Starting /dee2/code/volunteer_pipeline.sh SRR6958293 current disk space = 1550053359616 free memory = 1600425924 SRR6958293 SRAfilesize b1cecfaa75c8f50cd98e03bb7e2757c2 SRR6958293.sra SRR6958293.sra file validated SRR6958293 is paired end SRR6958293 is conventional basespace SRR6958293 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958293_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.95025 33.0 31.0 33.0 18.0 33.0 2 30.56725 33.0 29.0 33.0 27.0 34.0 3 30.97625 33.0 30.0 33.0 27.0 33.0 4 31.31875 33.0 31.0 33.0 28.0 34.0 5 31.6565 33.0 32.0 33.0 30.0 34.0 6 36.28225 38.0 36.0 38.0 33.0 38.0 7 37.00175 38.0 38.0 38.0 35.0 38.0 8 37.18 38.0 38.0 38.0 36.0 38.0 9 37.3495 38.0 38.0 38.0 37.0 38.0 10-14 37.39175 38.0 38.0 38.0 37.0 38.0 15-19 37.41275 38.0 38.0 38.0 37.0 38.0 20-24 37.43505 38.0 38.0 38.0 37.0 38.0 25-29 37.304649999999995 38.0 38.0 38.0 36.8 38.0 30-34 37.2798 38.0 38.0 38.0 36.8 38.0 35-39 37.12045 38.0 38.0 38.0 36.0 38.0 40-44 37.00965 38.0 38.0 38.0 35.8 38.0 45-49 37.15435 38.0 38.0 38.0 36.0 38.0 50-54 37.1582 38.0 38.0 38.0 36.0 38.0 55-59 36.89065 38.0 38.0 38.0 35.2 38.0 60-64 36.996500000000005 38.0 38.0 38.0 35.2 38.0 65-69 36.90325 38.0 38.0 38.0 35.0 38.0 70-74 36.96405 38.0 38.0 38.0 35.4 38.0 75-79 36.66845 38.0 38.0 38.0 34.4 38.0 80-84 36.3731 38.0 37.6 38.0 33.6 38.0 85-89 36.262299999999996 38.0 37.2 38.0 33.4 38.0 90-94 36.4776 38.0 37.6 38.0 33.8 38.0 95-99 36.3667 38.0 37.2 38.0 33.6 38.0 100-104 36.2723 38.0 37.0 38.0 33.4 38.0 105-109 35.993 38.0 36.8 38.0 32.4 38.0 110-114 35.562 38.0 35.8 38.0 30.2 38.0 115-119 35.497499999999995 38.0 36.0 38.0 29.8 38.0 120-124 35.197300000000006 38.0 35.2 38.0 28.8 38.0 125-129 34.93865 38.0 35.2 38.0 27.6 38.0 130-134 34.714299999999994 38.0 35.0 38.0 27.0 38.0 135-139 34.70285 38.0 35.0 38.0 27.4 38.0 140-144 33.999199999999995 38.0 34.0 38.0 23.0 38.0 145-149 32.523849999999996 37.0 33.0 38.0 15.4 38.0 150-151 28.416875 35.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 1.0 22 4.0 23 9.0 24 9.0 25 7.0 26 19.0 27 25.0 28 29.0 29 43.0 30 52.0 31 69.0 32 135.0 33 156.0 34 239.0 35 427.0 36 976.0 37 1798.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.19151138716356 9.187370600414079 8.281573498964804 42.339544513457554 2 22.3 11.525 37.05 29.125 3 20.5 14.35 25.575 39.574999999999996 4 24.4 21.425 23.625 30.55 5 26.26970227670753 26.09457092819615 25.519139354515886 22.116587440580435 6 22.5 31.574999999999996 23.474999999999998 22.45 7 18.325 25.75 36.825 19.1 8 20.175 24.525 30.25 25.05 9 19.8 22.925 33.35 23.925 10-14 22.59 26.32 26.450000000000003 24.64 15-19 22.205 25.264999999999997 26.740000000000002 25.790000000000003 20-24 22.08 26.145000000000003 26.174999999999997 25.6 25-29 22.095000000000002 25.540000000000003 26.57 25.795 30-34 22.720000000000002 25.324999999999996 26.47 25.485000000000003 35-39 22.515 25.674999999999997 26.14 25.669999999999998 40-44 22.919999999999998 26.235000000000003 25.805 25.040000000000003 45-49 22.685 25.835 26.229999999999997 25.25 50-54 22.509999999999998 25.629999999999995 26.14 25.72 55-59 22.55 25.145 26.63 25.674999999999997 60-64 22.37 26.295 25.740000000000002 25.595000000000002 65-69 