Starting /dee2/code/volunteer_pipeline.sh SRR6958294 current disk space = 1550047596544 free memory = 1600422836 SRR6958294 SRAfilesize aa4fa5de97e6f9e1b39828b7bdb513f3 SRR6958294.sra SRR6958294.sra file validated SRR6958294 is paired end SRR6958294 is conventional basespace SRR6958294 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958294_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.28825 18.0 18.0 30.0 18.0 32.0 2 21.048 18.0 18.0 25.0 18.0 29.0 3 28.026 28.0 27.0 30.0 25.0 31.0 4 27.2535 29.0 25.0 31.0 15.0 33.0 5 30.3625 32.0 31.0 33.0 25.0 33.0 6 36.03625 37.0 36.0 38.0 33.0 38.0 7 36.785 38.0 37.0 38.0 35.0 38.0 8 36.89725 38.0 38.0 38.0 35.0 38.0 9 37.18025 38.0 38.0 38.0 36.0 38.0 10-14 37.28365000000001 38.0 38.0 38.0 36.6 38.0 15-19 37.295100000000005 38.0 38.0 38.0 36.6 38.0 20-24 37.240750000000006 38.0 38.0 38.0 36.6 38.0 25-29 37.1395 38.0 38.0 38.0 36.0 38.0 30-34 37.004999999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.7474 38.0 38.0 38.0 34.6 38.0 40-44 36.8774 38.0 38.0 38.0 35.4 38.0 45-49 36.617599999999996 38.0 38.0 38.0 34.2 38.0 50-54 36.44965 38.0 37.8 38.0 33.8 38.0 55-59 36.30685 38.0 37.8 38.0 33.4 38.0 60-64 36.7976 38.0 38.0 38.0 34.8 38.0 65-69 36.59725 38.0 38.0 38.0 34.0 38.0 70-74 36.161 38.0 37.4 38.0 32.6 38.0 75-79 35.85545 38.0 37.0 38.0 31.0 38.0 80-84 35.944050000000004 38.0 37.0 38.0 31.8 38.0 85-89 36.14565 38.0 37.2 38.0 32.8 38.0 90-94 36.04325 38.0 37.0 38.0 32.2 38.0 95-99 35.04855 38.0 35.4 38.0 27.4 38.0 100-104 35.048500000000004 38.0 35.2 38.0 28.0 38.0 105-109 34.4289 38.0 34.4 38.0 23.6 38.0 110-114 34.689299999999996 38.0 34.8 38.0 26.2 38.0 115-119 34.046200000000006 38.0 34.0 38.0 22.6 38.0 120-124 34.22815000000001 38.0 34.2 38.0 23.8 38.0 125-129 33.7824 38.0 34.0 38.0 20.4 38.0 130-134 32.97345 37.4 32.8 38.0 16.6 38.0 135-139 32.33669999999999 36.8 32.6 38.0 14.4 38.0 140-144 30.7486 35.6 29.2 38.0 13.4 38.0 145-149 28.472649999999998 34.2 22.8 38.0 2.0 38.0 150-151 24.155625 32.0 7.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 3.0 18 5.0 19 1.0 20 8.0 21 6.0 22 12.0 23 20.0 24 18.0 25 27.0 26 35.0 27 51.0 28 65.0 29 79.0 30 109.0 31 136.0 32 168.0 33 247.0 34 375.0 35 567.0 36 1070.0 37 991.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.49227490676611 18.273841236014917 4.821523708044753 38.41236014917421 2 23.1 16.375 27.6 32.925 3 19.975 16.825000000000003 23.875 39.324999999999996 4 24.425 23.674999999999997 21.85 30.049999999999997 5 25.25 26.650000000000002 22.85 25.25 6 24.775 30.45 23.825 20.95 7 18.3 24.5 37.824999999999996 19.375 8 20.125 24.349999999999998 28.4 27.125 9 18.875 23.599999999999998 31.874999999999996 25.650000000000002 10-14 23.169999999999998 25.729999999999997 26.02 25.080000000000002 15-19 22.830000000000002 24.915000000000003 26.185000000000002 26.07 20-24 23.09 25.635 25.495 25.779999999999998 25-29 23.105 24.68 26.229999999999997 25.985000000000003 30-34 23.155 24.575 26.400000000000002 25.869999999999997 35-39 22.655 24.585 26.090000000000003 26.669999999999998 40-44 23.485 24.654999999999998 26.035000000000004 25.825 45-49 23.425 25.14 25.124999999999996 26.31 50-54 