Starting /dee2/code/volunteer_pipeline.sh SRR6958297 current disk space = 1550044332032 free memory = 1600038484 SRR6958297 SRAfilesize e2cd5199a152383ba2dfad85186eff1d SRR6958297.sra SRR6958297.sra file validated SRR6958297 is paired end SRR6958297 is conventional basespace SRR6958297 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958297_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.08125 25.0 18.0 33.0 18.0 33.0 2 29.368 30.0 27.0 33.0 25.0 33.0 3 31.54475 33.0 31.0 33.0 29.0 34.0 4 32.65875 33.0 33.0 33.0 31.0 34.0 5 33.036 33.0 33.0 34.0 32.0 34.0 6 36.69175 38.0 37.0 38.0 34.0 38.0 7 37.354 38.0 38.0 38.0 36.0 38.0 8 36.88425 38.0 38.0 38.0 35.0 38.0 9 37.4375 38.0 38.0 38.0 37.0 38.0 10-14 37.58995 38.0 38.0 38.0 37.6 38.0 15-19 37.563500000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.470600000000005 38.0 38.0 38.0 37.4 38.0 25-29 37.57365 38.0 38.0 38.0 37.6 38.0 30-34 37.6677 38.0 38.0 38.0 38.0 38.0 35-39 37.5956 38.0 38.0 38.0 37.8 38.0 40-44 37.5462 38.0 38.0 38.0 37.8 38.0 45-49 37.469899999999996 38.0 38.0 38.0 37.6 38.0 50-54 37.2265 38.0 38.0 38.0 36.6 38.0 55-59 37.133449999999996 38.0 38.0 38.0 36.2 38.0 60-64 37.06935 38.0 38.0 38.0 35.8 38.0 65-69 36.998799999999996 38.0 38.0 38.0 35.4 38.0 70-74 37.17635 38.0 38.0 38.0 36.0 38.0 75-79 37.1417 38.0 38.0 38.0 36.0 38.0 80-84 37.008849999999995 38.0 38.0 38.0 35.6 38.0 85-89 37.0411 38.0 38.0 38.0 35.8 38.0 90-94 36.986799999999995 38.0 38.0 38.0 35.8 38.0 95-99 36.758799999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.642849999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.56775 38.0 37.8 38.0 34.0 38.0 110-114 36.28185 38.0 37.4 38.0 33.8 38.0 115-119 36.128 38.0 37.0 38.0 33.2 38.0 120-124 35.97255 38.0 36.8 38.0 32.6 38.0 125-129 35.80225 38.0 36.0 38.0 32.0 38.0 130-134 35.77025 38.0 36.0 38.0 32.4 38.0 135-139 35.3468 38.0 36.0 38.0 31.0 38.0 140-144 35.0413 38.0 34.6 38.0 29.2 38.0 145-149 34.232299999999995 38.0 33.6 38.0 26.4 38.0 150-151 30.136375 35.5 28.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 2.0 18 0.0 19 2.0 20 4.0 21 2.0 22 2.0 23 4.0 24 8.0 25 5.0 26 9.0 27 8.0 28 21.0 29 12.0 30 22.0 31 49.0 32 58.0 33 106.0 34 171.0 35 329.0 36 876.0 37 2308.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.57324840764331 8.509554140127388 7.490445859872612 37.42675159235669 2 25.725725725725724 12.087087087087086 35.63563563563564 26.55155155155155 3 22.15 16.85 23.724999999999998 37.275000000000006 4 26.35 24.825 21.425 27.400000000000002 5 25.45 30.875000000000004 23.549999999999997 20.125 6 21.55 34.025 23.849999999999998 20.575 7 17.025000000000002 24.975 39.75 18.25 8 19.8 24.6 31.3 24.3 9 18.925 23.200000000000003 34.050000000000004 23.825 10-14 22.24 28.665000000000003 26.415 22.68 15-19 22.12 27.76 26.765 23.355 20-24 22.41 27.694999999999997 26.615 23.28 25-29 22.755 27.485 26.325 23.435 30-34 22.06 27.925 26.735 23.28 35-39 22.009999999999998 27.73 26.935 