Starting /dee2/code/volunteer_pipeline.sh SRR6958292 current disk space = 1550081474560 free memory = 1602817088 SRR6958292 SRAfilesize aec48ab7cfb5e9f2d4e914f6bebadb1d SRR6958292.sra SRR6958292.sra file validated SRR6958292 is paired end SRR6958292 is conventional basespace SRR6958292 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958292_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.85975 33.0 27.0 33.0 18.0 34.0 2 29.791 31.0 28.0 33.0 25.0 33.0 3 31.488 33.0 31.0 33.0 27.0 34.0 4 32.1885 33.0 32.0 33.0 31.0 34.0 5 32.39475 33.0 33.0 34.0 31.0 34.0 6 36.31625 38.0 37.0 38.0 34.0 38.0 7 36.69625 38.0 37.0 38.0 34.0 38.0 8 37.0745 38.0 38.0 38.0 36.0 38.0 9 37.221 38.0 38.0 38.0 36.0 38.0 10-14 37.260099999999994 38.0 38.0 38.0 36.4 38.0 15-19 37.24545 38.0 38.0 38.0 36.4 38.0 20-24 37.311099999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.1616 38.0 38.0 38.0 36.2 38.0 30-34 37.0684 38.0 38.0 38.0 36.0 38.0 35-39 37.01055 38.0 38.0 38.0 36.0 38.0 40-44 36.938649999999996 38.0 38.0 38.0 35.6 38.0 45-49 37.0364 38.0 38.0 38.0 35.6 38.0 50-54 36.968650000000004 38.0 38.0 38.0 35.4 38.0 55-59 36.77315 38.0 38.0 38.0 34.8 38.0 60-64 36.768800000000006 38.0 38.0 38.0 34.6 38.0 65-69 36.8191 38.0 38.0 38.0 34.8 38.0 70-74 36.86005 38.0 38.0 38.0 35.0 38.0 75-79 36.66035 38.0 38.0 38.0 34.6 38.0 80-84 36.33715 38.0 37.4 38.0 33.4 38.0 85-89 36.081849999999996 38.0 37.0 38.0 32.4 38.0 90-94 36.19355 38.0 37.0 38.0 33.0 38.0 95-99 36.23075 38.0 37.0 38.0 33.0 38.0 100-104 36.031499999999994 38.0 37.0 38.0 32.4 38.0 105-109 35.6879 38.0 36.2 38.0 30.6 38.0 110-114 35.562850000000005 38.0 36.0 38.0 30.2 38.0 115-119 35.51090000000001 38.0 36.0 38.0 31.0 38.0 120-124 35.3521 38.0 35.6 38.0 29.6 38.0 125-129 34.963049999999996 38.0 35.0 38.0 27.8 38.0 130-134 34.7895 38.0 35.0 38.0 27.4 38.0 135-139 34.413700000000006 38.0 34.6 38.0 25.4 38.0 140-144 34.049749999999996 38.0 34.2 38.0 23.6 38.0 145-149 32.961650000000006 38.0 33.4 38.0 17.4 38.0 150-151 28.784 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 1.0 20 2.0 21 5.0 22 3.0 23 3.0 24 10.0 25 9.0 26 17.0 27 14.0 28 36.0 29 47.0 30 83.0 31 86.0 32 129.0 33 158.0 34 251.0 35 424.0 36 903.0 37 1814.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.59840082538045 9.646633995357234 8.047459375806037 41.70750580345628 2 22.7 12.8 36.65 27.85 3 19.875 15.4 26.200000000000003 38.525 4 23.549999999999997 24.575 21.7 30.175 5 24.562281140570285 30.16508254127064 23.936968484242122 21.335667833916958 6 22.35 32.625 23.9 21.125 7 17.05 26.400000000000002 38.75 17.8 8 19.5 24.2 30.125 26.174999999999997 9 18.875 21.675 34.4 25.05 10-14 21.62 27.939999999999998 26.075 24.365000000000002 15-19 22.45 25.655 26.724999999999998 25.169999999999998 20-24 22.63 25.679999999999996 26.784999999999997 24.905 25-29 22.05 26.555 26.095000000000002 25.3 30-34 21.73 25.740000000000002 27.295 25.235000000000003 35-39 22.03 25.865 26.625 25.480000000000004 40-44 22.035 26.235000000000003 26.895000000000003 24.834999999999997 45-49 22.365 26.325 26.640000000000004 24.67 50-54 23.105 25.669999999999998 26.25 24.975 55-59 22.615 26.169999999999998 26.595000000000002 24.62 60-64 22.645 25.515 26.314999999999998 25.525 65-69 22.585 25.97 26.255 25.19 70-74 22.415 26.205000000000002 25.990000000000002 25.39 75-79 22.79 25.495 26.6 25.115 80-84 22.63 26.215 26.405 24.75 85-89 22.564999999999998 