Starting /dee2/code/volunteer_pipeline.sh SRR6958299 current disk space = 1550107734016 free memory = 1600172256 SRR6958299 SRAfilesize 8b480e949fad8d3823738a857a7b7b65 SRR6958299.sra SRR6958299.sra file validated SRR6958299 is paired end SRR6958299 is conventional basespace SRR6958299 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958299_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.90625 32.0 18.0 33.0 18.0 34.0 2 29.677 31.0 27.0 33.0 25.0 34.0 3 31.049 33.0 30.0 33.0 27.0 34.0 4 31.1525 33.0 31.0 33.0 28.0 33.0 5 31.6645 33.0 31.0 33.0 29.0 34.0 6 35.38075 37.0 35.0 38.0 29.0 38.0 7 36.342 38.0 36.0 38.0 33.0 38.0 8 37.20475 38.0 38.0 38.0 36.0 38.0 9 37.16425 38.0 38.0 38.0 36.0 38.0 10-14 36.992399999999996 38.0 38.0 38.0 35.4 38.0 15-19 37.2846 38.0 38.0 38.0 36.4 38.0 20-24 37.36985 38.0 38.0 38.0 37.0 38.0 25-29 37.5337 38.0 38.0 38.0 37.2 38.0 30-34 37.558099999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.55175 38.0 38.0 38.0 37.8 38.0 40-44 37.51800000000001 38.0 38.0 38.0 37.6 38.0 45-49 37.19885 38.0 38.0 38.0 36.4 38.0 50-54 37.354200000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.089349999999996 38.0 38.0 38.0 35.8 38.0 60-64 37.171200000000006 38.0 38.0 38.0 36.2 38.0 65-69 37.183 38.0 38.0 38.0 36.0 38.0 70-74 36.787749999999996 38.0 38.0 38.0 34.8 38.0 75-79 36.857150000000004 38.0 38.0 38.0 35.2 38.0 80-84 36.953649999999996 38.0 38.0 38.0 35.4 38.0 85-89 36.9236 38.0 38.0 38.0 35.2 38.0 90-94 36.87075 38.0 38.0 38.0 35.0 38.0 95-99 36.81875 38.0 38.0 38.0 35.0 38.0 100-104 36.6802 38.0 38.0 38.0 34.4 38.0 105-109 36.48595 38.0 38.0 38.0 34.0 38.0 110-114 36.36925 38.0 37.6 38.0 33.6 38.0 115-119 36.1195 38.0 37.2 38.0 33.6 38.0 120-124 35.9628 38.0 37.0 38.0 32.2 38.0 125-129 35.865899999999996 38.0 36.6 38.0 32.2 38.0 130-134 35.64005 38.0 36.0 38.0 31.4 38.0 135-139 35.241299999999995 38.0 35.6 38.0 30.0 38.0 140-144 34.97605 38.0 35.4 38.0 29.2 38.0 145-149 34.1552 38.0 35.0 38.0 25.0 38.0 150-151 30.304875000000003 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 4.0 23 7.0 24 9.0 25 5.0 26 11.0 27 10.0 28 23.0 29 32.0 30 30.0 31 51.0 32 70.0 33 116.0 34 183.0 35 328.0 36 832.0 37 2281.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.514891468955074 13.351842503785965 9.439676930843008 46.69358909641595 2 18.05 15.049999999999999 39.175 27.725 3 19.21441080810608 16.937703277458095 24.993745308981737 38.85414060545409 4 23.65 26.85 22.15 27.35 5 24.55 31.8 24.349999999999998 19.3 6 22.95 35.4 22.8 18.85 7 15.975 27.675 39.324999999999996 17.025000000000002 8 20.3 26.5 31.1 22.1 9 19.2 22.5 35.199999999999996 23.1 10-14 21.48 29.53 26.705000000000002 22.285 15-19 21.98 28.65 27.07 22.3 20-24 20.968145221783267 28.749312396859526 27.43911586738011 22.843426513977096 25-29 21.759999999999998 29.244999999999997 26.445 22.55 30-34 21.365000000000002 28.9 26.590000000000003 23.145 35-39 21.349999999999998 28.694999999999997 26.884999999999998 23.07 40-44 21.584999999999997 28.32 27.55 22.545 45-49 21.490000000000002 28.139999999999997 27.12 23.25 50-54 21.255 28.865000000000002 27.025 22.855 55-59 20.91 28.744999999999997 27.200000000000003 23.145 60-64 21.89 28.12 27.305 22.685 65-69 21.455 28.165000000000003 27.16 23.22 