Starting /dee2/code/volunteer_pipeline.sh SRR6958296 current disk space = 1550037663744 free memory = 1591552692 SRR6958296 SRAfilesize b322f9fdcee159774fb9940885336145 SRR6958296.sra SRR6958296.sra file validated SRR6958296 is paired end SRR6958296 is conventional basespace SRR6958296 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958296_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.08925 31.0 18.0 33.0 18.0 33.0 2 28.664 30.0 27.0 33.0 18.0 33.0 3 30.65375 31.0 29.0 33.0 27.0 33.0 4 31.25775 33.0 31.0 33.0 29.0 33.0 5 32.75075 33.0 33.0 33.0 32.0 34.0 6 36.21125 38.0 36.0 38.0 33.0 38.0 7 37.1945 38.0 38.0 38.0 36.0 38.0 8 36.62725 38.0 38.0 38.0 34.0 38.0 9 37.46625 38.0 38.0 38.0 37.0 38.0 10-14 37.562 38.0 38.0 38.0 38.0 38.0 15-19 37.5392 38.0 38.0 38.0 37.8 38.0 20-24 37.47535 38.0 38.0 38.0 37.8 38.0 25-29 37.47339999999999 38.0 38.0 38.0 37.6 38.0 30-34 37.2277 38.0 38.0 38.0 36.6 38.0 35-39 37.56349999999999 38.0 38.0 38.0 37.8 38.0 40-44 37.5017 38.0 38.0 38.0 38.0 38.0 45-49 37.479299999999995 38.0 38.0 38.0 37.6 38.0 50-54 37.2556 38.0 38.0 38.0 37.0 38.0 55-59 37.3558 38.0 38.0 38.0 37.0 38.0 60-64 37.42925 38.0 38.0 38.0 37.0 38.0 65-69 37.1522 38.0 38.0 38.0 36.4 38.0 70-74 36.362199999999994 38.0 37.0 38.0 30.8 38.0 75-79 37.19265 38.0 38.0 38.0 36.2 38.0 80-84 37.27145 38.0 38.0 38.0 37.0 38.0 85-89 36.2159 38.0 37.2 38.0 30.6 38.0 90-94 34.32185 37.8 34.2 38.0 22.4 38.0 95-99 35.941250000000004 38.0 37.0 38.0 31.6 38.0 100-104 35.560249999999996 38.0 36.2 38.0 30.2 38.0 105-109 35.83855 38.0 36.6 38.0 31.4 38.0 110-114 36.086600000000004 38.0 37.6 38.0 33.0 38.0 115-119 36.4531 38.0 38.0 38.0 34.0 38.0 120-124 36.52105 38.0 38.0 38.0 34.0 38.0 125-129 36.4808 38.0 38.0 38.0 34.0 38.0 130-134 36.392450000000004 38.0 38.0 38.0 34.0 38.0 135-139 36.11365 38.0 37.4 38.0 33.4 38.0 140-144 35.37865 38.0 36.0 38.0 31.0 38.0 145-149 34.87779999999999 38.0 35.8 38.0 29.8 38.0 150-151 30.690875 35.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 1.0 16 1.0 17 0.0 18 1.0 19 2.0 20 0.0 21 3.0 22 0.0 23 3.0 24 7.0 25 11.0 26 5.0 27 14.0 28 25.0 29 29.0 30 40.0 31 50.0 32 77.0 33 114.0 34 146.0 35 329.0 36 903.0 37 2235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.91525423728814 10.82558775287042 8.857299070530345 35.4018589393111 2 27.55 11.825 33.4 27.224999999999998 3 22.3 18.25 24.675 34.775 4 25.8 24.75 21.65 27.800000000000004 5 25.924999999999997 29.225 22.6 22.25 6 22.925 30.575000000000003 24.025 22.475 7 18.35 22.85 39.4 19.400000000000002 8 20.200000000000003 22.6 29.375 27.825 9 20.25 22.25 32.625 24.875 10-14 22.81 25.88 26.105 25.205 15-19 23.165 25.44 25.790000000000003 25.605 20-24 23.530588764944223 25.03126406883097 25.841628732929816 25.596518433294985 25-29 23.189999999999998 25.105 26.11 25.595000000000002 30-34 22.650000000000002 25.115 26.419999999999998 25.814999999999998 35-39 23.14 25.395 26.075 25.39 40-44 23.175 25.28 26.22 25.324999999999996 45-49 23.044999999999998 24.965 25.44 26.55 50-54 23.39 25.31 25.535000000000004 25.765 55-59 23.415 24.91 26.085 25.590000000000003 60-64 23.025000000000002 25.555 25.345000000000002 26.075 65-69 23.535 24.65 25.775 26.040000000000003 