Starting /dee2/code/volunteer_pipeline.sh SRR6958291 current disk space = 1516058685440 free memory = 1596821124 SRR6958291 SRAfilesize fa01a72d6367f7c04b4487e244ae7f74 SRR6958291.sra SRR6958291.sra file validated SRR6958291 is paired end SRR6958291 is conventional basespace SRR6958291 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958291_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.01275 32.0 25.0 33.0 18.0 34.0 2 31.35325 33.0 30.0 33.0 27.0 34.0 3 32.47475 33.0 33.0 34.0 30.0 34.0 4 32.9175 33.0 33.0 34.0 31.0 34.0 5 32.8975 33.0 33.0 34.0 31.0 34.0 6 36.93825 38.0 37.0 38.0 36.0 38.0 7 37.33 38.0 38.0 38.0 37.0 38.0 8 37.6435 38.0 38.0 38.0 38.0 38.0 9 37.1225 38.0 38.0 38.0 36.0 38.0 10-14 37.273 38.0 38.0 38.0 36.2 38.0 15-19 37.6379 38.0 38.0 38.0 38.0 38.0 20-24 37.5486 38.0 38.0 38.0 37.8 38.0 25-29 37.541250000000005 38.0 38.0 38.0 37.6 38.0 30-34 37.60594999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.52875 38.0 38.0 38.0 37.8 38.0 40-44 37.6265 38.0 38.0 38.0 38.0 38.0 45-49 37.53529999999999 38.0 38.0 38.0 37.8 38.0 50-54 37.43665 38.0 38.0 38.0 37.0 38.0 55-59 37.22605 38.0 38.0 38.0 36.4 38.0 60-64 37.350750000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.25865 38.0 38.0 38.0 36.6 38.0 70-74 37.139300000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.8496 38.0 37.8 38.0 34.8 38.0 80-84 37.07995 38.0 38.0 38.0 36.0 38.0 85-89 37.0587 38.0 38.0 38.0 36.0 38.0 90-94 36.93679999999999 38.0 38.0 38.0 35.4 38.0 95-99 36.8457 38.0 38.0 38.0 35.0 38.0 100-104 36.634100000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.5023 38.0 38.0 38.0 34.0 38.0 110-114 36.29925000000001 38.0 37.4 38.0 33.8 38.0 115-119 36.098299999999995 38.0 37.0 38.0 33.2 38.0 120-124 35.96435 38.0 37.0 38.0 32.0 38.0 125-129 35.58710000000001 38.0 36.2 38.0 31.0 38.0 130-134 35.283249999999995 38.0 35.8 38.0 30.0 38.0 135-139 35.134750000000004 38.0 35.8 38.0 29.8 38.0 140-144 34.747699999999995 38.0 35.0 38.0 28.6 38.0 145-149 33.64235000000001 38.0 34.0 38.0 21.8 38.0 150-151 27.54775 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 1.0 18 1.0 19 3.0 20 2.0 21 0.0 22 3.0 23 11.0 24 3.0 25 11.0 26 9.0 27 12.0 28 12.0 29 22.0 30 40.0 31 51.0 32 61.0 33 112.0 34 176.0 35 318.0 36 832.0 37 2318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.86777920410783 11.78433889602054 8.65211810012837 42.69576379974326 2 20.525 13.4 39.225 26.85 3 19.225 16.625 26.375 37.775 4 24.6 25.2 21.3 28.9 5 26.375 29.65 24.275 19.7 6 22.25 34.949999999999996 22.875 19.925 7 16.825000000000003 25.4 39.775 18.0 8 18.65 25.575 32.375 23.400000000000002 9 18.224999999999998 23.7 34.525 23.549999999999997 10-14 21.02 28.68 27.155 23.145 15-19 21.58 27.525 27.52 23.375 20-24 21.597159715971596 27.607760776077605 27.402740274027405 23.392339233923394 25-29 21.235 27.965 26.87 23.93 30-34 21.425 27.36 27.145000000000003 24.07 35-39 21.72 28.01 26.674999999999997 23.595 40-44 21.985 27.534999999999997 26.815 23.665 45-49 21.695 26.979999999999997 27.405 23.919999999999998 50-54 22.045 26.889999999999997 27.155 23.91 55-59 22.11 26.790000000000003 27.01 24.09 60-64 21.995 27.51 26.91 23.585 65-69 22.005 27.38 26.840000000000003 23.775 70-74 21.985 27.08 27.045 23.89 75-79 21.935 27.265 26.86 23.94 80-84 21.605 26.775 27.42 24.2 85-89 21.555 27.365000000000002 26.66 24.42 90-94 21.8 27.055 26.905 24.240000000000002 95-99 21.315 27.365000000000002 26.66 24.66 100-104 