70-74 21.86 28.155 27.125 22.86 75-79 21.475 27.79 27.025 23.71 80-84 21.13 27.61 27.485 23.775 85-89 20.669999999999998 27.905 27.694999999999997 23.73 90-94 21.490000000000002 27.485 27.345000000000002 23.68 95-99 21.560000000000002 27.310000000000002 27.47 23.66 100-104 22.14274996248687 27.554644125443907 26.84939728905117 23.453208623018057 105-109 21.89 28.465 26.85 22.795 110-114 21.849201981287834 28.84374843648371 26.53224595987392 22.77480362235453 115-119 22.211095533747248 29.00560785099139 26.52713799319047 22.2561586220709 120-124 21.67 28.505000000000003 26.740000000000002 23.085 125-129 21.34409141024356 28.45544752931743 26.786609201162676 23.413851859276335 130-134 21.999799819837854 28.350515463917525 26.133520168151335 23.516164548093286 135-139 21.175 27.96 26.86 24.005000000000003 140-144 21.93 27.525 26.25 24.295 145-149 22.040000000000003 27.87 26.590000000000003 23.5 150-151 21.925 26.987499999999997 27.462500000000002 23.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 2.0 26 2.5 27 3.0 28 5.0 29 8.5 30 16.0 31 24.5 32 29.5 33 43.0 34 63.0 35 68.5 36 83.5 37 113.0 38 131.5 39 160.5 40 205.5 41 231.0 42 245.0 43 259.0 44 258.0 45 242.5 46 242.5 47 230.5 48 198.0 49 173.5 50 144.5 51 125.5 52 108.0 53 93.0 54 73.5 55 62.0 56 59.5 57 52.5 58 43.5 59 31.0 60 26.0 61 22.5 62 16.5 63 16.5 64 17.0 65 14.0 66 14.5 67 11.0 68 7.0 69 4.0 70 3.0 71 3.5 72 3.5 73 2.0 74 1.0 75 1.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.034999999999999996 105-109 0.0 110-114 0.065 115-119 0.13999999999999999 120-124 0.0 125-129 0.22999999999999998 130-134 0.09 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64815280221161 99.125 2 0.2261874842925358 0.44999999999999996 3 0.07539582809751194 0.22499999999999998 4 0.050263885398341285 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.7625000000000002 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.3375 0.0 0.0 0.0 0.0 128-129 2.5250000000000004 0.0 0.0 0.0 0.0 130-131 2.8125 0.0 0.0 0.0 0.0 132-133 3.15 0.0 0.0 0.0 0.0 134-135 3.4749999999999996 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCTGA 30 0.0014437955 24.166668 140-144 GCACACG 40 0.0076550315 18.125 135-139 >>END_MODULE SRR6958299 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958299_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0985 33.0 33.0 34.0 33.0 34.0 2 33.21125 34.0 33.0 34.0 33.0 34.0 3 33.27775 34.0 33.0 34.0 33.0 34.0 4 33.2225 34.0 33.0 34.0 33.0 34.0 5 33.26 34.0 33.0 34.0 33.0 34.0 6 37.43875 38.0 38.0 38.0 38.0 38.0 7 37.41475 38.0 38.0 38.0 37.0 38.0 8 37.3925 38.0 38.0 38.0 38.0 38.0 9 37.412 38.0 38.0 38.0 37.0 38.0 10-14 36.91705 38.0 38.0 38.0 35.4 38.0 15-19 36.836650000000006 38.0 37.8 38.0 35.2 38.0 20-24 37.3634 38.0 38.0 38.0 38.0 38.0 25-29 37.4073 38.0 38.0 38.0 38.0 38.0 30-34 37.416650000000004 38.0 38.0 38.0 38.0 38.0 35-39 36.9254 38.0 38.0 38.0 36.0 38.0 40-44 37.2611 38.0 38.0 38.0 37.6 38.0 45-49 36.95825 38.0 38.0 38.0 36.0 38.0 50-54 37.08775 38.0 38.0 38.0 36.8 38.0 55-59 36.64915 38.0 37.8 38.0 33.8 38.0 60-64 37.3602 38.0 38.0 38.0 38.0 38.0 65-69 37.12925 38.0 38.0 38.0 36.6 38.0 70-74 37.28615 38.0 38.0 38.0 37.0 38.0 75-79 36.98005 38.0 38.0 38.0 36.2 38.0 80-84 37.189800000000005 38.0 