22.770000000000003 25.1 26.465 25.665 70-74 22.05 25.345000000000002 26.715 25.89 75-79 23.315 24.64 26.43 25.615 80-84 22.98 25.665 26.055 25.3 85-89 22.264999999999997 25.285000000000004 26.47 25.979999999999997 90-94 23.244999999999997 25.245 25.979999999999997 25.53 95-99 22.96 25.525 25.595000000000002 25.919999999999998 100-104 23.34 24.805 26.325 25.53 105-109 22.63 24.884999999999998 26.25 26.235000000000003 110-114 22.7 24.990000000000002 26.13 26.179999999999996 115-119 23.22 25.1 25.845000000000002 25.835 120-124 23.115 25.324999999999996 25.759999999999998 25.8 125-129 23.31 24.795 25.86 26.035000000000004 130-134 23.32 24.905 26.08 25.695 135-139 22.75 25.46 25.89 25.900000000000002 140-144 24.07 24.62 25.135 26.174999999999997 145-149 23.47 25.16 25.83 25.540000000000003 150-151 23.32416208104052 24.824912456228116 26.263131565782892 25.587793896948476 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.5 26 2.5 27 2.0 28 1.5 29 2.5 30 4.5 31 9.5 32 11.0 33 15.0 34 21.5 35 30.0 36 49.5 37 68.0 38 82.5 39 99.0 40 128.5 41 168.0 42 210.5 43 220.0 44 210.5 45 212.0 46 208.0 47 211.5 48 213.5 49 194.0 50 170.0 51 151.5 52 133.0 53 122.0 54 104.5 55 92.5 56 93.5 57 88.5 58 72.5 59 67.0 60 68.0 61 54.5 62 45.5 63 53.0 64 55.0 65 43.5 66 38.5 67 33.0 68 24.5 69 20.5 70 14.0 71 16.5 72 20.0 73 14.0 74 8.5 75 5.0 76 4.0 77 3.0 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4000000000000004 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.6000000000000001 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.9625 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.1124999999999998 0.0 0.0 0.0 0.0 126-127 1.3 0.0 0.0 0.0 0.0 128-129 1.575 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.5375 0.0 0.0 0.0 0.0 138-139 2.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958293 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958293_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.882 33.0 33.0 34.0 32.0 34.0 2 32.93075 33.0 33.0 34.0 32.0 34.0 3 32.8315 33.0 33.0 34.0 32.0 34.0 4 32.804 33.0 33.0 34.0 32.0 34.0 5 32.91175 33.0 33.0 34.0 32.0 34.0 6 37.02825 38.0 38.0 38.0 36.0 38.0 7 36.946 38.0 38.0 38.0 36.0 38.0 8 37.06975 38.0 38.0 38.0 36.0 38.0 9 36.9305 38.0 38.0 38.0 36.0 38.0 10-14 36.84975000000001 38.0 38.0 38.0 35.4 38.0 15-19 36.8495 38.0 38.0 38.0 35.6 38.0 20-24 36.8185 38.0 38.0 38.0 35.6 38.0 25-29 36.91605 38.0 38.0 38.0 35.6 38.0 30-34 37.03915 38.0 38.0 38.0 36.0 38.0 35-39 36.8351 38.0 38.0 38.0 35.4 38.0 40-44 36.84305 38.0 38.0 38.0 35.2 38.0 45-49 36.80415 38.0 38.0 38.0 35.0 38.0 50-54 36.79325 38.0 38.0 38.0 35.0 38.0 55-59 36.703500000000005 38.0 38.0 38.0 34.8 38.0 60-64 36.79895 38.0 38.0 38.0 35.0 38.0 65-69 36.49185 38.0 38.0 38.0 33.8 38.0 70-74 36.47765 38.0 38.0 38.0 34.2 38.0 75-79 36.2667 38.0 37.6 38.0 33.6 38.0 80-84 36.16765 38.0 37.6 38.0 33.2 38.0 85-89 36.040000000000006 38.0 37.4 38.0 32.8 38.0 90-94 35.96065 38.0 37.0 38.0 32.4 38.0 95-99 35.85865 38.0 37.0 38.0 31.4 38.0 100-104 35.74705 38.0 36.8 38.0 31.6 38.0 105-109 35.361799999999995 38.0 36.2 38.0 29.6 38.0 110-114 35.13590000000001 38.0 35.8 38.0 28.8 38.0 115-119 34.90865 38.0 35.0 38.0 27.2 38.0 120-124 34.7665 38.0 35.0 38.0 27.2 38.0 125-129 34.729 38.0 35.0 38.0 27.0 38.0 130-134 34.289100000000005 38.0 34.6 38.0 24.8 38.0 135-139 33.65165 38.0 34.0 38.0 20.6 38.0 140-144 33.21625 38.0 33.6 38.0 18.6 38.0 145-149 32.36035 38.0 32.2 38.0 13.2 38.0 150-151 27.260875 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 0.0 5 0.0 6 2.