70-74 23.695 25.074999999999996 25.595000000000002 25.635 75-79 23.244999999999997 25.115 26.055 25.585 80-84 23.21 24.745 25.89 26.155 85-89 23.745 24.995 25.979999999999997 25.28 90-94 23.835 24.815 25.71 25.64 95-99 23.365 24.33 26.174999999999997 26.13 100-104 23.57 25.080000000000002 25.814999999999998 25.535000000000004 105-109 23.9 24.81 25.405 25.885 110-114 24.025 25.369999999999997 25.685000000000002 24.92 115-119 23.28 25.119999999999997 25.685000000000002 25.915 120-124 23.805 24.86 25.635 25.7 125-129 23.595 25.22 25.03 26.155 130-134 23.695 24.675 25.835 25.795 135-139 24.349999999999998 25.314999999999998 24.64 25.695 140-144 24.025 25.0 25.330000000000002 25.645 145-149 24.415 25.759999999999998 24.345 25.480000000000004 150-151 23.4375 25.5125 24.474999999999998 26.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 2.0 29 2.0 30 6.5 31 13.0 32 15.5 33 17.5 34 27.0 35 37.5 36 41.5 37 54.5 38 86.5 39 105.5 40 118.5 41 152.5 42 170.0 43 180.0 44 197.5 45 200.0 46 195.0 47 209.5 48 206.0 49 181.0 50 171.5 51 147.5 52 126.0 53 129.0 54 119.5 55 103.5 56 96.0 57 83.0 58 81.5 59 82.5 60 82.0 61 73.5 62 67.0 63 66.0 64 59.5 65 54.0 66 46.0 67 40.0 68 31.0 69 25.5 70 25.0 71 19.0 72 13.0 73 15.0 74 10.5 75 4.0 76 3.5 77 1.5 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.045 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.5031446540880503 1.0 3 0.025157232704402514 0.075 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5249999999999999 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.3499999999999996 0.0 0.0 0.0 0.0 122-123 2.6625 0.0 0.0 0.0 0.0 124-125 3.0 0.0 0.0 0.0 0.0 126-127 3.575 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.324999999999999 0.0 0.0 0.0 0.0 132-133 4.775 0.0 0.0 0.0 0.0 134-135 5.325 0.0 0.0 0.0 0.0 136-137 5.800000000000001 0.0 0.0 0.0 0.0 138-139 6.387499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCTA 10 0.0068502324 144.8625 5 GATTGAT 10 0.0068502324 144.8625 5 >>END_MODULE SRR6958296 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958296_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.819 33.0 33.0 34.0 32.0 34.0 2 33.09975 34.0 33.0 34.0 32.0 34.0 3 33.08475 34.0 33.0 34.0 32.0 34.0 4 33.0815 34.0 33.0 34.0 32.0 34.0 5 33.0235 34.0 33.0 34.0 32.0 34.0 6 37.40125 38.0 38.0 38.0 37.0 38.0 7 37.27775 38.0 38.0 38.0 37.0 38.0 8 37.25275 38.0 38.0 38.0 37.0 38.0 9 37.1335 38.0 38.0 38.0 37.0 38.0 10-14 37.10535 38.0 38.0 38.0 37.0 38.0 15-19 36.98175 38.0 38.0 38.0 36.6 38.0 20-24 36.777049999999996 38.0 38.0 38.0 35.8 38.0 25-29 36.78515 38.0 38.0 38.0 35.6 38.0 30-34 37.107400000000005 38.0 38.0 38.0 36.6 38.0 35-39 37.0156 38.0 38.0 38.0 35.8 38.0 40-44 35.9781 38.0 36.2 38.0 31.4 38.0 45-49 36.7604 38.0 37.6 38.0 34.6 38.0 50-54 37.029500000000006 38.0 38.0 38.0 36.4 38.0 55-59 36.99275 38.0 38.0 38.0 36.2 38.0 60-64 35.623749999999994 38.0 35.6 38.0 30.4 38.0 65-69 35.83955 38.0 36.0 38.0 30.8 38.0 70-74 34.951350000000005 37.8 34.2 38.0 27.4 38.0 75-79 36.451 38.0 38.0 38.0 34.2 38.0 80-84 36.464299999999994 38.0 38.0 38.0 34.4 38.0 85-89 36.27569999999999 38.0 38.0 38.0 33.8 38.0 90-94 36.6271 38.0 38.0 38.0 34.8 38.0 95-99 36.6982 38.0 38.0 