23.325000000000003 40-44 22.41 27.389999999999997 26.840000000000003 23.36 45-49 22.439999999999998 27.665 26.555 23.34 50-54 22.02 27.74 26.325 23.915 55-59 22.38 27.58 26.615 23.425 60-64 21.872187218721873 27.96779677967797 26.7026702670267 23.457345734573458 65-69 22.501125056252814 27.501375068753436 26.48632431621581 23.51117555877794 70-74 22.59 27.495000000000005 26.695 23.22 75-79 22.11 27.500000000000004 26.82 23.57 80-84 22.025 27.084999999999997 27.005000000000003 23.885 85-89 21.91 27.529999999999998 26.405 24.154999999999998 90-94 22.23 27.115000000000002 26.665 23.990000000000002 95-99 22.33 27.52 26.615 23.535 100-104 22.43 27.575 26.495 23.5 105-109 23.23 27.865000000000002 25.855 23.05 110-114 23.41 27.595 26.090000000000003 22.905 115-119 23.66 28.560000000000002 25.21 22.57 120-124 23.215 28.065 25.255 23.465 125-129 22.845 27.810000000000002 25.95 23.395 130-134 22.900000000000002 27.875 25.695 23.53 135-139 22.509999999999998 28.225 24.779999999999998 24.485 140-144 22.505 27.715 25.47 24.310000000000002 145-149 22.675 27.200000000000003 25.230000000000004 24.895 150-151 22.3125 27.900000000000002 24.7375 25.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 2.5 28 3.5 29 9.0 30 14.5 31 17.0 32 19.0 33 35.5 34 53.5 35 61.0 36 80.0 37 98.5 38 109.0 39 138.0 40 170.5 41 194.5 42 212.5 43 239.5 44 259.0 45 247.0 46 225.5 47 215.5 48 194.5 49 178.0 50 176.0 51 146.5 52 122.5 53 107.0 54 91.0 55 81.0 56 67.0 57 48.0 58 39.0 59 41.0 60 38.0 61 30.0 62 28.0 63 31.0 64 30.0 65 24.5 66 19.5 67 18.5 68 15.5 69 10.5 70 12.5 71 13.5 72 8.5 73 5.0 74 5.0 75 4.0 76 2.0 77 1.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.01 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0125 0.0 0.0 0.0 12-13 0.025 0.025 0.0 0.0 0.0 14-15 0.025 0.025 0.0 0.0 0.0 16-17 0.025 0.025 0.0 0.0 0.0 18-19 0.025 0.025 0.0 0.0 0.0 20-21 0.025 0.025 0.0 0.0 0.0 22-23 0.025 0.025 0.0 0.0 0.0 24-25 0.025 0.025 0.0 0.0 0.0 26-27 0.025 0.025 0.0 0.0 0.0 28-29 0.025 0.025 0.0 0.0 0.0 30-31 0.025 0.025 0.0 0.0 0.0 32-33 0.025 0.025 0.0 0.0 0.0 34-35 0.025 0.025 0.0 0.0 0.0 36-37 0.025 0.025 0.0 0.0 0.0 38-39 0.025 0.025 0.0 0.0 0.0 40-41 0.025 0.025 0.0 0.0 0.0 42-43 0.025 0.025 0.0 0.0 0.0 44-45 0.025 0.025 0.0 0.0 0.0 46-47 0.025 0.025 0.0 0.0 0.0 48-49 0.025 0.025 0.0 0.0 0.0 50-51 0.025 0.025 0.0 0.0 0.0 52-53 0.025 0.025 0.0 0.0 0.0 54-55 0.025 0.025 0.0 0.0 0.0 56-57 0.025 0.025 0.0 0.0 0.0 58-59 0.025 0.025 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.0625 0.025 0.0 0.0 0.0 72-73 0.0875 0.025 0.0 0.0 0.0 74-75 0.1 0.025 0.0 0.0 0.0 76-77 0.1 0.025 0.0 0.0 0.0 78-79 0.125 0.025 0.0 0.0 0.0 80-81 0.15 0.025 0.0 0.0 0.0 82-83 0.175 0.025 0.0 0.0 0.0 84-85 0.25 0.025 0.0 0.0 0.0 86-87 0.2875 0.025 0.0 0.0 0.0 88-89 0.4375 0.025 0.0 0.0 0.0 90-91 0.5625 0.025 0.0 0.0 0.0 92-93 0.5874999999999999 0.025 0.0 0.0 0.0 94-95 0.6375 0.025 0.0 0.0 0.0 96-97 0.725 0.025 0.0 0.0 0.0 98-99 0.8374999999999999 