25.805 26.56 25.069999999999997 90-94 22.975 25.56 26.195 25.27 95-99 22.650000000000002 25.96 25.82 25.569999999999997 100-104 22.89 25.314999999999998 26.810000000000002 24.985 105-109 23.22 25.064999999999998 26.784999999999997 24.93 110-114 22.439999999999998 25.86 26.490000000000002 25.21 115-119 23.0 25.83 25.755 25.415 120-124 22.105 26.119999999999997 26.1 25.674999999999997 125-129 22.650000000000002 26.555 26.415 24.38 130-134 23.115 26.165 26.055 24.665 135-139 22.825 25.765 26.200000000000003 25.21 140-144 23.544999999999998 25.56 26.455000000000002 24.44 145-149 23.41 25.674999999999997 26.1 24.815 150-151 22.586293146573286 25.275137568784395 26.425712856428213 25.71285642821411 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 1.5 26 0.0 27 2.0 28 4.0 29 4.0 30 9.5 31 14.5 32 14.0 33 16.0 34 25.5 35 38.5 36 50.0 37 74.5 38 105.0 39 117.0 40 143.0 41 170.5 42 192.5 43 226.0 44 244.0 45 238.0 46 223.5 47 230.5 48 211.0 49 176.0 50 153.5 51 135.5 52 133.0 53 121.5 54 100.0 55 84.0 56 75.0 57 68.0 58 65.0 59 62.0 60 60.5 61 60.5 62 53.0 63 44.5 64 39.5 65 33.0 66 30.5 67 30.0 68 21.0 69 15.0 70 16.5 71 14.5 72 14.5 73 15.5 74 9.0 75 3.0 76 3.0 77 2.5 78 1.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.075 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06612821807168 98.125 2 0.9086320040383644 1.7999999999999998 3 0.025239777889954566 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.2000000000000002 0.0 0.0 0.0 0.0 124-125 1.45 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.7375 0.0 0.0 0.0 0.0 130-131 1.95 0.0 0.0 0.0 0.0 132-133 2.1375 0.0 0.0 0.0 0.0 134-135 2.3499999999999996 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATACTT 10 0.006836113 144.9625 7 TTATACT 10 0.006836113 144.9625 6 ATTATAC 10 0.006836113 144.9625 5 AGGTTTT 10 0.006836113 144.9625 4 GTGACAT 10 0.006836113 144.9625 9 GATAGAT 10 0.006836113 144.9625 3 >>END_MODULE SRR6958292 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958292_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8855 33.0 33.0 34.0 32.0 34.0 2 32.88175 33.0 33.0 34.0 32.0 34.0 3 32.876 33.0 33.0 34.0 32.0 34.0 4 32.809 33.0 33.0 34.0 32.0 34.0 5 32.8055 34.0 33.0 34.0 32.0 34.0 6 36.881 38.0 38.0 38.0 35.0 38.0 7 36.80425 38.0 38.0 38.0 35.0 38.0 8 36.84525 38.0 38.0 38.0 35.0 38.0 9 36.754 38.0 38.0 38.0 35.0 38.0 10-14 36.73025 38.0 38.0 38.0 34.6 38.0 15-19 36.6462 38.0 38.0 38.0 34.2 38.0 20-24 36.853750000000005 38.0 38.0 38.0 35.2 38.0 25-29 36.958999999999996 38.0 38.0 38.0 35.8 38.0 30-34 36.92495 38.0 38.0 38.0 35.8 38.0 35-39 36.910349999999994 38.0 38.0 38.0 35.6 38.0 40-44 36.792350000000006 38.0 38.0 38.0 35.0 38.0 45-49 36.68265 38.0 38.0 38.0 34.4 38.0 50-54 36.64365 38.0 38.0 38.0 34.2 38.0 55-59 36.73465 38.0 38.0 38.0 35.0 38.0 60-64 36.6358 38.0 38.0 38.0 34.2 38.0 65-69 36.43765 38.0 38.0 38.0 33.8 38.0 70-74 36.282500000000006 38.0 37.8 38.0 33.4 38.0 75-79 36.32255 38.0 38.0 38.0 33.2 38.0 80-84 36.05995 38.0 37.4 38.0 32.6 38.0 85-89 35.95175 38.0 37.0 38.0 31.8 38.0 90-94 35.85850000000001 38.0 37.0 38.0 31.8 38.0 95-99 35.8315 38.0 37.0 38.0 31.6 38.0 100-104 35.6659 38.0 36.8 38.0 31.0 38.0 105-109 35.386199999999995 38.0 36.0 38.0 29.8 38.0 110-114 34.8596 38.0 35.2 38.0 27.0 38.0 115-119 35.01375 38.0 35.0 38.0 27.8 38.0 120-124 34.73479999999999 38.0 35.0 38.0 27.0 38.0 125-129 34.52929999999999 38.0 35.0 38.0 26.2 38.0 130-134 34.07785 38.0 34.4 38.0 23.2 38.0 135-139 33.75775 38.0 34.0 38.0 22.2 38.0 140-144 33.15905 38.0 33.2 38.0 18.2 38.0 145-149 32.3305 38.0 32.8 38.0 13.8 38.0 150-151 27.04925 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 0.0 5 1.0 6 1.0 7 1.0 8 1.0 9 0.0 10 3.0 11 2.0 12 1.0 13 2.0 14 3.0 15 3.0 16 4.0 17 3.0 18 1.0 19 8.0 20 7.0 21 3.0 22 10.0 23 6.0 24 24.0 25 20.0 26 35.0 27 25.0 28 40.0 29 49.0 30 62.0 31 113.0 32 117.0 33 175.0 34 196.0 35 380.0 36 846.0 37 1855.