21.864372874574915 27.350470094018803 27.030406081216242 23.754750950190036 105-109 21.959999999999997 27.07 26.685 24.285 110-114 22.009713112702148 27.612276573374057 26.540830120662896 23.837180193260902 115-119 22.600991139810784 27.63177654302448 26.145066826850876 23.62216549031386 120-124 22.00160048014404 27.433229968990698 26.32289686906072 24.24227268180454 125-129 22.153769095917855 27.302779864763338 26.62158777861257 23.921863260706235 130-134 21.98588659226265 27.255893098443522 26.425103848656224 24.333116460637605 135-139 22.345000000000002 26.595000000000002 26.534999999999997 24.525 140-144 22.09 26.400000000000002 26.765 24.745 145-149 22.095000000000002 27.169999999999998 26.515 24.22 150-151 21.462500000000002 26.674999999999997 26.7625 25.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 3.5 27 5.0 28 6.0 29 8.5 30 10.0 31 17.5 32 26.5 33 33.0 34 45.5 35 59.0 36 73.0 37 97.5 38 131.5 39 150.5 40 166.5 41 190.5 42 213.5 43 245.5 44 258.5 45 251.0 46 227.0 47 214.5 48 199.5 49 173.0 50 162.5 51 142.0 52 127.5 53 117.0 54 94.5 55 74.5 56 68.5 57 64.5 58 55.0 59 49.0 60 40.0 61 29.5 62 29.0 63 26.5 64 17.5 65 17.5 66 20.0 67 12.5 68 8.0 69 9.0 70 6.5 71 4.0 72 4.0 73 4.5 74 4.0 75 2.0 76 0.5 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.0 110-114 0.135 115-119 0.11499999999999999 120-124 0.03 125-129 0.17500000000000002 130-134 0.095 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.8375 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.4500000000000002 0.0 0.0 0.0 0.0 122-123 1.4875 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.2249999999999996 0.0 0.0 0.0 0.0 130-131 2.45 0.0 0.0 0.0 0.0 132-133 2.6625 0.0 0.0 0.0 0.0 134-135 2.975 0.0 0.0 0.0 0.0 136-137 3.2875 0.0 0.0 0.0 0.0 138-139 3.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 20 0.005942617 28.992498 25-29 >>END_MODULE SRR6958291 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958291_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6345 33.0 33.0 34.0 31.0 34.0 2 32.14875 33.0 33.0 34.0 27.0 34.0 3 32.81775 33.0 33.0 34.0 32.0 34.0 4 31.78725 33.0 33.0 34.0 27.0 34.0 5 32.763 33.0 33.0 34.0 32.0 34.0 6 37.19925 38.0 38.0 38.0 36.0 38.0 7 37.36775 38.0 38.0 38.0 37.0 38.0 8 37.4595 38.0 38.0 38.0 37.0 38.0 9 37.48175 38.0 38.0 38.0 38.0 38.0 10-14 37.53125 38.0 38.0 38.0 38.0 38.0 15-19 37.45095 38.0 38.0 38.0 37.8 38.0 20-24 37.4994 38.0 38.0 38.0 38.0 38.0 25-29 37.55 38.0 38.0 38.0 38.0 38.0 30-34 37.576100000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.481449999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.203700000000005 38.0 38.0 38.0 36.8 38.0 45-49 37.0011 38.0 38.0 38.0 35.4 38.0 50-54 36.6457 38.0 37.4 38.0 32.6 38.0 55-59 37.43305 38.0 38.0 38.0 37.4 38.0 60-64 37.48685 38.0 38.0 38.0 38.0 38.0 65-69 37.44545 38.0 38.0 38.0 37.6 38.0 70-74 36.312799999999996 38.0 37.8 38.0 32.4 38.0 75-79 37.0179 38.0 38.0 38.0 36.0 38.0 80-84 35.373949999999994 38.0 36.0 38.0 24.8 38.0 85-89 37.118550000000006 38.0 38.0 38.0 36.4 38.0 90-94 37.208 38.0 38.0 38.0 37.0 38.0 95-99 37.09439999999999 38.0 38.0 38.0 36.2 38.0 100-104 36.987649999999995 38.0 38.0 38.0 35.8 38.0 105-109 36.742050000000006 38.0 38.0 38.0 35.0 38.0 110-114 36.796949999999995 38.0 38.0 38.0 35.0 38.0 115-119 36.786 38.0 38.0 38.0 35.4 38.0 120-124 36.557500000000005 38.0 38.0 38.0 34.0 38.0 125-129 36.287 38.0 38.0 38.0 33.2 38.0 130-134 36.0701 38.0 38.0 38.0 33.2 38.0 135-139 35.37215 38.0 36.8 38.0 29.2 38.0 140-144 33.1205 37.6 31.6 38.0 21.8 38.0 145-149 32.634 38.0 32.0 38.0 18.6 38.0 150-151 28.493750000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 2.0 17 1.0 18 2.0 19 1.0 20 1.0 21 4.0 22 4.0 23 8.0 24 9.0 25 3.0 26 10.0 27 11.0 28 19.0 29 15.0 30 27.0 31 49.0 32 64.0 33 106.0 34 154.0 35 316.0 36 846.0 37 2340.