0.025 0.0 0.0 0.0 100-101 1.1124999999999998 0.025 0.0 0.0 0.0 102-103 1.3624999999999998 0.025 0.0 0.0 0.0 104-105 1.7 0.025 0.0 0.0 0.0 106-107 2.0375 0.025 0.0 0.0 0.0 108-109 2.45 0.025 0.0 0.0 0.0 110-111 2.925 0.025 0.0 0.0 0.0 112-113 3.3125 0.025 0.0 0.0 0.0 114-115 3.9000000000000004 0.025 0.0 0.0 0.0 116-117 4.5 0.025 0.0 0.0 0.0 118-119 4.9625 0.025 0.0 0.0 0.0 120-121 5.4875 0.025 0.0 0.0 0.0 122-123 6.2 0.025 0.0 0.0 0.0 124-125 7.05 0.025 0.0 0.0 0.0 126-127 7.875 0.025 0.0 0.0 0.0 128-129 8.7375 0.025 0.0 0.0 0.0 130-131 9.4625 0.025 0.0 0.0 0.0 132-133 10.2375 0.025 0.0 0.0 0.0 134-135 11.100000000000001 0.025 0.0 0.0 0.0 136-137 11.899999999999999 0.025 0.0 0.0 0.0 138-139 12.5125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAGGA 10 0.006836113 144.9625 8 TGTTTTC 10 0.006836113 144.9625 7 >>END_MODULE SRR6958297 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958297_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18025 33.0 33.0 34.0 33.0 34.0 2 33.318 34.0 33.0 34.0 33.0 34.0 3 33.38575 34.0 33.0 34.0 33.0 34.0 4 33.32975 34.0 33.0 34.0 33.0 34.0 5 33.3725 34.0 33.0 34.0 33.0 34.0 6 37.568 38.0 38.0 38.0 38.0 38.0 7 37.62225 38.0 38.0 38.0 38.0 38.0 8 37.62425 38.0 38.0 38.0 38.0 38.0 9 37.48 38.0 38.0 38.0 38.0 38.0 10-14 37.5107 38.0 38.0 38.0 38.0 38.0 15-19 37.515299999999996 38.0 38.0 38.0 38.0 38.0 20-24 36.8075 38.0 37.8 38.0 34.4 38.0 25-29 37.543400000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.6035 38.0 38.0 38.0 38.0 38.0 35-39 37.07425 38.0 38.0 38.0 35.4 38.0 40-44 37.51515 38.0 38.0 38.0 38.0 38.0 45-49 37.53845 38.0 38.0 38.0 38.0 38.0 50-54 37.51995 38.0 38.0 38.0 38.0 38.0 55-59 36.959050000000005 38.0 38.0 38.0 35.4 38.0 60-64 37.49305 38.0 38.0 38.0 37.8 38.0 65-69 37.4876 38.0 38.0 38.0 37.8 38.0 70-74 37.454750000000004 38.0 38.0 38.0 38.0 38.0 75-79 37.406 38.0 38.0 38.0 37.6 38.0 80-84 37.3621 38.0 38.0 38.0 37.0 38.0 85-89 37.259249999999994 38.0 38.0 38.0 37.0 38.0 90-94 37.1383 38.0 38.0 38.0 36.6 38.0 95-99 37.0884 38.0 38.0 38.0 36.2 38.0 100-104 36.21205 38.0 37.4 38.0 31.4 38.0 105-109 36.31515 38.0 37.4 38.0 31.0 38.0 110-114 36.346500000000006 38.0 37.6 38.0 33.0 38.0 115-119 36.70605 38.0 38.0 38.0 35.0 38.0 120-124 34.66895 38.0 35.2 38.0 24.8 38.0 125-129 35.7802 38.0 36.6 38.0 32.0 38.0 130-134 34.41485 38.0 34.0 38.0 24.4 38.0 135-139 33.2829 37.4 31.4 38.0 21.8 38.0 140-144 34.15665 38.0 33.8 38.0 24.8 38.0 145-149 34.4838 38.0 35.8 38.0 28.2 38.0 150-151 28.866625 35.5 18.5 38.0 11.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 1.0 14 1.0 15 0.0 16 3.0 17 2.0 18 3.0 19 1.0 20 2.0 21 2.0 22 5.0 23 1.0 24 8.0 25 5.0 26 14.0 27 13.0 28 14.0 29 19.0 30 23.0 31 34.0 32 54.0 33 88.0 34 181.0 35 269.0 36 1001.0 37 2251.