Starting /dee2/code/volunteer_pipeline.sh SRR6958295 current disk space = 1550045941760 free memory = 1600430424 SRR6958295 SRAfilesize 5e31f9ac30745325c14e196bdea885a1 SRR6958295.sra SRR6958295.sra file validated SRR6958295 is paired end SRR6958295 is conventional basespace SRR6958295 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958295_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.71875 33.0 31.0 33.0 18.0 34.0 2 31.05275 33.0 31.0 33.0 27.0 34.0 3 31.149 33.0 31.0 33.0 27.0 34.0 4 32.0485 33.0 32.0 33.0 31.0 34.0 5 31.988 33.0 32.0 33.0 30.0 34.0 6 35.814 38.0 36.0 38.0 31.0 38.0 7 36.8335 38.0 37.0 38.0 35.0 38.0 8 36.87725 38.0 38.0 38.0 35.0 38.0 9 37.10725 38.0 38.0 38.0 36.0 38.0 10-14 37.13555 38.0 38.0 38.0 36.0 38.0 15-19 37.11475 38.0 38.0 38.0 36.0 38.0 20-24 37.1903 38.0 38.0 38.0 36.2 38.0 25-29 37.0947 38.0 38.0 38.0 36.0 38.0 30-34 37.008849999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.8733 38.0 38.0 38.0 35.4 38.0 40-44 36.7887 38.0 38.0 38.0 35.0 38.0 45-49 36.92144999999999 38.0 38.0 38.0 35.4 38.0 50-54 36.7829 38.0 38.0 38.0 35.0 38.0 55-59 36.5512 38.0 38.0 38.0 34.2 38.0 60-64 36.535250000000005 38.0 37.8 38.0 33.8 38.0 65-69 36.655649999999994 38.0 38.0 38.0 34.0 38.0 70-74 36.785 38.0 38.0 38.0 34.8 38.0 75-79 36.50675 38.0 37.8 38.0 33.8 38.0 80-84 36.11955 38.0 37.0 38.0 32.6 38.0 85-89 35.93525 38.0 37.0 38.0 31.2 38.0 90-94 36.04775 38.0 37.0 38.0 32.2 38.0 95-99 36.02095 38.0 37.0 38.0 32.4 38.0 100-104 35.776599999999995 38.0 36.6 38.0 31.0 38.0 105-109 35.5946 38.0 36.0 38.0 30.8 38.0 110-114 35.37295 38.0 36.0 38.0 29.4 38.0 115-119 35.34354999999999 38.0 36.0 38.0 29.4 38.0 120-124 35.1493 38.0 35.4 38.0 28.4 38.0 125-129 34.609300000000005 38.0 34.8 38.0 25.8 38.0 130-134 34.505849999999995 38.0 34.8 38.0 26.0 38.0 135-139 34.08284999999999 38.0 34.0 38.0 23.0 38.0 140-144 33.62805 38.0 33.8 38.0 21.0 38.0 145-149 32.449250000000006 37.6 33.2 38.0 15.4 38.0 150-151 27.8515 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 0.0 18 1.0 19 4.0 20 1.0 21 5.0 22 2.0 23 8.0 24 12.0 25 25.0 26 25.0 27 26.0 28 53.0 29 51.0 30 68.0 31 97.0 32 129.0 33 188.0 34 272.0 35 412.0 36 838.0 37 1780.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.32858990944373 9.676584734799484 7.0633893919793005 40.93143596377749 2 20.925 12.15 37.9 29.025000000000002 3 19.6 14.85 26.200000000000003 39.35 4 25.35 23.799999999999997 21.5 29.349999999999998 5 27.163581790895446 26.91345672836418 24.062031015507753 21.860930465232617 6 24.175 31.35 22.425 22.05 7 17.974999999999998 25.674999999999997 36.8 19.55 8 21.2 23.775 30.349999999999998 24.675 9 19.8 22.025 33.4 24.775 10-14 22.615 27.145000000000003 25.585 24.654999999999998 15-19 22.634999999999998 25.290000000000003 26.6 25.474999999999998 20-24 22.42 25.424999999999997 26.590000000000003 25.564999999999998 25-29 22.545 25.85 25.835 25.77 30-34 22.795 25.580000000000002 26.21 25.415 35-39 22.71 25.374999999999996 26.445 25.47 40-44 22.48 25.69 26.090000000000003 25.740000000000002 45-49 22.64 25.715 25.46 26.185000000000002 50-54 22.88 25.705 25.845000000000002 25.569999999999997 55-59 23.35 25.805 25.380000000000003 25.465 60-64 23.095 25.729999999999997 26.105 25.069999999999997 