38.0 38.0 37.0 38.0 85-89 37.232549999999996 38.0 38.0 38.0 37.0 38.0 90-94 37.10045 38.0 38.0 38.0 36.6 38.0 95-99 37.07340000000001 38.0 38.0 38.0 36.8 38.0 100-104 36.10325 38.0 37.4 38.0 31.8 38.0 105-109 36.1584 38.0 37.6 38.0 32.6 38.0 110-114 36.65195 38.0 38.0 38.0 34.8 38.0 115-119 36.809099999999994 38.0 38.0 38.0 35.2 38.0 120-124 36.6625 38.0 38.0 38.0 35.0 38.0 125-129 36.4129 38.0 38.0 38.0 34.0 38.0 130-134 36.2329 38.0 38.0 38.0 34.0 38.0 135-139 36.05905 38.0 37.8 38.0 33.8 38.0 140-144 35.49485 38.0 36.4 38.0 31.4 38.0 145-149 35.060950000000005 38.0 36.2 38.0 31.0 38.0 150-151 27.531125000000003 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 1.0 5 1.0 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 3.0 18 2.0 19 5.0 20 1.0 21 4.0 22 2.0 23 7.0 24 5.0 25 9.0 26 7.0 27 15.0 28 14.0 29 17.0 30 35.0 31 39.0 32 51.0 33 70.0 34 117.0 35 232.0 36 599.0 37 2752.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.75 18.025 14.2 36.025 2 27.650000000000002 23.425 31.35 17.575 3 20.724999999999998 25.974999999999998 31.025000000000002 22.275 4 25.174999999999997 31.924999999999997 23.724999999999998 19.175 5 28.575 33.300000000000004 20.75 17.375 6 20.3 39.1 22.625 17.974999999999998 7 19.975 21.25 39.225 19.55 8 22.95 24.95 27.825 24.275 9 22.875 23.375 30.2 23.549999999999997 10-14 24.62 27.435 25.47 22.475 15-19 24.36 27.27 26.47 21.9 20-24 23.875 27.525 26.68 21.92 25-29 23.755000000000003 27.229999999999997 26.8 22.215 30-34 23.549999999999997 26.88 27.465 22.105 35-39 24.005000000000003 27.775 25.995 22.225 40-44 23.28 27.24 27.639999999999997 21.84 45-49 23.34 27.075 27.095000000000002 22.49 50-54 23.865 27.450000000000003 27.185 21.5 55-59 23.875 27.205000000000002 26.950000000000003 21.97 60-64 24.21 27.05 26.56 22.18 65-69 23.68 27.655 27.235 21.43 70-74 24.015 26.855 26.974999999999998 22.155 75-79 23.87 27.089999999999996 27.63 21.41 80-84 23.13 26.985 27.845 22.040000000000003 85-89 23.54 27.089999999999996 27.105 22.264999999999997 90-94 23.400000000000002 26.815 28.21 21.575 95-99 23.580000000000002 27.01 27.43 21.98 100-104 23.445 26.950000000000003 27.639999999999997 21.965 105-109 23.7 27.400000000000002 27.075 21.825 110-114 23.25 27.595 27.474999999999998 21.68 115-119 23.599999999999998 27.584999999999997 27.215 21.6 120-124 23.86 27.655 27.405 21.08 125-129 24.445 27.74 26.685 21.13 130-134 24.235 27.505000000000003 26.945000000000004 21.315 135-139 24.325 26.905 27.555000000000003 21.215 140-144 24.6 27.655 26.96 20.785 145-149 24.275 27.405 27.395000000000003 20.925 150-151 24.962500000000002 28.15 26.4125 20.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 2.5 26 3.0 27 3.0 28 5.5 29 9.5 30 11.0 31 16.5 32 26.0 33 31.5 34 38.0 35 49.5 36 71.5 37 106.0 38 131.5 39 142.5 40 184.0 41 226.0 42 243.0 43 250.5 44 241.0 45 225.5 46 227.0 47 221.5 48 205.0 49 182.5 50 155.5 51 137.5 52 118.5 53 100.0 54 88.5 55 72.0 56 54.0 57 60.0 58 61.0 59 53.0 60 46.0 61 38.0 62 26.0 63 20.5 64 18.0 65 12.5 66 13.0 67 14.0 68 12.0 69 12.0 70 9.5 71 6.0 72 6.0 73 4.5 74 2.5 75 2.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.3499999999999996 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.8375 0.0 0.0 0.0 0.0 132-133 3.175 0.0 0.0 0.0 0.0 134-135 3.5 0.0 0.0 0.0 0.0 136-137 3.8875 0.0 0.0 0.0 0.0 138-139 4.