23.53 24.91 25.779999999999998 25.779999999999998 55-59 23.605 24.965 25.915 25.515 60-64 23.3 24.705 25.775 26.22 65-69 23.785 25.009999999999998 24.895 26.31 70-74 23.82 24.565 25.685000000000002 25.929999999999996 75-79 23.990000000000002 24.46 25.89 25.66 80-84 23.3 25.369999999999997 25.345000000000002 25.985000000000003 85-89 23.5 24.34 26.029999999999998 26.13 90-94 24.21 24.525 25.380000000000003 25.885 95-99 24.02 24.92 25.575 25.485000000000003 100-104 23.39 24.775 26.174999999999997 25.66 105-109 23.055 24.75 25.95 26.245 110-114 23.89 24.615000000000002 25.480000000000004 26.015 115-119 23.91 25.03 25.665 25.395 120-124 23.86 24.935 25.224999999999998 25.979999999999997 125-129 23.68 24.44 25.96 25.919999999999998 130-134 24.169999999999998 24.834999999999997 25.15 25.845000000000002 135-139 23.785 25.09 25.590000000000003 25.535000000000004 140-144 23.875 24.69 25.665 25.77 145-149 24.240000000000002 24.055 26.11 25.595000000000002 150-151 23.7875 24.325 25.9625 25.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 1.5 29 2.0 30 5.0 31 8.5 32 9.0 33 12.5 34 22.0 35 33.0 36 37.0 37 51.0 38 71.5 39 87.0 40 103.5 41 135.5 42 173.5 43 193.5 44 197.5 45 212.0 46 233.0 47 226.5 48 216.0 49 191.0 50 166.0 51 151.0 52 133.0 53 116.5 54 107.0 55 101.0 56 93.0 57 85.0 58 69.5 59 77.0 60 79.5 61 63.0 62 61.0 63 63.5 64 64.0 65 63.5 66 52.5 67 39.0 68 34.5 69 33.0 70 34.5 71 25.5 72 14.5 73 16.0 74 12.5 75 7.0 76 5.0 77 3.0 78 2.5 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.3250000000000002 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 1.9125 0.0 0.0 0.0 0.0 126-127 2.175 0.0 0.0 0.0 0.0 128-129 2.5125 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.825 0.0 0.0 0.0 0.0 138-139 4.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958294 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958294_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37775 33.0 33.0 34.0 31.0 34.0 2 32.4115 33.0 33.0 34.0 31.0 34.0 3 32.4855 33.0 33.0 34.0 31.0 34.0 4 32.38075 33.0 33.0 34.0 31.0 34.0 5 32.4405 33.0 33.0 34.0 31.0 34.0 6 35.91025 38.0 38.0 38.0 31.0 38.0 7 36.07775 38.0 38.0 38.0 33.0 38.0 8 36.155 38.0 38.0 38.0 33.0 38.0 9 36.34375 38.0 38.0 38.0 33.0 38.0 10-14 36.24005 38.0 38.0 38.0 33.2 38.0 15-19 36.4133 38.0 38.0 38.0 34.0 38.0 20-24 36.579 38.0 38.0 38.0 34.6 38.0 25-29 36.5314 38.0 38.0 38.0 34.6 38.0 30-34 36.40925 38.0 38.0 38.0 34.0 38.0 35-39 36.3409 38.0 38.0 38.0 33.8 38.0 40-44 36.200649999999996 38.0 38.0 38.0 33.6 38.0 45-49 36.191700000000004 38.0 38.0 38.0 33.8 38.0 50-54 36.10795 38.0 38.0 38.0 33.4 38.0 55-59 36.13115 38.0 37.8 38.0 33.4 38.0 60-64 35.90989999999999 38.0 37.6 38.0 32.6 38.0 65-69 35.8318 38.0 37.2 38.0 32.0 38.0 70-74 35.6728 38.0 37.2 38.0 31.0 38.0 75-79 35.558949999999996 38.0 37.0 38.0 30.2 38.0 80-84 35.39659999999999 38.0 36.8 38.0 29.4 38.0 85-89 35.3249 38.0 36.4 38.0 29.0 38.0 90-94 35.224250000000005 38.0 36.4 38.0 29.4 38.0 95-99 34.84755 38.0 35.6 38.0 27.2 38.0 100-104 34.193349999999995 38.0 34.6 38.0 23.6 38.0 105-109 34.07575 38.0 34.8 38.0 23.0 38.0 110-114 33.892 38.0 34.0 38.0 21.4 38.0 115-119 33.32855 38.0 