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.35 18.625 10.775 32.25 2 29.799999999999997 23.95 30.049999999999997 16.2 3 22.425 26.6 28.725 22.25 4 25.224999999999998 30.599999999999998 22.45 21.725 5 26.85 34.925 21.375 16.85 6 20.775 36.25 23.95 19.025 7 20.95 20.75 36.625 21.675 8 23.1 23.775 27.175 25.95 9 22.85 22.775000000000002 30.7 23.674999999999997 10-14 24.755 27.265 25.25 22.73 15-19 24.685000000000002 26.815 26.27 22.23 20-24 24.69 26.650000000000002 26.009999999999998 22.650000000000002 25-29 24.26 27.395000000000003 26.224999999999998 22.12 30-34 23.794999999999998 26.715 26.950000000000003 22.54 35-39 23.665 27.425 27.01 21.9 40-44 24.060000000000002 27.065 26.71 22.165000000000003 45-49 23.71 26.72 26.875 22.695 50-54 24.085 27.16 26.185000000000002 22.57 55-59 24.345 26.76 26.540000000000003 22.355 60-64 23.985 26.705000000000002 26.669999999999998 22.64 65-69 23.785 26.87 27.089999999999996 22.255 70-74 24.195 26.740000000000002 27.435 21.63 75-79 23.87 26.875 26.905 22.35 80-84 23.525 27.165 27.334999999999997 21.975 85-89 23.64 26.590000000000003 27.18 22.59 90-94 23.91 26.119999999999997 27.435 22.535 95-99 24.104999999999997 27.224999999999998 26.640000000000004 22.03 100-104 23.925 26.505000000000003 27.505000000000003 22.065 105-109 24.355 26.805 26.965 21.875 110-114 25.03 27.529999999999998 25.835 21.605 115-119 24.45 27.71 25.985000000000003 21.855 120-124 24.97 26.529999999999998 26.66 21.84 125-129 25.465 26.97 26.11 21.455 130-134 25.81 26.965 26.135 21.09 135-139 25.715 27.445000000000004 25.8 21.04 140-144 25.465 27.169999999999998 26.88 20.485 145-149 26.6 27.815 25.169999999999998 20.415 150-151 25.900000000000002 28.1125 25.2375 20.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 2.0 24 1.0 25 1.5 26 2.5 27 6.5 28 8.0 29 9.5 30 14.0 31 16.0 32 21.0 33 32.0 34 42.5 35 50.5 36 64.0 37 89.5 38 110.5 39 137.5 40 162.5 41 184.0 42 218.0 43 226.5 44 227.5 45 230.0 46 233.0 47 224.5 48 198.0 49 189.0 50 166.0 51 146.5 52 131.0 53 108.5 54 96.0 55 75.0 56 65.5 57 65.5 58 62.5 59 53.0 60 44.0 61 42.0 62 41.5 63 37.5 64 27.5 65 20.0 66 19.5 67 21.0 68 16.0 69 14.0 70 11.5 71 9.5 72 8.5 73 4.5 74 3.0 75 1.5 76 2.5 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.20060180541624875 0.4 3 0.05015045135406219 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.8875000000000002 0.0 0.0 0.0 0.0 108-109 2.275 0.0 0.0 0.0 0.0 110-111 2.7249999999999996 0.0 0.0 0.0 0.0 112-113 3.0875000000000004 0.0 0.0 0.0 0.0 114-115 3.6125 0.0 0.0 0.0 0.0 116-117 4.175000000000001 0.0 0.0 0.0 0.0 118-119 4.625 0.0 0.0 0.0 0.0 120-121 5.1 0.0 0.0 0.0 0.0 122-123 5.775 0.0 0.0 0.0 0.0 124-125 6.5375 0.0 0.0 0.0 0.0 126-127 7.262499999999999 0.0 0.0 0.0 0.0 128-129 8.0125 0.0 0.0 0.0 0.0 130-131 8.6 0.0 0.0 0.0 0.0 132-133 9.1875 0.0 0.0 0.0 0.0 134-135 9.825 0.0 0.0 0.0 0.0 136-137 10.524999999999999 0.0 0.0 0.0 0.0 138-139 11.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAGAA 10 0.006830828 145.0 145 >>END_MODULE Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648901 spots for SRR6958297.sra Written 648901 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra Read 648892 spots for SRR6958297.sra Written 648892 spots for SRR6958297.sra SRR ids: ['SRR6958297.