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.19209604802401 18.90945472736368 11.35567783891946 35.542771385692845 2 29.604604604604607 24.44944944944945 27.7027027027027 18.243243243243242 3 20.801001251564454 27.133917396745932 28.185231539424283 23.879849812265334 4 24.061091637456183 32.8492739108663 20.681021532298445 22.408612919379067 5 26.91537305958938 33.52528793189784 20.205307961942914 19.354031046569855 6 21.575 36.05 22.525000000000002 19.85 7 22.6 19.975 34.925 22.5 8 23.849999999999998 23.400000000000002 26.900000000000002 25.85 9 23.7 22.75 28.925 24.625 10-14 25.275 26.38 24.23 24.115000000000002 15-19 24.86 26.46 24.965 23.715 20-24 25.259999999999998 26.735 24.615000000000002 23.39 25-29 25.236261813090653 26.271313565678284 24.55122756137807 23.941197059852993 30-34 24.8 26.674999999999997 25.31 23.215 35-39 25.56 26.400000000000002 24.615000000000002 23.425 40-44 25.115 26.16 24.86 23.865 45-49 25.385 26.479999999999997 25.135 23.0 50-54 25.445 26.505000000000003 25.509999999999998 22.54 55-59 25.919999999999998 25.990000000000002 24.895 23.195 60-64 25.155 26.195 25.385 23.265 65-69 25.230000000000004 26.119999999999997 25.09 23.56 70-74 25.27 25.89 25.805 23.035 75-79 25.21 26.275 25.775 22.74 80-84 25.52 26.075 25.240000000000002 23.165 85-89 25.45 26.115 25.485000000000003 22.95 90-94 25.445 26.525 25.485000000000003 22.545 95-99 24.965 26.275 25.335 23.425 100-104 25.490000000000002 26.3 25.39 22.82 105-109 25.195 26.25 25.61 22.945 110-114 25.555 26.495 25.695 22.255 115-119 25.685000000000002 26.31 25.095 22.91 120-124 25.805 26.305 25.435000000000002 22.455 125-129 25.41 26.72 25.355 22.515 130-134 26.625 26.275 24.88 22.220000000000002 135-139 24.765 26.669999999999998 26.235000000000003 22.33 140-144 25.75 26.145000000000003 25.919999999999998 22.185 145-149 26.119999999999997 26.200000000000003 25.615 22.065 150-151 26.313156578289142 26.92596298149075 25.212606303151574 21.548274137068535 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 1.5 26 0.5 27 0.5 28 4.0 29 7.5 30 8.5 31 10.0 32 18.0 33 21.5 34 22.0 35 36.0 36 47.0 37 65.0 38 98.0 39 123.0 40 139.5 41 155.5 42 180.5 43 209.5 44 222.0 45 207.5 46 201.0 47 205.5 48 189.5 49 176.0 50 178.5 51 160.5 52 132.0 53 114.5 54 96.0 55 84.0 56 87.5 57 79.5 58 70.5 59 71.5 60 59.0 61 54.5 62 53.5 63 51.5 64 48.0 65 52.0 66 55.5 67 43.0 68 34.5 69 28.5 70 27.0 71 24.5 72 13.5 73 7.0 74 6.5 75 6.5 76 4.5 77 2.0 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.1 3 0.125 4 0.15 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98708533806027 97.725 2 0.8356545961002786 1.6500000000000001 3 0.10129146619397315 0.3 4 0.05064573309698658 0.2 5 0.02532286654849329 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.075 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.5125000000000002 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138-139 2.8499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGACGC 10 0.006830828 145.0 6 >>END_MODULE Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238329 spots for SRR6958292.sra Written 1238329 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra Read 1238318 spots for SRR6958292.sra Written 1238318 spots for SRR6958292.sra SRR ids: ['SRR6958292.