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 3.0 13 2.0 14 2.0 15 2.0 16 3.0 17 6.0 18 3.0 19 7.0 20 3.0 21 2.0 22 7.0 23 9.0 24 9.0 25 19.0 26 17.0 27 36.0 28 46.0 29 53.0 30 79.0 31 97.0 32 107.0 33 156.0 34 211.0 35 401.0 36 795.0 37 1913.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.749562171628725 17.838378784088064 12.48436327245434 36.92769577182887 2 28.849999999999998 24.05 28.975 18.125 3 21.930482620655166 25.431357839459867 29.457364341085274 23.1807951987997 4 25.6 31.275 21.275 21.85 5 27.981995498874717 30.682670667666915 21.630407601900476 19.70492623155789 6 22.575 37.325 19.725 20.375 7 22.075 20.525 34.275 23.125 8 23.95 23.674999999999997 25.4 26.974999999999998 9 23.400000000000002 22.900000000000002 28.299999999999997 25.4 10-14 25.485000000000003 26.345000000000002 23.84 24.33 15-19 25.035 26.26 24.08 24.625 20-24 25.36 26.029999999999998 24.825 23.785 25-29 26.015 25.795 24.43 23.76 30-34 25.775 25.41 25.264999999999997 23.549999999999997 35-39 25.5 25.974999999999998 24.45 24.075 40-44 25.485000000000003 25.330000000000002 24.6 24.585 45-49 25.785000000000004 26.325 24.69 23.200000000000003 50-54 25.83 26.064999999999998 24.55 23.555 55-59 26.200000000000003 25.895000000000003 24.19 23.715 60-64 26.015 25.955000000000002 24.51 23.52 65-69 25.96 25.674999999999997 24.6 23.765 70-74 26.740000000000002 25.474999999999998 24.51 23.275000000000002 75-79 25.96 25.540000000000003 25.235000000000003 23.265 80-84 25.88 25.88 25.005 23.235 85-89 25.35 25.61 24.955 24.085 90-94 25.95 26.284999999999997 23.919999999999998 23.845 95-99 25.75 25.624999999999996 25.240000000000002 23.385 100-104 26.27 25.845000000000002 24.87 23.015 105-109 25.224999999999998 26.174999999999997 25.52 23.080000000000002 110-114 25.724999999999998 25.895000000000003 24.985 23.395 115-119 26.174999999999997 25.855 24.645 23.325000000000003 120-124 26.085 25.874999999999996 24.9 23.14 125-129 25.985000000000003 26.69 24.18 23.145 130-134 26.974999999999998 25.935000000000002 24.224999999999998 22.865 135-139 26.055 26.51 24.8 22.634999999999998 140-144 26.36 26.174999999999997 24.735 22.73 145-149 26.009999999999998 25.759999999999998 25.3 22.93 150-151 27.163581790895446 26.738369184592298 24.399699849924964 21.698349174587296 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 0.5 26 0.5 27 1.0 28 1.0 29 3.5 30 8.5 31 13.5 32 14.5 33 15.0 34 19.0 35 29.5 36 44.5 37 56.0 38 75.0 39 101.0 40 117.5 41 145.0 42 174.0 43 200.0 44 220.5 45 211.0 46 197.5 47 188.5 48 185.5 49 184.5 50 167.5 51 149.0 52 129.5 53 117.0 54 103.0 55 99.5 56 98.0 57 90.0 58 81.0 59 66.0 60 72.0 61 67.5 62 57.5 63 62.5 64 60.0 65 52.5 66 46.5 67 43.0 68 44.0 69 45.0 70 40.5 71 27.5 72 17.0 73 13.5 74 12.0 75 10.5 76 7.0 77 3.0 78 3.5 79 2.