33.8 38.0 18.6 38.0 120-124 33.2825 38.0 33.8 38.0 17.8 38.0 125-129 32.868199999999995 37.8 33.0 38.0 14.8 38.0 130-134 32.21155 37.4 32.2 38.0 14.0 38.0 135-139 31.357050000000005 36.0 30.4 38.0 13.2 38.0 140-144 30.737599999999997 36.4 29.6 38.0 13.0 38.0 145-149 28.943050000000007 35.2 25.4 38.0 2.0 38.0 150-151 23.224625 29.5 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 10.0 4 5.0 5 2.0 6 3.0 7 1.0 8 3.0 9 2.0 10 3.0 11 0.0 12 2.0 13 1.0 14 7.0 15 3.0 16 3.0 17 5.0 18 6.0 19 11.0 20 17.0 21 7.0 22 18.0 23 21.0 24 29.0 25 26.0 26 56.0 27 56.0 28 54.0 29 77.0 30 101.0 31 124.0 32 137.0 33 204.0 34 300.0 35 486.0 36 855.0 37 1347.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.20980245061265 20.05501375343836 11.877969492373094 28.857214303575894 2 29.099999999999998 24.5 25.5 20.9 3 23.275000000000002 26.3 26.875 23.549999999999997 4 24.9 33.825 19.5 21.775 5 26.05 33.15 20.25 20.549999999999997 6 23.5 33.900000000000006 20.575 22.025 7 21.95 21.625 33.225 23.200000000000003 8 25.974999999999998 23.375 22.75 27.900000000000002 9 23.125 22.225 28.349999999999998 26.3 10-14 25.374999999999996 26.529999999999998 23.085 25.009999999999998 15-19 25.295 26.529999999999998 23.880000000000003 24.295 20-24 25.28 25.919999999999998 24.395 24.404999999999998 25-29 25.655 25.41 24.425 24.51 30-34 25.455 24.98 24.82 24.745 35-39 26.095000000000002 25.505 24.115000000000002 24.285 40-44 25.245 25.56 24.404999999999998 24.79 45-49 25.119999999999997 26.07 24.27 24.54 50-54 25.314999999999998 26.029999999999998 24.465 24.19 55-59 26.400000000000002 25.215 23.97 24.415 60-64 26.700000000000003 25.005 24.310000000000002 23.985 65-69 25.869999999999997 26.05 24.07 24.01 70-74 26.38 24.745 24.67 24.205 75-79 26.674999999999997 25.650000000000002 23.775 23.9 80-84 26.55 25.230000000000004 24.365000000000002 23.855 85-89 25.945 25.03 24.15 24.875 90-94 26.240000000000002 25.45 24.68 23.630000000000003 95-99 25.96 25.629999999999995 24.59 23.82 100-104 26.435 25.3 24.77 23.494999999999997 105-109 26.135 25.455 24.67 23.74 110-114 26.290000000000003 25.535000000000004 24.63 23.544999999999998 115-119 26.445 25.835 24.12 23.599999999999998 120-124 26.36 25.47 24.36 23.810000000000002 125-129 26.700000000000003 25.82 23.765 23.715 130-134 26.919999999999998 25.53 23.84 23.71 135-139 26.85 25.555 24.595 23.0 140-144 26.68 25.66 24.575 23.085 145-149 26.979999999999997 25.165 24.2 23.655 150-151 26.6 25.7625 24.0375 23.599999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.0 25 0.5 26 1.0 27 1.5 28 2.0 29 2.0 30 4.0 31 6.0 32 7.5 33 13.0 34 15.5 35 22.5 36 36.0 37 44.0 38 62.0 39 78.0 40 103.0 41 139.5 42 162.5 43 169.0 44 186.0 45 213.5 46 204.5 47 206.0 48 203.5 49 182.0 50 174.5 51 163.5 52 140.5 53 120.0 54 113.5 55 104.0 56 97.0 57 95.5 58 91.0 59 88.5 60 91.0 61 85.5 62 76.0 63 77.5 64 68.5 65 57.5 66 54.5 67 45.0 68 38.5 69 37.5 70 31.0 71 19.0 72 15.0 73 14.5 74 12.0 75 6.5 76 5.0 77 4.0 78 0.5 79 2.0 80 2.