 38.0 23.2 38.0 135-139 33.66165 38.0 34.0 38.0 21.8 38.0 140-144 33.35535 38.0 33.6 38.0 19.8 38.0 145-149 32.390350000000005 38.0 32.8 38.0 13.2 38.0 150-151 27.750999999999998 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 3.0 14 2.0 15 2.0 16 2.0 17 4.0 18 4.0 19 9.0 20 3.0 21 13.0 22 10.0 23 15.0 24 15.0 25 21.0 26 25.0 27 32.0 28 45.0 29 47.0 30 72.0 31 67.0 32 111.0 33 163.0 34 238.0 35 325.0 36 747.0 37 2017.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.449999999999996 16.725 12.75 36.075 2 29.189594797398698 23.386693346673336 28.489244622311155 18.934467233616807 3 22.536268134067033 24.487243621810904 28.61430715357679 24.362181090545274 4 26.394796097072803 29.572179134350762 21.79134350763072 22.241681260945708 5 27.52064048036027 32.724543407555664 21.065799349512133 18.689016762571928 6 22.25 36.075 20.974999999999998 20.7 7 23.35 19.7 34.300000000000004 22.650000000000002 8 23.775 23.525 24.95 27.750000000000004 9 24.474999999999998 22.175 28.825 24.525 10-14 25.814999999999998 26.195 23.685000000000002 24.305 15-19 25.419999999999998 25.245 25.145 24.19 20-24 26.13 25.869999999999997 24.315 23.685000000000002 25-29 25.945 25.825 24.610000000000003 23.62 30-34 25.85 25.314999999999998 24.759999999999998 24.075 35-39 25.97 25.935000000000002 24.709999999999997 23.385 40-44 25.56 25.474999999999998 24.73 24.235 45-49 25.85 26.105 24.16 23.885 50-54 25.385 25.03 25.28 24.305 55-59 26.02 25.91 24.455 23.615 60-64 25.629999999999995 25.259999999999998 25.324999999999996 23.785 65-69 25.905 26.055 24.165 23.875 70-74 26.11 25.650000000000002 24.585 23.655 75-79 25.679999999999996 25.805 25.025 23.49 80-84 25.775 26.064999999999998 24.565 23.595 85-89 25.46 25.295 24.834999999999997 24.41 90-94 25.405 25.645 25.4 23.549999999999997 95-99 25.95 26.179999999999996 24.64 23.23 100-104 26.02 26.205000000000002 24.435000000000002 23.34 105-109 25.45 25.845000000000002 24.935 23.77 110-114 26.08 26.11 24.765 23.044999999999998 115-119 25.840000000000003 25.83 24.7 23.630000000000003 120-124 26.075 25.929999999999996 25.1 22.895 125-129 25.81 26.275 24.635 23.28 130-134 26.1 26.009999999999998 24.945 22.945 135-139 26.0 26.435 24.665 22.900000000000002 140-144 26.584999999999997 25.55 24.965 22.900000000000002 145-149 26.11 26.875 24.635 22.38 150-151 26.331582895723933 26.756689172293076 23.768442110527634 23.143285821455365 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 0.5 25 0.0 26 2.5 27 5.0 28 3.0 29 4.0 30 8.0 31 9.5 32 11.5 33 15.0 34 17.5 35 34.5 36 54.5 37 57.0 38 67.5 39 93.5 40 118.0 41 135.5 42 157.0 43 173.5 44 190.0 45 206.5 46 209.0 47 201.0 48 180.5 49 159.0 50 158.0 51 162.0 52 147.5 53 128.5 54 112.5 55 106.5 56 98.0 57 96.5 58 91.0 59 79.0 60 85.5 61 85.5 62 77.0 63 65.0 64 66.5 65 59.5 66 46.0 67 46.5 68 42.0 69 34.0 70 28.5 71 19.0 72 10.5 73 13.5 74 13.5 75 7.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0632911392405 97.82499999999999 2 0.7594936708860759 1.5 3 0.10126582278481014 0.3 4 0.025316455696202535 0.1 5 0.025316455696202535 0.125 6 0.025316455696202535 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7749999999999999 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.5125000000000002 0.0 0.0 0.0 0.0 130-131 1.65 0.0 0.0 0.0 0.0 132-133 1.725 0.0 0.0 0.0 0.0 134-135 2.0 0.0 0.0 0.0 0.0 136-137 2.3125 0.0 0.0 0.0 0.0 138-139 2.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCGTTT 10 0.006830828 145.0 5 CCCCGTT 10 0.006830828 145.0 4 >>END_MODULE Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123442 spots for SRR6958290.sra Written 1123442 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra Read 1123435 spots for SRR6958290.sra Written 1123435 spots for SRR6958290.sra SRR ids: ['SRR6958290.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h0mgso31 SRR6958290.sra spots: 22468707 blocks: [[1, 1123435], [1123436, 2246870], [2246871, 3370305], [3370306, 4493740], [4493741, 5617175], [5617176, 6740610], [6740611, 7864045], [7864046, 8987480], [8987481, 10110915], [10110916, 11234350], [11234351, 12357785], [12357786, 13481220], [13481221, 14604655], [14604656, 15728090], [15728091, 16851525], [16851526, 17974960], [17974961, 19098395], [19098396, 20221830], [20221831, 21345265], [21345266, 22468707]] SRR6958290 file size 7592207 SRR6958290 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958290 SRR6958290_1.fastq SRR6958290_2.fastq Input file: SRR6958290_1.fastq Paired file: SRR6958290_2.fastq trimmed: SRR6958290-trimmed-pair1.fastq, SRR6958290-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:53:43 2024 >> started Fri Dec 6 18:54:09 2024 >> done (26.398s) 22468707 read pairs processed; of these: 9326 ( 0.04%) short read pairs filtered out after trimming by size control 5663 ( 0.03%) empty read pairs filtered out after trimming by size control 22453718 (99.93%) read pairs available; of these: 7951587 (35.41%) trimmed read pairs available after processing 14502131 (64.