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAGG 30 0.0014437955 24.166668 140-144 CGTGTAG 30 0.0014437955 24.166668 140-144 GCGTCGT 40 0.0076550315 18.125 135-139 AGCGTCG 40 0.0076550315 18.125 135-139 >>END_MODULE Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra Read 484633 spots for SRR6958299.sra Written 484633 spots for SRR6958299.sra SRR ids: ['SRR6958299.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f8lfjl1h SRR6958299.sra spots: 9692660 blocks: [[1, 484633], [484634, 969266], [969267, 1453899], [1453900, 1938532], [1938533, 2423165], [2423166, 2907798], [2907799, 3392431], [3392432, 3877064], [3877065, 4361697], [4361698, 4846330], [4846331, 5330963], [5330964, 5815596], [5815597, 6300229], [6300230, 6784862], [6784863, 7269495], [7269496, 7754128], [7754129, 8238761], [8238762, 8723394], [8723395, 9208027], [9208028, 9692660]] SRR6958299 file size 3263424 SRR6958299 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958299 SRR6958299_1.fastq SRR6958299_2.fastq Input file: SRR6958299_1.fastq Paired file: SRR6958299_2.fastq trimmed: SRR6958299-trimmed-pair1.fastq, SRR6958299-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:05:12 2024 >> started Fri Dec 6 19:05:23 2024 >> done (10.799s) 9692660 read pairs processed; of these: 4815 ( 0.05%) short read pairs filtered out after trimming by size control 3540 ( 0.04%) empty read pairs filtered out after trimming by size control 9684305 (99.91%) read pairs available; of these: 3261982 (33.68%) trimmed read pairs available after processing 6422323 (66.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 3 0.00% 22 1 0.00% 23 1 0.00% 24 6 0.00% 25 2 0.00% 26 0 0.00% 27 3 0.00% 28 4 0.00% 29 1 0.00% 30 4 0.00% 31 1 0.00% 32 5 0.00% 33 2 0.00% 34 1 0.00% 35 7 0.00% 36 4 0.00% 37 8 0.00% 38 7 0.00% 39 4 0.00% 40 7 0.00% 41 4 0.00% 42 8 0.00% 43 3 0.00% 44 4 0.00% 45 13 0.00% 46 9 0.00% 47 6 0.00% 48 4 0.00% 49 20 0.00% 50 12 0.00% 51 20 0.00% 52 17 0.00% 53 16 0.00% 54 24 0.00% 55 20 0.00% 56 34 0.00% 57 21 0.00% 58 25 0.00% 59 29 0.00% 60 31 0.00% 61 36 0.00% 62 43 0.00% 63 65 0.00% 64 58 0.00% 65 65 0.00% 66 73 0.00% 67 93 0.00% 68 111 0.00% 69 127 0.00% 70 151 0.00% 71 142 0.00% 72 143 0.00% 73 210 0.00% 74 225 0.00% 75 244 0.00% 76 276 0.00% 77 310 0.00% 78 349 0.00% 79 397 0.00% 80 442 0.00% 81 498 0.01% 82 617 0.01% 83 686 0.01% 84 840 0.01% 85 986 0.01% 86 1071 0.01% 87 1204 0.01% 88 1272 0.01% 89 1274 0.01% 90 1462 0.02% 91 1633 0.02% 92 1859 0.02% 93 1906 0.02% 94 2073 0.02% 95 2324 0.02% 96 2375 0.02% 97 2567 0.03% 98 2655 0.03% 99 3028 0.03% 100 3346 0.03% 101 3500 0.04% 102 3681 0.04% 103 3939 0.04% 104 4256 0.04% 105 4504 0.05% 106 4744 0.05% 107 5095 0.05% 108 5369 0.06% 109 5658 0.06% 110 6083 0.06% 111 6103 0.06% 112 6629 0.07% 113 7001 0.07% 114 7564 0.08% 115 8053 0.08% 116 8561 0.09% 117 8780 0.09% 118 9403 0.10% 119 9460 0.10% 120 10037 0.10% 121 10332 0.11% 122 10871 0.11% 123 11589 0.12% 124 12129 0.13% 125 12456 0.13% 126 13247 0.14% 127 13594 0.14% 128 14692 0.15% 129 15121 0.16% 130 16181 0.17% 131 16742 0.17% 132 17327 0.18% 133 18740 0.19% 134 19461 0.20% 135 20539 0.21% 136 22188 0.23% 137 23314 0.24% 138 24498 