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52201257861634 98.9 2 0.37735849056603776 0.75 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.2999999999999998 0.0 0.0 0.0 0.0 120-121 1.5125 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.8875 0.0 0.0 0.0 0.0 126-127 2.1 0.0 0.0 0.0 0.0 128-129 2.4375 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 3.1875 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.775 0.0 0.0 0.0 0.0 138-139 4.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTCG 10 0.006830828 145.0 4 GAAAAAC 10 0.006830828 145.0 1 AACCTGG 10 0.006830828 145.0 7 AAAACTC 10 0.006830828 145.0 3 AAAAACT 10 0.006830828 145.0 2 >>END_MODULE Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011280 spots for SRR6958294.sra Written 1011280 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra Read 1011269 spots for SRR6958294.sra Written 1011269 spots for SRR6958294.sra SRR ids: ['SRR6958294.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i37q7ptk SRR6958294.sra spots: 20225391 blocks: [[1, 1011269], [1011270, 2022538], [2022539, 3033807], [3033808, 4045076], [4045077, 5056345], [5056346, 6067614], [6067615, 7078883], [7078884, 8090152], [8090153, 9101421], [9101422, 10112690], [10112691, 11123959], [11123960, 12135228], [12135229, 13146497], [13146498, 14157766], [14157767, 15169035], [15169036, 16180304], [16180305, 17191573], [17191574, 18202842], [18202843, 19214111], [19214112, 20225391]] SRR6958294 file size 6832020 SRR6958294 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958294 SRR6958294_1.fastq SRR6958294_2.fastq Input file: SRR6958294_1.fastq Paired file: SRR6958294_2.fastq trimmed: SRR6958294-trimmed-pair1.fastq, SRR6958294-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:03:18 2024 >> started Fri Dec 6 19:03:38 2024 >> done (20.087s) 20225391 read pairs processed; of these: 50879 ( 0.25%) short read pairs filtered out after trimming by size control 48461 ( 0.24%) empty read pairs filtered out after trimming by size control 20126051 (99.51%) read pairs available; of these: 9458198 (46.99%) trimmed read pairs available after processing 10667853 (53.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 11 0.00% 20 4 0.00% 21 1 0.00% 22 9 0.00% 23 8 0.00% 24 7 0.00% 25 9 0.00% 26 13 0.00% 27 11 0.00% 28 10 0.00% 29 12 0.00% 30 6 0.00% 31 19 0.00% 32 13 0.00% 33 11 0.00% 34 8 0.00% 35 15 0.00% 36 8 0.00% 37 13 0.00% 38 12 0.00% 39 16 0.00% 40 13 0.00% 41 14 0.00% 42 23 0.00% 43 25 0.00% 44 35 0.00% 45 28 0.00% 46 35 0.00% 47 38 0.00% 48 41 0.00% 49 49 0.00% 50 50 0.00% 51 56 0.00% 52 78 0.00% 53 50 0.00% 54 88 0.00% 55 84 0.00% 56 77 0.00% 57 114 0.00% 58 118 0.00% 59 122 0.00% 60 156 0.00% 61 186 0.00% 62 172 0.00% 63 196 0.00% 64 222 0.00% 65 243 0.00% 66 270 0.00% 67 296 0.00% 68 348 0.00% 69 413 0.00% 70 434 0.00% 71 502 0.00% 72 549 0.00% 73 584 0.00% 74 695 0.00% 75 774 0.00% 76 863 0.00% 77 935 0.00% 78 1104 0.01% 79 1191 0.01% 80 1298 0.01% 81 1649 0.01% 82 1830 0.01% 83 2271 0.01% 84 4156 0.02% 85 5189 0.03% 86 5162 0.03% 87 5282 0.03% 88 5464 0.03% 89 5621 0.03% 90 5813 0.03% 91 6056 0.03% 92 6456 0.03% 93 6727 0.03% 94 7258 0.04% 95 7821 0.04% 96 8246 0.04% 97 8432 0.04% 98 9378 0.05% 99 9637 0.05% 100 10339 0.05% 101 10803 0.05% 102 11653 0.06% 103 12717 0.06% 104 13536 0.07% 105 14508 0.07% 106 15138 