38.0 35.0 38.0 100-104 36.6403 38.0 38.0 38.0 35.0 38.0 105-109 36.46415 38.0 38.0 38.0 34.2 38.0 110-114 36.39485 38.0 38.0 38.0 34.0 38.0 115-119 36.1354 38.0 38.0 38.0 33.8 38.0 120-124 35.47475 38.0 37.2 38.0 30.2 38.0 125-129 35.41695 38.0 36.4 38.0 30.0 38.0 130-134 35.73805 38.0 37.2 38.0 32.6 38.0 135-139 35.353500000000004 38.0 36.0 38.0 31.0 38.0 140-144 35.067049999999995 38.0 36.0 38.0 31.0 38.0 145-149 34.62565 38.0 36.0 38.0 29.4 38.0 150-151 29.487250000000003 35.5 27.0 38.0 11.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 8.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 2.0 14 0.0 15 2.0 16 2.0 17 1.0 18 4.0 19 4.0 20 8.0 21 8.0 22 5.0 23 7.0 24 13.0 25 18.0 26 16.0 27 23.0 28 30.0 29 29.0 30 46.0 31 58.0 32 88.0 33 111.0 34 146.0 35 277.0 36 671.0 37 2415.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.7 19.775000000000002 11.35 31.175000000000004 2 30.55 23.400000000000002 26.650000000000002 19.400000000000002 3 22.25 25.275 27.250000000000004 25.224999999999998 4 24.474999999999998 32.1 20.9 22.525000000000002 5 26.35 32.1 20.125 21.425 6 23.724999999999998 34.75 20.424999999999997 21.099999999999998 7 22.05 19.925 34.449999999999996 23.575 8 24.075 23.75 22.575 29.599999999999998 9 23.75 23.0 27.85 25.4 10-14 25.89 26.640000000000004 22.935 24.535 15-19 26.035000000000004 25.619999999999997 24.375 23.97 20-24 25.419999999999998 25.95 24.310000000000002 24.32 25-29 25.355 26.095000000000002 23.419999999999998 25.130000000000003 30-34 25.55 25.424999999999997 24.52 24.505 35-39 25.515 25.575 24.175 24.735 40-44 25.895000000000003 25.53 24.385 24.19 45-49 25.69 25.624999999999996 24.610000000000003 24.075 50-54 25.39 25.405 24.765 24.44 55-59 26.0 25.28 24.240000000000002 24.48 60-64 25.7 26.055 23.94 24.305 65-69 26.135 25.624999999999996 24.19 24.05 70-74 25.89 25.009999999999998 24.93 24.169999999999998 75-79 25.885 24.64 25.369999999999997 24.104999999999997 80-84 26.185000000000002 25.75 24.565 23.5 85-89 25.900000000000002 25.145 24.79 24.165 90-94 25.61 25.805 24.895 23.69 95-99 26.245 25.575 24.715 23.465 100-104 26.295 25.34 24.63 23.735 105-109 25.635 25.790000000000003 24.51 24.065 110-114 26.174999999999997 25.985000000000003 24.14 23.7 115-119 26.57 25.729999999999997 24.14 23.56 120-124 26.284999999999997 26.314999999999998 23.705000000000002 23.695 125-129 26.71 25.945 23.575 23.77 130-134 26.965 26.155 23.715 23.165 135-139 26.700000000000003 26.555 24.060000000000002 22.685 140-144 27.08 25.52 24.5 22.900000000000002 145-149 26.615 26.1 24.335 22.95 150-151 26.724999999999998 27.0125 24.075 22.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 1.0 26 0.0 27 0.5 28 1.5 29 2.5 30 4.5 31 7.5 32 10.5 33 15.5 34 19.5 35 26.0 36 39.0 37 55.5 38 70.5 39 90.0 40 120.5 41 151.5 42 168.0 43 166.0 44 175.5 45 198.5 46 202.0 47 194.0 48 194.0 49 183.5 50 161.5 51 139.5 52 128.0 53 121.5 54 111.0 55 108.0 56 97.0 57 95.5 58 97.5 59 84.5 60 88.0 61 88.0 62 76.5 63 70.0 64 70.0 65 65.5 66 47.5 67 44.0 68 45.0 69 36.5 70 32.0 71 29.0 72 20.0 73 12.5 74 8.0 75 6.0 76 5.5 77 5.0 78 4.