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7077c97y SRR6958297.sra spots: 12977849 blocks: [[1, 648892], [648893, 1297784], [1297785, 1946676], [1946677, 2595568], [2595569, 3244460], [3244461, 3893352], [3893353, 4542244], [4542245, 5191136], [5191137, 5840028], [5840029, 6488920], [6488921, 7137812], [7137813, 7786704], [7786705, 8435596], [8435597, 9084488], [9084489, 9733380], [9733381, 10382272], [10382273, 11031164], [11031165, 11680056], [11680057, 12328948], [12328949, 12977849]] SRR6958297 file size 4376066 SRR6958297 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958297 SRR6958297_1.fastq SRR6958297_2.fastq Input file: SRR6958297_1.fastq Paired file: SRR6958297_2.fastq trimmed: SRR6958297-trimmed-pair1.fastq, SRR6958297-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:03:28 2024 >> started Fri Dec 6 19:03:48 2024 >> done (19.679s) 12977849 read pairs processed; of these: 4396 ( 0.03%) short read pairs filtered out after trimming by size control 5160 ( 0.04%) empty read pairs filtered out after trimming by size control 12968293 (99.93%) read pairs available; of these: 7537108 (58.12%) trimmed read pairs available after processing 5431185 (41.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 5 0.00% 21 8 0.00% 22 8 0.00% 23 8 0.00% 24 7 0.00% 25 10 0.00% 26 8 0.00% 27 10 0.00% 28 4 0.00% 29 16 0.00% 30 16 0.00% 31 18 0.00% 32 12 0.00% 33 10 0.00% 34 15 0.00% 35 14 0.00% 36 13 0.00% 37 9 0.00% 38 12 0.00% 39 29 0.00% 40 20 0.00% 41 25 0.00% 42 16 0.00% 43 22 0.00% 44 33 0.00% 45 27 0.00% 46 35 0.00% 47 41 0.00% 48 41 0.00% 49 59 0.00% 50 58 0.00% 51 65 0.00% 52 85 0.00% 53 89 0.00% 54 68 0.00% 55 110 0.00% 56 113 0.00% 57 116 0.00% 58 164 0.00% 59 152 0.00% 60 186 0.00% 61 247 0.00% 62 265 0.00% 63 270 0.00% 64 291 0.00% 65 331 0.00% 66 393 0.00% 67 472 0.00% 68 499 0.00% 69 643 0.00% 70 620 0.00% 71 710 0.01% 72 837 0.01% 73 982 0.01% 74 1041 0.01% 75 1222 0.01% 76 1397 0.01% 77 1617 0.01% 78 1802 0.01% 79 1949 0.02% 80 2147 0.02% 81 2412 0.02% 82 2633 0.02% 83 2938 0.02% 84 3382 0.03% 85 4007 0.03% 86 4271 0.03% 87 4671 0.04% 88 5301 0.04% 89 5606 0.04% 90 6020 0.05% 91 6768 0.05% 92 7649 0.06% 93 8160 0.06% 94 9073 0.07% 95 9706 0.07% 96 10447 0.08% 97 11091 0.09% 98 11920 0.09% 99 12987 0.10% 100 14375 0.11% 101 16021 0.12% 102 16264 0.13% 103 17004 0.13% 104 18147 0.14% 105 19193 0.15% 106 20773 0.16% 107 21581 0.17% 108 22801 0.18% 109 24156 0.19% 110 24810 0.19% 111 26569 0.20% 112 27474 0.21% 113 28666 0.22% 114 30120 0.23% 115 32153 0.25% 116 33275 0.26% 117 34276 0.26% 118 36309 0.28% 119 36735 0.28% 120 38510 0.30% 121 39639 0.31% 122 41804 0.32% 123 43101 0.33% 124 45133 0.35% 125 47109 0.36% 126 48993 0.38% 127 50862 0.39% 128 52176 0.40% 129 54487 0.42% 130 57343 0.44% 131 58610 0.45% 132 61596 0.47% 133 64498 0.50% 134 66941 