65-69 22.665 25.264999999999997 26.384999999999998 25.685000000000002 70-74 23.69 25.35 25.324999999999996 25.635 75-79 23.07 25.615 25.66 25.655 80-84 23.515 25.44 26.015 25.03 85-89 23.0 26.025 25.155 25.82 90-94 23.21 25.419999999999998 25.705 25.665 95-99 23.419999999999998 24.975 26.16 25.445 100-104 23.935000000000002 25.21 25.919999999999998 24.935 105-109 23.285 25.074999999999996 25.8 25.840000000000003 110-114 23.525 25.445 25.655 25.374999999999996 115-119 23.49 25.790000000000003 24.93 25.790000000000003 120-124 23.48 26.07 25.14 25.31 125-129 23.31 25.335 25.569999999999997 25.785000000000004 130-134 23.89 25.255 25.16 25.695 135-139 23.43 25.485000000000003 25.215 25.869999999999997 140-144 23.494999999999997 25.040000000000003 25.66 25.805 145-149 23.84 25.275 25.259999999999998 25.624999999999996 150-151 23.896461172939855 24.234087782918596 25.397023883956482 26.47242716018507 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.5 28 2.5 29 6.0 30 9.5 31 12.0 32 17.0 33 28.0 34 40.0 35 42.0 36 45.0 37 55.5 38 85.0 39 112.0 40 132.0 41 160.0 42 183.5 43 202.5 44 195.0 45 192.5 46 199.0 47 204.5 48 205.0 49 197.5 50 177.5 51 155.5 52 137.0 53 110.5 54 97.0 55 88.0 56 81.0 57 75.5 58 71.5 59 71.0 60 64.5 61 55.5 62 54.5 63 54.5 64 52.5 65 52.0 66 49.0 67 38.5 68 35.0 69 33.5 70 23.5 71 21.0 72 20.0 73 15.5 74 13.0 75 8.0 76 4.5 77 3.5 78 2.5 79 1.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.375 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1679273827534 98.32499999999999 2 0.8068582955118508 1.6 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.0750000000000002 0.0 0.0 0.0 0.0 124-125 1.1749999999999998 0.0 0.0 0.0 0.0 126-127 1.2999999999999998 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.7374999999999998 0.0 0.0 0.0 0.0 132-133 1.9125 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.5125 0.0 0.0 0.0 0.0 138-139 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958295 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958295_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72875 33.0 33.0 34.0 32.0 34.0 2 32.61775 33.0 33.0 34.0 32.0 34.0 3 32.69875 33.0 33.0 34.0 32.0 34.0 4 32.56325 33.0 33.0 34.0 32.0 34.0 5 32.7085 33.0 33.0 34.0 32.0 34.0 6 36.72875 38.0 38.0 38.0 35.0 38.0 7 36.55775 38.0 38.0 38.0 34.0 38.0 8 36.5905 38.0 38.0 38.0 34.0 38.0 9 36.497 38.0 38.0 38.0 34.0 38.0 10-14 36.4461 38.0 38.0 38.0 33.8 38.0 15-19 36.42415 38.0 38.0 38.0 34.0 38.0 20-24 36.4999 38.0 38.0 38.0 34.0 38.0 25-29 36.71775 38.0 38.0 38.0 35.0 38.0 30-34 36.705149999999996 38.0 38.0 38.0 35.0 38.0 35-39 36.6297 38.0 38.0 38.0 34.6 38.0 40-44 36.52890000000001 38.0 38.0 38.0 34.0 38.0 45-49 36.376149999999996 38.0 38.0 38.0 33.8 38.0 50-54 36.45175 38.0 38.0 38.0 34.0 38.0 55-59 36.47615 38.0 38.0 38.0 34.0 38.0 60-64 36.3677 38.0 38.0 38.0 33.8 38.0 65-69 36.178149999999995 38.0 37.8 38.0 33.4 38.0 70-74 36.0292 38.0 37.2 38.0 32.8 38.0 75-79 36.04455 38.0 37.0 38.0 33.0 38.0 80-84 35.8504 38.0 37.0 38.0 31.2 38.0 85-89 35.6608 38.0 37.0 38.0 30.6 38.0 90-94 35.533849999999994 38.0 36.6 38.0 30.2 38.0 95-99 35.5324 38.0 36.6 38.0 30.4 38.0 100-104 35.342600000000004 38.0 36.0 38.0 29.2 38.0 105-109 35.040299999999995 38.0 