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9873417721519 97.75 2 0.8607594936708861 1.7000000000000002 3 0.10126582278481014 0.3 4 0.025316455696202535 0.1 5 0.0 0.0 6 0.025316455696202535 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.2249999999999996 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 3.0374999999999996 0.0 0.0 0.0 0.0 126-127 3.625 0.0 0.0 0.0 0.0 128-129 3.9625000000000004 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 4.85 0.0 0.0 0.0 0.0 134-135 5.4 0.0 0.0 0.0 0.0 136-137 5.875 0.0 0.0 0.0 0.0 138-139 6.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTGAT 10 0.006830828 145.0 6 TGCTTGG 10 0.006830828 145.0 4 CAGCTGG 10 0.006830828 145.0 1 >>END_MODULE Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937034 spots for SRR6958296.sra Written 937034 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra Read 937023 spots for SRR6958296.sra Written 937023 spots for SRR6958296.sra SRR ids: ['SRR6958296.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m_h3lwee SRR6958296.sra spots: 18740471 blocks: [[1, 937023], [937024, 1874046], [1874047, 2811069], [2811070, 3748092], [3748093, 4685115], [4685116, 5622138], [5622139, 6559161], [6559162, 7496184], [7496185, 8433207], [8433208, 9370230], [9370231, 10307253], [10307254, 11244276], [11244277, 12181299], [12181300, 13118322], [13118323, 14055345], [14055346, 14992368], [14992369, 15929391], [15929392, 16866414], [16866415, 17803437], [17803438, 18740471]] SRR6958296 file size 6328830 SRR6958296 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958296 SRR6958296_1.fastq SRR6958296_2.fastq Input file: SRR6958296_1.fastq Paired file: SRR6958296_2.fastq trimmed: SRR6958296-trimmed-pair1.fastq, SRR6958296-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:04:19 2024 >> started Fri Dec 6 19:04:39 2024 >> done (20.082s) 18740471 read pairs processed; of these: 11415 ( 0.06%) short read pairs filtered out after trimming by size control 9821 ( 0.05%) empty read pairs filtered out after trimming by size control 18719235 (99.89%) read pairs available; of these: 7482721 (39.97%) trimmed read pairs available after processing 11236514 (60.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 3 0.00% 21 5 0.00% 22 8 0.00% 23 8 0.00% 24 7 0.00% 25 5 0.00% 26 5 0.00% 27 4 0.00% 28 3 0.00% 29 5 0.00% 30 6 0.00% 31 10 0.00% 32 6 0.00% 33 7 0.00% 34 4 0.00% 35 7 0.00% 36 9 0.00% 37 7 0.00% 38 11 0.00% 39 13 0.00% 40 18 0.00% 41 14 0.00% 42 16 0.00% 43 14 0.00% 44 19 0.00% 45 17 0.00% 46 31 0.00% 47 23 0.00% 48 29 0.00% 49 30 0.00% 50 38 0.00% 51 54 0.00% 52 57 0.00% 53 61 0.00% 54 72 0.00% 55 80 0.00% 56 95 0.00% 57 74 0.00% 58 104 0.00% 59 113 0.00% 60 128 0.00% 61 176 0.00% 62 210 0.00% 63 190 0.00% 64 230 0.00% 65 284 0.00% 66 349 0.00% 67 344 0.00% 68 412 0.00% 69 461 0.00% 70 540 0.00% 71 597 0.00% 72 715 0.00% 73 833 0.00% 74 993 0.01% 75 1056 0.01% 76 1174 0.01% 77 1334 0.01% 78 1552 0.01% 79 1743 0.01% 80 1978 0.01% 81 2256 0.01% 82 2667 0.01% 83 2862 0.02% 84 3890 0.02% 85 4438 0.02% 86 4779 0.03% 87 5331 0.03% 88 5651 0.03% 89 6048 0.03% 90 6524 0.03% 91 7077 0.04% 92 7769 0.04% 93 8546 0.05% 94 9440 0.05% 95 10183 0.05% 96 10764 0.06% 97 11459 0.06% 98 12035 0.06% 99 12764 0.07% 100 13546 0.07% 101 14074 0.08% 102 15434 0.08% 103 16508 0.09% 