0.08% 107 15771 0.08% 108 16757 0.08% 109 17645 0.09% 110 18625 0.09% 111 19899 0.10% 112 20941 0.10% 113 22047 0.11% 114 23489 0.12% 115 25075 0.12% 116 26644 0.13% 117 27897 0.14% 118 28765 0.14% 119 29849 0.15% 120 31678 0.16% 121 32852 0.16% 122 34463 0.17% 123 37105 0.18% 124 39269 0.20% 125 41381 0.21% 126 43157 0.21% 127 45719 0.23% 128 47548 0.24% 129 50484 0.25% 130 52729 0.26% 131 55095 0.27% 132 58999 0.29% 133 62781 0.31% 134 66120 0.33% 135 70770 0.35% 136 75112 0.37% 137 79660 0.40% 138 84686 0.42% 139 91619 0.46% 140 98247 0.49% 141 107751 0.54% 142 120980 0.60% 143 136265 0.68% 144 158951 0.79% 145 191778 0.95% 146 239237 1.19% 147 324161 1.61% 148 495185 2.46% 149 984054 4.89% 150 4993029 24.81% 151 10667853 53.01% 20126051 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=18 prefix-density=0.81 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=32.18 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=16 prefix-density=0.54 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=46.39 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.7 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958294 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:04:31 Started mapping on | Dec 06 19:04:31 Finished on | Dec 06 19:06:38 Mapping speed, Million of reads per hour | 570.50 Number of input reads | 20126051 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19473532 Uniquely mapped reads % | 96.76% Average mapped length | 295.14 Number of splices: Total | 22459615 Number of splices: Annotated (sjdb) | 21104513 Number of splices: GT/AG | 22150465 Number of splices: GC/AG | 262606 Number of splices: AT/AC | 7909 Number of splices: Non-canonical | 38635 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 214218 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 8053 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 465524 465524 465524 N_multimapping 214218 214218 214218 N_noFeature 561950 18865409 707395 N_ambiguous 534250 2503 72370 UnstrandedReadsAssigned:18377332 PositiveStrandReadsAssigned:605620 NegativeStrandReadsAssigned:18693767 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958294 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958294-trimmed-pair1.fastq SRR6958294-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,126,051 reads, 18,683,609 reads pseudoaligned [quant] estimated average fragment length: 253.14 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR6958294.ke.tsv 35125 SRR6958294.se.tsv 88098 total ==> SRR6958294.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 684.364 0 0 PNS24247 1044 791.86 54.9539 5.47552 PNS24249 1928 1675.86 44.2274 2.08223 PNS24246 1044 791.86 54.9539 5.47552 PNS24248 1044 791.86 54.9539 5.47552 PNS24244 1471 1218.86 37.9109 2.45406 PNS24243 293 86.8637 0 0 KQK14069 1603 1350.86 5410.09 315.987 KQK14071 474 232.547 86.6757 29.4077 ==> SRR6958294.se.tsv <== BRADI_1g14170v3 6204 BRADI_1g53295v3 1096 BRADI_1g59795v3 92 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 370 BRADI_1g74790v3 106 BRADI_1g09890v3 0 BRADI_1g77505v3 235 BRADI_1g48960v3 0 SRR6958294 completed mapping pipeline successfully