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gsykmmly SRR6958292.sra spots: 24766371 blocks: [[1, 1238318], [1238319, 2476636], [2476637, 3714954], [3714955, 4953272], [4953273, 6191590], [6191591, 7429908], [7429909, 8668226], [8668227, 9906544], [9906545, 11144862], [11144863, 12383180], [12383181, 13621498], [13621499, 14859816], [14859817, 16098134], [16098135, 17336452], [17336453, 18574770], [18574771, 19813088], [19813089, 21051406], [21051407, 22289724], [22289725, 23528042], [23528043, 24766371]] SRR6958292 file size 8370810 SRR6958292 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958292 SRR6958292_1.fastq SRR6958292_2.fastq Input file: SRR6958292_1.fastq Paired file: SRR6958292_2.fastq trimmed: SRR6958292-trimmed-pair1.fastq, SRR6958292-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 18:56:50 2024 >> started Fri Dec 6 18:57:16 2024 >> done (26.110s) 24766371 read pairs processed; of these: 12917 ( 0.05%) short read pairs filtered out after trimming by size control 8860 ( 0.04%) empty read pairs filtered out after trimming by size control 24744594 (99.91%) read pairs available; of these: 9180053 (37.10%) trimmed read pairs available after processing 15564541 (62.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 3 0.00% 21 9 0.00% 22 3 0.00% 23 4 0.00% 24 4 0.00% 25 6 0.00% 26 3 0.00% 27 4 0.00% 28 8 0.00% 29 12 0.00% 30 10 0.00% 31 10 0.00% 32 7 0.00% 33 14 0.00% 34 7 0.00% 35 6 0.00% 36 10 0.00% 37 8 0.00% 38 21 0.00% 39 17 0.00% 40 13 0.00% 41 16 0.00% 42 12 0.00% 43 20 0.00% 44 15 0.00% 45 11 0.00% 46 24 0.00% 47 26 0.00% 48 33 0.00% 49 35 0.00% 50 41 0.00% 51 38 0.00% 52 42 0.00% 53 48 0.00% 54 47 0.00% 55 63 0.00% 56 51 0.00% 57 70 0.00% 58 87 0.00% 59 116 0.00% 60 95 0.00% 61 118 0.00% 62 126 0.00% 63 135 0.00% 64 172 0.00% 65 156 0.00% 66 204 0.00% 67 253 0.00% 68 267 0.00% 69 287 0.00% 70 309 0.00% 71 385 0.00% 72 410 0.00% 73 502 0.00% 74 540 0.00% 75 572 0.00% 76 693 0.00% 77 719 0.00% 78 787 0.00% 79 906 0.00% 80 993 0.00% 81 1186 0.00% 82 1340 0.01% 83 1591 0.01% 84 2259 0.01% 85 2809 0.01% 86 2945 0.01% 87 3053 0.01% 88 3282 0.01% 89 3673 0.01% 90 3714 0.02% 91 4042 0.02% 92 4183 0.02% 93 4501 0.02% 94 5010 0.02% 95 5809 0.02% 96 5547 0.02% 97 6098 0.02% 98 6509 0.03% 99 7021 0.03% 100 7413 0.03% 101 7835 0.03% 102 8393 0.03% 103 9175 0.04% 104 9843 0.04% 105 10199 0.04% 106 11041 0.04% 107 11574 0.05% 108 12551 0.05% 109 13184 0.05% 110 14197 0.06% 111 14876 0.06% 112 15797 0.06% 113 17098 0.07% 114 17747 0.07% 115 19031 0.08% 116 20184 0.08% 117 21187 0.09% 118 22619 0.09% 119 23665 0.10% 120 24227 0.10% 121 25727 0.10% 122 27135 0.11% 123 28584 0.12% 124 30506 0.12% 125 32113 0.13% 126 33889 0.14% 127 35914 0.15% 128 37838 0.15% 129 39753 0.16% 130 42387 0.17% 131 44821 0.18% 132 47868 0.19% 133 51198 0.21% 134 54009 0.22% 135 57913 0.23% 136 62575 0.25% 137 66885 0.27% 138 71700 0.29% 139 78246 0.32% 140 85258 0.34% 141 93873 0.38% 142 105643 0.43% 143 121744 0.49% 144 142081 0.57% 145 172047 0.70% 146 219731 0.89% 147 304578 1.23% 148 471039 