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 5 0.00% 21 8 0.00% 22 4 0.00% 23 7 0.00% 24 7 0.00% 25 5 0.00% 26 6 0.00% 27 6 0.00% 28 6 0.00% 29 8 0.00% 30 11 0.00% 31 9 0.00% 32 4 0.00% 33 7 0.00% 34 7 0.00% 35 8 0.00% 36 6 0.00% 37 8 0.00% 38 9 0.00% 39 18 0.00% 40 12 0.00% 41 14 0.00% 42 14 0.00% 43 20 0.00% 44 13 0.00% 45 21 0.00% 46 18 0.00% 47 30 0.00% 48 16 0.00% 49 37 0.00% 50 26 0.00% 51 36 0.00% 52 33 0.00% 53 35 0.00% 54 45 0.00% 55 43 0.00% 56 55 0.00% 57 66 0.00% 58 57 0.00% 59 82 0.00% 60 67 0.00% 61 101 0.00% 62 99 0.00% 63 109 0.00% 64 91 0.00% 65 157 0.00% 66 130 0.00% 67 163 0.00% 68 195 0.00% 69 228 0.00% 70 249 0.00% 71 268 0.00% 72 297 0.00% 73 347 0.00% 74 365 0.00% 75 418 0.00% 76 477 0.00% 77 556 0.00% 78 633 0.00% 79 684 0.00% 80 765 0.00% 81 808 0.00% 82 918 0.00% 83 1068 0.00% 84 1611 0.01% 85 2028 0.01% 86 2172 0.01% 87 2275 0.01% 88 2460 0.01% 89 2537 0.01% 90 2717 0.01% 91 2854 0.01% 92 3070 0.01% 93 3328 0.01% 94 3668 0.02% 95 3873 0.02% 96 4113 0.02% 97 4568 0.02% 98 4832 0.02% 99 5093 0.02% 100 5511 0.02% 101 5880 0.03% 102 6331 0.03% 103 6828 0.03% 104 7017 0.03% 105 7557 0.03% 106 8070 0.04% 107 8748 0.04% 108 9287 0.04% 109 9883 0.04% 110 10407 0.05% 111 10988 0.05% 112 11772 0.05% 113 12739 0.06% 114 13503 0.06% 115 14436 0.06% 116 15379 0.07% 117 15944 0.07% 118 17094 0.08% 119 17906 0.08% 120 18770 0.08% 121 20015 0.09% 122 20782 0.09% 123 22100 0.10% 124 23315 0.10% 125 24987 0.11% 126 25990 0.12% 127 27720 0.12% 128 29406 0.13% 129 31177 0.14% 130 32780 0.15% 131 35360 0.16% 132 37476 0.17% 133 40342 0.18% 134 43189 0.19% 135 46116 0.21% 136 49557 0.22% 137 53549 0.24% 138 57425 0.26% 139 62721 0.28% 140 68191 0.30% 141 75690 0.34% 142 85027 0.38% 143 97284 0.43% 144 115112 0.51% 145 140659 0.63% 146 177628 0.79% 147 245694 1.09% 148 389588 1.74% 149 808042 3.60% 150 4769395 21.24% 151 14502131 64.59% 22453718 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=26 prefix-density=0.83 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=42.95 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=25 prefix-density=0.60 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=366.40 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=15.9 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958290 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:54:56 Started mapping on | Dec 06 18:54:56 Finished on | Dec 06 18:56:53 Mapping speed, Million of reads per hour | 690.88 Number of input reads | 22453718 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 22092007 Uniquely mapped reads % | 98.39% Average mapped length | 298.29 Number of splices: Total | 26313921 Number of splices: Annotated (sjdb) | 24787442 Number of splices: GT/AG | 25972621 Number of splices: GC/AG | 310737 Number of splices: AT/AC | 9996 Number of splices: Non-canonical | 20567 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 137015 % of reads mapped to multiple loci | 0.61% Number of reads mapped to too many loci | 10807 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.64% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 230733 230733 230733 N_multimapping 137015 137015 137015 N_noFeature 820090 21460154 1000454 N_ambiguous 538818 2980 88939 UnstrandedReadsAssigned:20733099 PositiveStrandReadsAssigned:628873 NegativeStrandReadsAssigned:21002614 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958290 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958290-trimmed-pair1.fastq SRR6958290-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,453,718 reads, 21,027,588 reads pseudoaligned [quant] estimated average fragment length: 281.764 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR6958290.ke.tsv 35125 SRR6958290.se.tsv 88098 total ==> SRR6958290.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 655.866 0 0 PNS24247 1044 763.236 72.3864 6.85337 PNS24249 1928 1647.24 38.7996 1.70207 PNS24246 1044 763.236 72.3864 6.85337 PNS24248 1044 763.236 72.3864 6.85337 PNS24244 1471 1190.24 34.0412 2.06671 PNS24243 293 75.7727 0 0 KQK14069 1603 1322.24 5108.66 279.193 KQK14071 474 211.468 55.7324 19.0445 ==> SRR6958290.se.tsv <== BRADI_1g14170v3 5683 BRADI_1g53295v3 452 BRADI_1g59795v3 292 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 290 BRADI_1g74790v3 109 BRADI_1g09890v3 0 BRADI_1g77505v3 247 BRADI_1g48960v3 0 SRR6958290 completed mapping pipeline successfully