35.6 38.0 27.8 38.0 110-114 34.589349999999996 38.0 35.0 38.0 25.4 38.0 115-119 34.6106 38.0 35.0 38.0 25.8 38.0 120-124 34.265600000000006 38.0 34.8 38.0 23.2 38.0 125-129 34.06005 38.0 34.2 38.0 23.2 38.0 130-134 33.73405 38.0 34.0 38.0 21.8 38.0 135-139 33.27695 38.0 34.0 38.0 18.6 38.0 140-144 32.59465 37.6 33.0 38.0 14.2 38.0 145-149 31.5068 37.6 31.8 38.0 10.8 38.0 150-151 26.54725 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 2.0 10 2.0 11 2.0 12 2.0 13 2.0 14 1.0 15 2.0 16 3.0 17 3.0 18 5.0 19 8.0 20 8.0 21 15.0 22 11.0 23 9.0 24 24.0 25 34.0 26 42.0 27 41.0 28 44.0 29 74.0 30 81.0 31 105.0 32 101.0 33 176.0 34 250.0 35 395.0 36 747.0 37 1796.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.51825912956478 17.70885442721361 10.98049024512256 34.79239619809905 2 28.946710032524393 23.592694520890667 27.645734300725543 19.814861145859393 3 22.091568676507382 25.369026770077557 27.820865649236925 24.718538904178132 4 25.5005005005005 31.03103103103103 21.446446446446448 22.02202202202202 5 27.627627627627625 32.207207207207205 21.02102102102102 19.144144144144143 6 22.925 36.825 20.175 20.075000000000003 7 22.1 20.424999999999997 35.075 22.400000000000002 8 24.425 24.575 23.925 27.075 9 25.1 22.2 26.700000000000003 26.0 10-14 26.200000000000003 26.529999999999998 23.075000000000003 24.195 15-19 25.6 25.674999999999997 24.305 24.42 20-24 25.95 25.735000000000003 24.435000000000002 23.880000000000003 25-29 25.740000000000002 26.19 24.29 23.78 30-34 25.96 25.96 24.154999999999998 23.925 35-39 26.064999999999998 25.564999999999998 24.59 23.78 40-44 25.929999999999996 25.345000000000002 24.585 24.14 45-49 25.185000000000002 25.82 24.745 24.25 50-54 25.369999999999997 25.569999999999997 24.959999999999997 24.099999999999998 55-59 25.905 24.995 24.705 24.395 60-64 26.095000000000002 25.330000000000002 24.43 24.145 65-69 26.31 25.52 24.975 23.195 70-74 26.400000000000002 25.835 24.474999999999998 23.29 75-79 25.835 25.75 24.36 24.055 80-84 25.855 25.7 24.95 23.494999999999997 85-89 26.51 25.575 24.4 23.515 90-94 25.72 25.445 25.019999999999996 23.815 95-99 26.145000000000003 25.8 24.545 23.51 100-104 25.974999999999998 25.035 25.36 23.630000000000003 105-109 25.974999999999998 25.21 25.085 23.73 110-114 26.265 25.665 24.755 23.315 115-119 26.11 25.415 24.525 23.95 120-124 25.619999999999997 25.650000000000002 25.095 23.635 125-129 25.619999999999997 25.974999999999998 24.72 23.685000000000002 130-134 26.22 26.13 24.355 23.294999999999998 135-139 26.185000000000002 25.795 24.98 23.04 140-144 26.400000000000002 25.474999999999998 24.795 23.330000000000002 145-149 26.435 26.14 24.675 22.75 150-151 26.835063148680753 26.20982868575716 23.783918969613605 23.17118919594848 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 1.0 27 2.0 28 4.5 29 4.5 30 7.5 31 12.5 32 17.0 33 22.0 34 29.0 35 36.0 36 43.0 37 56.5 38 74.5 39 92.5 40 117.5 41 148.0 42 163.0 43 179.0 44 207.0 45 209.0 46 188.0 47 180.5 48 174.0 49 169.5 50 163.0 51 147.0 52 134.0 53 128.0 54 118.5 55 101.5 56 84.5 57 78.5 58 67.0 59 68.0 60 80.0 61 73.0 62 64.0 63 63.5 64 63.5 65 64.5 66 62.0 67 48.5 68 50.5 69 50.0 70 32.5 71 23.0 72 24.0 73 23.5 74 17.5 75 9.0 76 7.0 77 6.0 78 3.5 79 2.