1.90% 149 958118 3.87% 150 5240861 21.18% 151 15564541 62.90% 24744594 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=25 prefix-density=0.54 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=84.94 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.0 sequence=CAGCTGCAGCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCACCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGATAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCGCTTTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCGTGGAATCCATAGTCCATCAAGCGCTTTGCCACATCCTCGGGCTCTATACCAGCAGTTGCCTTAAACCCTCTTAAGTCAATAATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGCTTCTCCAG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=25 prefix-density=0.43 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=60.42 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.1 sequence=AGAAGGTGCAGTACGCCGTGCGCGGGGAGCTCTACCTCCGCGCCTCCGAGCTCCAGAAGGAGGGCAAGCGGATCATCTTCACCAACGTCGGCAACCCGCACGCCCTCGGCCAGAAGCCCCTCACCTTCCCCCGCCAGGTGGTGGCGCTGTGCCAGGCTCCGTTCCTGCTCGATGATCCCAACGTCGGCCTCATCTTCCCCGCCGATGCCATCGCCCGGGCCAAGCACTACCTCTCCATGGCGCCCGGTGGTTTAGGTGCCTACAGTGACTCCCGAGGTATCCCCGGAGTTAGGAAGGAAGTTGCCGAGTTCATTCAGAGGCGTGACGGGTATCCGAGTGATCCGGAGCTTATTTACCTGACTGATGGTGCCAGCAAAGGTGTGATGCAAATGCTCAACGCCATTATCAGAAACGAGAGAGACGGGATTTTGGTCCCTGTTCCACAATACCCGCTTTATTCTGCAGCCATTTCTCTCTTTGGTGGCTCGCTTGTCCCATATTACTTAGAAGA SRR6958292 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 18:58:04 Started mapping on | Dec 06 18:58:04 Finished on | Dec 06 19:00:50 Mapping speed, Million of reads per hour | 536.63 Number of input reads | 24744594 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 24102198 Uniquely mapped reads % | 97.40% Average mapped length | 297.30 Number of splices: Total | 29441235 Number of splices: Annotated (sjdb) | 27828175 Number of splices: GT/AG | 29037391 Number of splices: GC/AG | 340440 Number of splices: AT/AC | 11706 Number of splices: Non-canonical | 51698 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284796 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 11161 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 366158 366158 366158 N_multimapping 284796 284796 284796 N_noFeature 894870 23398527 1067334 N_ambiguous 617063 2712 87042 UnstrandedReadsAssigned:22590265 PositiveStrandReadsAssigned:700959 NegativeStrandReadsAssigned:22947822 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958292 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958292-trimmed-pair1.fastq SRR6958292-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,744,594 reads, 22,907,128 reads pseudoaligned [quant] estimated average fragment length: 270.065 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR6958292.ke.tsv 35125 SRR6958292.se.tsv 88098 total ==> SRR6958292.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.491 0 0 PNS24247 1044 774.935 72.4693 6.22413 PNS24249 1928 1658.93 25.4024 1.01915 PNS24246 1044 774.935 72.4693 6.22413 PNS24248 1044 774.935 72.4693 6.22413 PNS24244 1471 1201.93 55.1898 3.0561 PNS24243 293 77.8024 0 0 KQK14069 1603 1333.93 3899.23 194.551 KQK14071 474 218.81 51.0332 15.523 ==> SRR6958292.se.tsv <== BRADI_1g14170v3 4451 BRADI_1g53295v3 1933 BRADI_1g59795v3 170 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 523 BRADI_1g74790v3 165 BRADI_1g09890v3 0 BRADI_1g77505v3 407 BRADI_1g48960v3 0 SRR6958292 completed mapping pipeline successfully