104 17733 0.09% 105 18865 0.10% 106 19923 0.11% 107 20431 0.11% 108 21945 0.12% 109 22496 0.12% 110 23499 0.13% 111 24726 0.13% 112 25961 0.14% 113 27000 0.14% 114 28525 0.15% 115 30286 0.16% 116 31618 0.17% 117 32455 0.17% 118 33482 0.18% 119 34006 0.18% 120 35158 0.19% 121 36182 0.19% 122 37665 0.20% 123 39046 0.21% 124 41000 0.22% 125 42688 0.23% 126 44393 0.24% 127 45691 0.24% 128 46333 0.25% 129 48182 0.26% 130 49362 0.26% 131 51243 0.27% 132 53395 0.29% 133 55843 0.30% 134 57282 0.31% 135 59984 0.32% 136 61849 0.33% 137 64601 0.35% 138 67382 0.36% 139 70946 0.38% 140 75044 0.40% 141 79046 0.42% 142 85618 0.46% 143 93013 0.50% 144 102523 0.55% 145 117902 0.63% 146 141801 0.76% 147 184476 0.99% 148 273953 1.46% 149 553674 2.96% 150 4144054 22.14% 151 11236514 60.03% 18719235 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=21 prefix-density=0.83 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=38.98 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=18 prefix-density=0.52 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=28.43 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958296 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:05:42 Started mapping on | Dec 06 19:05:42 Finished on | Dec 06 19:07:22 Mapping speed, Million of reads per hour | 673.89 Number of input reads | 18719235 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 16573738 Uniquely mapped reads % | 88.54% Average mapped length | 288.34 Number of splices: Total | 19388498 Number of splices: Annotated (sjdb) | 18293871 Number of splices: GT/AG | 19132769 Number of splices: GC/AG | 223824 Number of splices: AT/AC | 7525 Number of splices: Non-canonical | 24380 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 148520 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 14321 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.30% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2006985 2006985 2006985 N_multimapping 148520 148520 148520 N_noFeature 479602 16118135 601977 N_ambiguous 414996 2427 83994 UnstrandedReadsAssigned:15679140 PositiveStrandReadsAssigned:453176 NegativeStrandReadsAssigned:15887767 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958296 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958296-trimmed-pair1.fastq SRR6958296-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,719,235 reads, 17,422,080 reads pseudoaligned [quant] estimated average fragment length: 251.618 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR6958296.ke.tsv 35125 SRR6958296.se.tsv 88098 total ==> SRR6958296.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.904 0 0 PNS24247 1044 793.382 48.3314 5.15848 PNS24249 1928 1677.38 46.502 2.34755 PNS24246 1044 793.382 48.3314 5.15848 PNS24248 1044 793.382 48.3314 5.15848 PNS24244 1471 1220.38 14.5039 1.00638 PNS24243 293 97.759 0 0 KQK14069 1603 1352.38 4551.36 284.982 KQK14071 474 241.371 43.5986 15.2955 ==> SRR6958296.se.tsv <== BRADI_1g14170v3 4127 BRADI_1g53295v3 210 BRADI_1g59795v3 167 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 290 BRADI_1g74790v3 73 BRADI_1g09890v3 0 BRADI_1g77505v3 199 BRADI_1g48960v3 0 SRR6958296 completed mapping pipeline successfully