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.1 18.925 12.775 36.199999999999996 2 28.625 25.15 29.299999999999997 16.925 3 20.1 27.125 29.7 23.075000000000003 4 23.200000000000003 32.675 22.650000000000002 21.475 5 27.025 34.699999999999996 21.15 17.125 6 21.6 36.725 22.125 19.55 7 21.55 20.549999999999997 37.525 20.375 8 23.025000000000002 24.099999999999998 26.525 26.35 9 22.425 23.35 29.799999999999997 24.425 10-14 24.675 27.134999999999998 25.545 22.645 15-19 24.15 26.805 26.11 22.935 20-24 24.345 26.915 26.155 22.585 25-29 25.295 27.105 25.275 22.325 30-34 24.075 26.740000000000002 26.584999999999997 22.6 35-39 24.595 26.505000000000003 26.495 22.405 40-44 25.205 27.150000000000002 25.5 22.145 45-49 24.529999999999998 27.175 25.94 22.355 50-54 24.625 26.974999999999998 26.224999999999998 22.175 55-59 25.314999999999998 26.555 25.96 22.17 60-64 24.25 27.060000000000002 25.974999999999998 22.715 65-69 25.145 26.224999999999998 26.655 21.975 70-74 24.87 26.284999999999997 26.584999999999997 22.259999999999998 75-79 23.94 27.175 27.075 21.81 80-84 24.515 27.08 26.325 22.08 85-89 24.575 26.645000000000003 26.805 21.975 90-94 24.05 27.0 27.3 21.65 95-99 24.125 27.325 26.43 22.12 100-104 24.635 26.935 26.790000000000003 21.64 105-109 24.115000000000002 27.145000000000003 27.145000000000003 21.595 110-114 24.68 27.045 27.02 21.255 115-119 24.97 26.985 26.655 21.39 120-124 23.905 27.88 26.705000000000002 21.51 125-129 24.715 27.095000000000002 26.68 21.51 130-134 24.985 26.419999999999998 26.965 21.63 135-139 24.79 27.57 26.32 21.32 140-144 24.995 26.615 26.765 21.625 145-149 25.88 26.834999999999997 26.224999999999998 21.060000000000002 150-151 24.675 27.224999999999998 26.775 21.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 2.5 27 6.5 28 6.5 29 7.0 30 10.5 31 14.5 32 18.5 33 25.5 34 36.5 35 42.0 36 50.5 37 77.0 38 114.0 39 142.0 40 163.5 41 184.0 42 203.0 43 216.5 44 230.5 45 245.0 46 240.0 47 217.5 48 190.0 49 189.0 50 179.5 51 155.5 52 129.0 53 106.0 54 98.5 55 84.5 56 78.5 57 70.5 58 69.5 59 64.5 60 46.5 61 38.5 62 38.5 63 37.0 64 33.0 65 29.0 66 22.5 67 18.5 68 18.5 69 14.5 70 9.5 71 7.0 72 5.0 73 3.5 74 3.0 75 2.0 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74918485076498 99.425 2 0.200652119388011 0.4 3 0.025081514923501375 0.075 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.025 0.0 0.0 2 0.0 0.0 0.025 0.0 0.0 3 0.0 0.0 0.025 0.0 0.0 4 0.0 0.0 0.025 0.0 0.0 5 0.0 0.0 0.025 0.0 0.0 6 0.0 0.0 0.025 0.0 0.0 7 0.0 0.0 0.025 0.0 0.0 8 0.0 0.0 0.025 0.0 0.0 9 0.0 0.0 0.025 0.0 0.0 10-11 0.0 0.0 0.025 0.0 0.0 12-13 0.0 0.0 0.025 0.0 0.0 14-15 0.0 0.0 0.025 0.0 0.0 16-17 0.0 0.0 0.025 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.025 0.0 0.025 0.0 0.0 80-81 0.05 0.0 0.025 0.0 0.0 82-83 0.05 0.0 0.025 0.0 0.0 84-85 0.05 0.0 0.025 0.0 0.0 86-87 0.05 0.0 0.025 0.0 0.0 88-89 0.075 0.0 0.025 0.0 0.0 90-91 0.1 0.0 0.025 0.0 0.0 92-93 0.15 0.0 0.025 0.0 0.0 94-95 0.175 0.0 0.025 0.0 0.0 96-97 0.1875 0.0 0.025 0.0 0.0 98-99 0.2375 0.0 0.025 0.0 0.0 100-101 0.275 0.0 0.025 0.0 0.0 102-103 0.32499999999999996 