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.075 3 0.075 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09044972208186 98.05 2 0.833754421424962 1.6500000000000001 3 0.05053057099545225 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025265285497726126 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.8375 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0499999999999998 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.4375 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.875 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.4875 0.0 0.0 0.0 0.0 138-139 2.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATCCT 10 0.006830828 145.0 1 GGGGGGG 20 0.00593511 29.0 125-129 >>END_MODULE Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131786 spots for SRR6958295.sra Written 1131786 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra Read 1131767 spots for SRR6958295.sra Written 1131767 spots for SRR6958295.sra SRR ids: ['SRR6958295.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ec84awp9 SRR6958295.sra spots: 22635359 blocks: [[1, 1131767], [1131768, 2263534], [2263535, 3395301], [3395302, 4527068], [4527069, 5658835], [5658836, 6790602], [6790603, 7922369], [7922370, 9054136], [9054137, 10185903], [10185904, 11317670], [11317671, 12449437], [12449438, 13581204], [13581205, 14712971], [14712972, 15844738], [15844739, 16976505], [16976506, 18108272], [18108273, 19240039], [19240040, 20371806], [20371807, 21503573], [21503574, 22635359]] SRR6958295 file size 7648680 SRR6958295 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958295 SRR6958295_1.fastq SRR6958295_2.fastq Input file: SRR6958295_1.fastq Paired file: SRR6958295_2.fastq trimmed: SRR6958295-trimmed-pair1.fastq, SRR6958295-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:04:27 2024 >> started Fri Dec 6 19:04:50 2024 >> done (23.676s) 22635359 read pairs processed; of these: 14593 ( 0.06%) short read pairs filtered out after trimming by size control 10776 ( 0.05%) empty read pairs filtered out after trimming by size control 22609990 (99.89%) read pairs available; of these: 8680747 (38.39%) trimmed read pairs available after processing 13929243 (61.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 6 0.00% 21 9 0.00% 22 4 0.00% 23 7 0.00% 24 6 0.00% 25 7 0.00% 26 7 0.00% 27 5 0.00% 28 14 0.00% 29 12 0.00% 30 21 0.00% 31 11 0.00% 32 9 0.00% 33 13 0.00% 34 10 0.00% 35 17 0.00% 36 14 0.00% 37 8 0.00% 38 15 0.00% 39 19 0.00% 40 20 0.00% 41 19 0.00% 42 19 0.00% 43 16 0.00% 44 13 0.00% 45 27 0.00% 46 26 0.00% 47 36 0.00% 48 31 0.00% 49 34 0.00% 50 35 0.00% 51 45 0.00% 52 64 0.00% 53 50 0.00% 54 59 0.00% 55 75 0.00% 56 74 0.00% 57 69 0.00% 58 75 0.00% 59 104 0.00% 60 103 0.00% 61 112 0.00% 62 127 0.00% 63 155 0.00% 64 192 0.00% 65 189 0.00% 66 224 0.00% 67 209 0.00% 68 254 0.00% 69 287 0.00% 70 321 0.00% 71 354 0.00% 72 431 0.00% 73 468 0.00% 74 497 0.00% 75 567 0.00% 76 660 0.00% 77 701 0.00% 78 801 0.00% 79 897 0.00% 80 1019 0.00% 81 1128 0.00% 82 1326 0.01% 83 1522 0.01% 84 2343 0.01% 85 2814 0.01% 86 3007 0.01% 87 3167 0.01% 88 3484 0.02% 89 3799 0.02% 90 3793 0.02% 91 3966 0.02% 92 4297 0.02% 93 4543 0.02% 94 4974 0.02% 95 5734 0.03% 96 5697 0.03% 97 6145 0.03% 98 6347 0.03% 