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26786165109822 98.3 2 0.6059075990911386 1.2 3 0.07573844988639232 0.22499999999999998 4 0.0 0.0 5 0.025246149962130777 0.125 6 0.025246149962130777 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 0.9875 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.5125 0.0 0.0 0.0 0.0 130-131 1.7125 0.0 0.0 0.0 0.0 132-133 1.8875 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.4125 0.0 0.0 0.0 0.0 138-139 2.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAAGC 10 0.006830828 145.0 6 >>END_MODULE Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028228 spots for SRR6958293.sra Written 1028228 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra Read 1028212 spots for SRR6958293.sra Written 1028212 spots for SRR6958293.sra SRR ids: ['SRR6958293.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4fs4kwd6 SRR6958293.sra spots: 20564256 blocks: [[1, 1028212], [1028213, 2056424], [2056425, 3084636], [3084637, 4112848], [4112849, 5141060], [5141061, 6169272], [6169273, 7197484], [7197485, 8225696], [8225697, 9253908], [9253909, 10282120], [10282121, 11310332], [11310333, 12338544], [12338545, 13366756], [13366757, 14394968], [14394969, 15423180], [15423181, 16451392], [16451393, 17479604], [17479605, 18507816], [18507817, 19536028], [19536029, 20564256]] SRR6958293 file size 6946851 SRR6958293 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958293 SRR6958293_1.fastq SRR6958293_2.fastq Input file: SRR6958293_1.fastq Paired file: SRR6958293_2.fastq trimmed: SRR6958293-trimmed-pair1.fastq, SRR6958293-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:01:53 2024 >> started Fri Dec 6 19:02:18 2024 >> done (24.808s) 20564256 read pairs processed; of these: 9475 ( 0.05%) short read pairs filtered out after trimming by size control 7121 ( 0.03%) empty read pairs filtered out after trimming by size control 20547660 (99.92%) read pairs available; of these: 7304774 (35.55%) trimmed read pairs available after processing 13242886 (64.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 0 0.00% 22 4 0.00% 23 2 0.00% 24 5 0.00% 25 5 0.00% 26 3 0.00% 27 5 0.00% 28 6 0.00% 29 9 0.00% 30 7 0.00% 31 7 0.00% 32 8 0.00% 33 4 0.00% 34 5 0.00% 35 8 0.00% 36 5 0.00% 37 9 0.00% 38 5 0.00% 39 12 0.00% 40 8 0.00% 41 11 0.00% 42 10 0.00% 43 11 0.00% 44 15 0.00% 45 21 0.00% 46 18 0.00% 47 17 0.00% 48 15 0.00% 49 23 0.00% 50 19 0.00% 51 29 0.00% 52 28 0.00% 53 36 0.00% 54 29 0.00% 55 32 0.00% 56 39 0.00% 57 51 0.00% 58 65 0.00% 59 50 0.00% 60 97 0.00% 61 103 0.00% 62 109 0.00% 63 148 0.00% 64 166 0.00% 65 115 0.00% 66 134 0.00% 67 177 0.00% 68 167 0.00% 69 193 0.00% 70 270 0.00% 71 285 0.00% 72 277 0.00% 73 310 0.00% 74 350 0.00% 75 411 0.00% 76 463 0.00% 77 510 0.00% 78 581 0.00% 79 654 0.00% 80 678 0.00% 81 760 0.00% 82 957 0.00% 83 1057 0.01% 84 1536 0.01% 85 1944 0.01% 86 2093 0.01% 87 2260 0.01% 88 2449 0.01% 89 2615 0.01% 90 2985 0.01% 91 3337 0.02% 92 3150 0.02% 93 3481 0.02% 94 3910 0.02% 95 4092 0.02% 96 4246 0.02% 97 4544 0.02% 98 4775 0.02% 99 5314 0.03% 100 5748 0.03% 101 6047 0.03% 102 6551 0.03% 103 6900 0.03% 104 7389 0.04% 105 7733 0.04% 106 8560 0.04% 107 9215 0.04% 108 9733 0.05% 109 10223 0.05% 110 10872 0.05% 111 11476 0.06% 112 12386 0.06% 113 13272 