0.52% 135 70349 0.54% 136 74005 0.57% 137 78798 0.61% 138 81791 0.63% 139 88024 0.68% 140 93574 0.72% 141 100722 0.78% 142 111435 0.86% 143 123990 0.96% 144 139570 1.08% 145 167410 1.29% 146 203483 1.57% 147 267361 2.06% 148 394245 3.04% 149 768269 5.92% 150 3354031 25.86% 151 5431185 41.88% 12968293 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=24 prefix-density=0.15 prefix-fanout=3.3 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=245.78 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=27.3 sequence=TTCTTCTTGTCCA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=29 prefix-density=0.28 prefix-fanout=3.0 sequence=CCTTCGCCGGCGCCGCCGTCCTGCCCCGTGCCGCCGCAGCCGCAGCACGATCACGGACATTGTCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=33 fanout-score=134.10 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=25.4 sequence=CAAGGAGGAGAAC SRR6958297 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:04:36 Started mapping on | Dec 06 19:04:37 Finished on | Dec 06 19:05:47 Mapping speed, Million of reads per hour | 666.94 Number of input reads | 12968293 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12730194 Uniquely mapped reads % | 98.16% Average mapped length | 291.44 Number of splices: Total | 13929930 Number of splices: Annotated (sjdb) | 13070466 Number of splices: GT/AG | 13740989 Number of splices: GC/AG | 157766 Number of splices: AT/AC | 7636 Number of splices: Non-canonical | 23539 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 126761 % of reads mapped to multiple loci | 0.98% Number of reads mapped to too many loci | 7524 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 113811 113811 113811 N_multimapping 126761 126761 126761 N_noFeature 676100 12395674 803879 N_ambiguous 248848 1658 42835 UnstrandedReadsAssigned:11805246 PositiveStrandReadsAssigned:332862 NegativeStrandReadsAssigned:11883480 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR6958297 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958297-trimmed-pair1.fastq SRR6958297-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,968,293 reads, 11,900,826 reads pseudoaligned [quant] estimated average fragment length: 210.518 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52973 SRR6958297.ke.tsv 35125 SRR6958297.se.tsv 88098 total ==> SRR6958297.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 726.818 2.66896 0.504068 PNS24247 1044 834.482 43.0324 7.07868 PNS24249 1928 1718.48 33.2645 2.65711 PNS24246 1044 834.482 43.0324 7.07868 PNS24248 1044 834.482 43.0324 7.07868 PNS24244 1471 1261.48 30.9692 3.36995 PNS24243 293 104.249 0 0 KQK14069 1603 1393.48 198.417 19.5457 KQK14071 474 267.648 3.80315 1.95053 ==> SRR6958297.se.tsv <== BRADI_1g14170v3 210 BRADI_1g53295v3 481 BRADI_1g59795v3 232 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 304 BRADI_1g74790v3 298 BRADI_1g09890v3 0 BRADI_1g77505v3 212 BRADI_1g48960v3 0 SRR6958297 completed mapping pipeline successfully