99 6814 0.03% 100 7381 0.03% 101 7927 0.04% 102 8457 0.04% 103 8920 0.04% 104 9709 0.04% 105 10151 0.04% 106 10956 0.05% 107 11421 0.05% 108 12202 0.05% 109 13089 0.06% 110 14061 0.06% 111 14676 0.06% 112 15611 0.07% 113 16727 0.07% 114 17337 0.08% 115 18855 0.08% 116 19818 0.09% 117 21146 0.09% 118 22472 0.10% 119 22986 0.10% 120 24170 0.11% 121 25587 0.11% 122 27013 0.12% 123 28614 0.13% 124 30045 0.13% 125 31780 0.14% 126 33565 0.15% 127 35588 0.16% 128 37131 0.16% 129 39399 0.17% 130 42049 0.19% 131 44298 0.20% 132 47085 0.21% 133 50477 0.22% 134 54009 0.24% 135 57101 0.25% 136 60781 0.27% 137 65413 0.29% 138 69962 0.31% 139 76622 0.34% 140 83384 0.37% 141 91845 0.41% 142 102915 0.46% 143 117299 0.52% 144 137227 0.61% 145 166631 0.74% 146 211446 0.94% 147 290433 1.28% 148 448032 1.98% 149 908162 4.02% 150 4874200 21.56% 151 13929243 61.61% 22609990 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=25 prefix-density=0.73 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=58.28 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=11 prefix-density=0.50 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=33.34 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958295 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:05:58 Started mapping on | Dec 06 19:05:58 Finished on | Dec 06 19:07:50 Mapping speed, Million of reads per hour | 726.75 Number of input reads | 22609990 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 22196087 Uniquely mapped reads % | 98.17% Average mapped length | 297.49 Number of splices: Total | 25322463 Number of splices: Annotated (sjdb) | 23904547 Number of splices: GT/AG | 25000460 Number of splices: GC/AG | 292583 Number of splices: AT/AC | 9292 Number of splices: Non-canonical | 20128 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 129834 % of reads mapped to multiple loci | 0.57% Number of reads mapped to too many loci | 11328 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 293377 293377 293377 N_multimapping 129834 129834 129834 N_noFeature 741455 21534109 923677 N_ambiguous 560773 2655 82347 UnstrandedReadsAssigned:20893859 PositiveStrandReadsAssigned:659323 NegativeStrandReadsAssigned:21190063 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958295 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958295-trimmed-pair1.fastq SRR6958295-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,609,990 reads, 21,186,408 reads pseudoaligned [quant] estimated average fragment length: 265.02 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR6958295.ke.tsv 35125 SRR6958295.se.tsv 88098 total ==> SRR6958295.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.385 0 0 PNS24247 1044 779.98 69.9798 6.1786 PNS24249 1928 1663.98 40.6639 1.68291 PNS24246 1044 779.98 69.9798 6.1786 PNS24248 1044 779.98 69.9798 6.1786 PNS24244 1471 1206.98 33.3967 1.90548 PNS24243 293 80.5502 0 0 KQK14069 1603 1338.98 7243.69 372.552 KQK14071 474 222.502 104.91 32.4703 ==> SRR6958295.se.tsv <== BRADI_1g14170v3 8044 BRADI_1g53295v3 390 BRADI_1g59795v3 263 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 386 BRADI_1g74790v3 127 BRADI_1g09890v3 0 BRADI_1g77505v3 229 BRADI_1g48960v3 0 SRR6958295 completed mapping pipeline successfully