0.06% 114 13925 0.07% 115 15281 0.07% 116 15878 0.08% 117 16893 0.08% 118 17602 0.09% 119 18524 0.09% 120 19329 0.09% 121 20409 0.10% 122 21618 0.11% 123 22632 0.11% 124 24112 0.12% 125 25438 0.12% 126 26794 0.13% 127 28600 0.14% 128 29822 0.15% 129 31602 0.15% 130 33651 0.16% 131 35798 0.17% 132 37564 0.18% 133 40840 0.20% 134 42625 0.21% 135 45557 0.22% 136 49021 0.24% 137 52544 0.26% 138 55855 0.27% 139 61090 0.30% 140 66263 0.32% 141 72256 0.35% 142 80921 0.39% 143 92008 0.45% 144 107965 0.53% 145 132014 0.64% 146 170445 0.83% 147 225954 1.10% 148 354623 1.73% 149 759368 3.70% 150 4251501 20.69% 151 13242886 64.45% 20547660 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=24 prefix-density=0.50 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=28.02 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=22 prefix-density=0.39 prefix-fanout=2.9 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=83.08 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.5 sequence=TGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAG SRR6958293 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:03:07 Started mapping on | Dec 06 19:03:07 Finished on | Dec 06 19:05:15 Mapping speed, Million of reads per hour | 577.90 Number of input reads | 20547660 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19683161 Uniquely mapped reads % | 95.79% Average mapped length | 297.84 Number of splices: Total | 23574846 Number of splices: Annotated (sjdb) | 22280347 Number of splices: GT/AG | 23259652 Number of splices: GC/AG | 277285 Number of splices: AT/AC | 9671 Number of splices: Non-canonical | 28238 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 292482 % of reads mapped to multiple loci | 1.42% Number of reads mapped to too many loci | 48370 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.95% % of reads unmapped: other | 1.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 577936 577936 577936 N_multimapping 292482 292482 292482 N_noFeature 746790 19154167 892310 N_ambiguous 460762 2319 78558 UnstrandedReadsAssigned:18475609 PositiveStrandReadsAssigned:526675 NegativeStrandReadsAssigned:18712293 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958293 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958293-trimmed-pair1.fastq SRR6958293-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,547,660 reads, 18,757,629 reads pseudoaligned [quant] estimated average fragment length: 265.459 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR6958293.ke.tsv 35125 SRR6958293.se.tsv 88098 total ==> SRR6958293.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.011 0 0 PNS24247 1044 779.541 54.8678 5.43761 PNS24249 1928 1663.54 58.8194 2.7316 PNS24246 1044 779.541 54.8678 5.43761 PNS24248 1044 779.541 54.8678 5.43761 PNS24244 1471 1206.54 26.5771 1.70174 PNS24243 293 79.4018 0 0 KQK14069 1603 1338.54 4383.84 253.018 KQK14071 474 222.63 67.3133 23.3586 ==> SRR6958293.se.tsv <== BRADI_1g14170v3 4834 BRADI_1g53295v3 200 BRADI_1g59795v3 287 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 276 BRADI_1g74790v3 91 BRADI_1g09890v3 0 BRADI_1g77505v3 341 BRADI_1g48960v3 0 SRR6958293 completed mapping pipeline successfully