0.0 0.025 0.0 0.0 104-105 0.4 0.0 0.025 0.0 0.0 106-107 0.4375 0.0 0.025 0.0 0.0 108-109 0.5375 0.0 0.025 0.0 0.0 110-111 0.75 0.0 0.025 0.0 0.0 112-113 0.8375 0.0 0.025 0.0 0.0 114-115 1.0 0.0 0.025 0.0 0.0 116-117 1.175 0.0 0.025 0.0 0.0 118-119 1.3125 0.0 0.025 0.0 0.0 120-121 1.4249999999999998 0.0 0.025 0.0 0.0 122-123 1.4625 0.0 0.025 0.0 0.0 124-125 1.5375 0.0 0.025 0.0 0.0 126-127 1.8875000000000002 0.0 0.025 0.0 0.0 128-129 2.2 0.0 0.025 0.0 0.0 130-131 2.425 0.0 0.025 0.0 0.0 132-133 2.6125 0.0 0.025 0.0 0.0 134-135 2.875 0.0 0.025 0.0 0.0 136-137 3.1375 0.0 0.025 0.0 0.0 138-139 3.3375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746059 spots for SRR6958291.sra Written 746059 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra Read 746046 spots for SRR6958291.sra Written 746046 spots for SRR6958291.sra SRR ids: ['SRR6958291.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_evice7yq SRR6958291.sra spots: 14920933 blocks: [[1, 746046], [746047, 1492092], [1492093, 2238138], [2238139, 2984184], [2984185, 3730230], [3730231, 4476276], [4476277, 5222322], [5222323, 5968368], [5968369, 6714414], [6714415, 7460460], [7460461, 8206506], [8206507, 8952552], [8952553, 9698598], [9698599, 10444644], [10444645, 11190690], [11190691, 11936736], [11936737, 12682782], [12682783, 13428828], [13428829, 14174874], [14174875, 14920933]] SRR6958291 file size 5034514 SRR6958291 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958291 SRR6958291_1.fastq SRR6958291_2.fastq Input file: SRR6958291_1.fastq Paired file: SRR6958291_2.fastq trimmed: SRR6958291-trimmed-pair1.fastq, SRR6958291-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:15:07 2024 >> started Thu Dec 12 02:15:23 2024 >> done (16.149s) 14920933 read pairs processed; of these: 6602 ( 0.04%) short read pairs filtered out after trimming by size control 6769 ( 0.05%) empty read pairs filtered out after trimming by size control 14907562 (99.91%) read pairs available; of these: 6169612 (41.39%) trimmed read pairs available after processing 8737950 (58.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 4 0.00% 21 1 0.00% 22 2 0.00% 23 1 0.00% 24 1 0.00% 25 5 0.00% 26 4 0.00% 27 2 0.00% 28 1 0.00% 29 5 0.00% 30 3 0.00% 31 1 0.00% 32 4 0.00% 33 4 0.00% 34 5 0.00% 35 7 0.00% 36 0 0.00% 37 5 0.00% 38 2 0.00% 39 7 0.00% 40 5 0.00% 41 10 0.00% 42 9 0.00% 43 9 0.00% 44 5 0.00% 45 8 0.00% 46 9 0.00% 47 7 0.00% 48 13 0.00% 49 20 0.00% 50 16 0.00% 51 14 0.00% 52 20 0.00% 53 18 0.00% 54 26 0.00% 55 20 0.00% 56 30 0.00% 57 29 0.00% 58 34 0.00% 59 45 0.00% 60 43 0.00% 61 50 0.00% 62 44 0.00% 63 70 0.00% 64 56 0.00% 65 71 0.00% 66 94 0.00% 67 95 0.00% 68 99 0.00% 69 115 0.00% 70 135 0.00% 71 156 0.00% 72 215 0.00% 73 203 0.00% 74 213 0.00% 75 256 0.00% 76 326 0.00% 77 373 0.00% 78 347 0.00% 79 367 0.00% 80 451 0.00% 81 509 0.00% 82 642 0.00% 83 708 0.00% 84 940 0.01% 85 1145 0.01% 86 1163 0.01% 87 1444 0.01% 88 1590 0.01% 89 1629 0.01% 90 1722 0.01% 91 1841 0.01% 92 1963 0.01% 93 2272 0.02% 94 2522 0.02% 95 2598 0.02% 96 2787 0.02% 97 3120 0.02% 98 3217 0.02% 99 3585 0.02% 100 3952 0.03% 101 4102 0.03% 102 4533 0.03% 103 4855 0.03% 104 5293 0.04% 105 5649 0.04% 106 6273 0.04% 107 6520 0.04% 108 6779 0.05% 109 7449 0.05% 110 7821 0.05% 111 8151 0.05% 112 8687 0.06% 113 9449 0.06% 114 9916 0.07% 115 10741 0.07% 116 11302 0.08% 117 11962 0.08% 118 12260 0.08% 119 13066 0.09% 120 13443 0.09% 121 14437 0.10% 122 15224 