0.25% 139 26586 0.27% 140 28772 0.30% 141 31026 0.32% 142 34427 0.36% 143 38385 0.40% 144 44041 0.45% 145 52540 0.54% 146 65674 0.68% 147 89271 0.92% 148 138174 1.43% 149 290817 3.00% 150 1963200 20.27% 151 6422323 66.32% 9684305 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=21 prefix-density=0.58 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=52.95 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.5 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=15 prefix-density=0.43 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=66.66 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=12.4 sequence=CTCATCTTCCCCGCCGATGCCATCGCCCGGGCCAAGCACTACCTCTCCATGGCGCCCGGTGGTTTAGGTGCCTACAGTGACTCCCGAGGTATCCCCGGAGTTAGGAAGGAAGTTGCCGAGTTCATTCAGAGGCGTGACGGGTATCCGAGTGATCCGGAGCTTATTTACCTGACTGATGGTGCCAGCAAAGGTGTGATGCAAATGCTCAACGCCATTATCAGAAACGAGAGAGACGGGATTTTGGTCCCTGTTCCACAATACCCGCTTTATTCTGCAGCCATTTCTCTCTTTGGTGGCTCGCTTGTCCCATATTACTTAGAAGAAGAGGCTAACTGGGGACTCGACATTGTAACTACCCGGCAATCAGTAGCAGCTGCACGGTCCAAGGGGATGACTGTTCGAGCAATGGTGATTATTAATCCTGGAAACCCCACTGGCCAATGCCTAAGTGAAGCAAATATCAGGGAACTTCTGAATTTTTGTTATCAGGAAAACTTAGTTCTGCTTGCAG SRR6958299 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:06:07 Started mapping on | Dec 06 19:06:07 Finished on | Dec 06 19:06:49 Mapping speed, Million of reads per hour | 830.08 Number of input reads | 9684305 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 9528804 Uniquely mapped reads % | 98.39% Average mapped length | 297.96 Number of splices: Total | 11199580 Number of splices: Annotated (sjdb) | 10534054 Number of splices: GT/AG | 11057609 Number of splices: GC/AG | 128848 Number of splices: AT/AC | 4485 Number of splices: Non-canonical | 8638 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 69887 % of reads mapped to multiple loci | 0.72% Number of reads mapped to too many loci | 9638 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.18% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 87431 87431 87431 N_multimapping 69887 69887 69887 N_noFeature 467033 9249443 560159 N_ambiguous 222242 1203 36683 UnstrandedReadsAssigned:8839529 PositiveStrandReadsAssigned:278158 NegativeStrandReadsAssigned:8931962 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958299 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958299-trimmed-pair1.fastq SRR6958299-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,684,305 reads, 8,953,421 reads pseudoaligned [quant] estimated average fragment length: 242.372 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52973 SRR6958299.ke.tsv 35125 SRR6958299.se.tsv 88098 total ==> SRR6958299.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 695.038 0 0 PNS24247 1044 802.628 31.138 7.04655 PNS24249 1928 1686.63 6.4077 0.690054 PNS24246 1044 802.628 31.138 7.04655 PNS24248 1044 802.628 31.138 7.04655 PNS24244 1471 1229.63 22.1783 3.27609 PNS24243 293 82.7051 0 0 KQK14069 1603 1361.63 1368.9 182.605 KQK14071 474 237.069 42.0965 32.2531 ==> SRR6958299.se.tsv <== BRADI_1g14170v3 1695 BRADI_1g53295v3 142 BRADI_1g59795v3 149 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 158 BRADI_1g74790v3 37 BRADI_1g09890v3 0 BRADI_1g77505v3 107 BRADI_1g48960v3 0 SRR6958299 completed mapping pipeline successfully