0.10% 123 16147 0.11% 124 17108 0.11% 125 18346 0.12% 126 18851 0.13% 127 20139 0.14% 128 21285 0.14% 129 22596 0.15% 130 24765 0.17% 131 24931 0.17% 132 26876 0.18% 133 28837 0.19% 134 30739 0.21% 135 33221 0.22% 136 35766 0.24% 137 38746 0.26% 138 40925 0.27% 139 45230 0.30% 140 49305 0.33% 141 54876 0.37% 142 62531 0.42% 143 70845 0.48% 144 83753 0.56% 145 103369 0.69% 146 131881 0.88% 147 182754 1.23% 148 291361 1.95% 149 616944 4.14% 150 3816031 25.60% 151 8737950 58.61% 14907562 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=23 prefix-density=0.37 prefix-fanout=2.8 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=78.12 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.4 sequence=CAGCTGCAGCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCACCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGATAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCGCTTTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCGTGGAATCCATAGTCCATCAAGCGCTTTGCCACATCCTCGGGCTCTATACCAGCAGTTGCCTTAAACCCTCTTAAGTCAATAATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGCTTCTCCAG criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=24 prefix-density=0.34 prefix-fanout=2.9 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=29.04 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=11.3 sequence=AGAAGATCAAGG SRR6958291 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:16:26 Started mapping on | Dec 12 02:16:26 Finished on | Dec 12 02:18:17 Mapping speed, Million of reads per hour | 483.49 Number of input reads | 14907562 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14454041 Uniquely mapped reads % | 96.96% Average mapped length | 297.51 Number of splices: Total | 17305640 Number of splices: Annotated (sjdb) | 16338405 Number of splices: GT/AG | 17073353 Number of splices: GC/AG | 192708 Number of splices: AT/AC | 6932 Number of splices: Non-canonical | 32647 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 178701 % of reads mapped to multiple loci | 1.20% Number of reads mapped to too many loci | 5682 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.58% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 277438 277438 277438 N_multimapping 178701 178701 178701 N_noFeature 660287 14050907 776415 N_ambiguous 339006 1720 52720 UnstrandedReadsAssigned:13454748 PositiveStrandReadsAssigned:401414 NegativeStrandReadsAssigned:13624906 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958291 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958291-trimmed-pair1.fastq SRR6958291-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,907,562 reads, 13,589,902 reads pseudoaligned [quant] estimated average fragment length: 247.62 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR6958291.ke.tsv 35125 SRR6958291.se.tsv 88098 total ==> SRR6958291.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.584 0 0 PNS24247 1044 797.38 42.5417 6.21925 PNS24249 1928 1681.38 26.1063 1.80996 PNS24246 1044 797.38 42.5417 6.21925 PNS24248 1044 797.38 42.5417 6.21925 PNS24244 1471 1224.38 54.2686 5.16678 PNS24243 293 80.7371 0 0 KQK14069 1603 1356.38 1488.87 127.957 KQK14071 474 232.452 24.7261 12.3997 ==> SRR6958291.se.tsv <== BRADI_1g14170v3 1851 BRADI_1g53295v3 2026 BRADI_1g59795v3 120 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 376 BRADI_1g74790v3 122 BRADI_1g09890v3 0 BRADI_1g77505v3 233 BRADI_1g48960v3 0 SRR6958291 completed mapping pipeline successfully