Starting /dee2/code/volunteer_pipeline.sh SRR6958300 current disk space = 1550101368832 free memory = 1349390352 SRR6958300 SRAfilesize ee6030b1b09f3b4b9b7160293ba1a4e7 SRR6958300.sra SRR6958300.sra file validated SRR6958300 is paired end SRR6958300 is conventional basespace SRR6958300 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958300_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.92275 18.0 18.0 30.0 18.0 33.0 2 24.25625 25.0 18.0 31.0 18.0 32.0 3 28.94225 29.0 27.0 31.0 25.0 33.0 4 28.018 30.0 27.0 33.0 15.0 33.0 5 30.4155 32.0 31.0 33.0 25.0 33.0 6 34.017 36.0 33.0 38.0 28.0 38.0 7 35.49925 38.0 36.0 38.0 29.0 38.0 8 35.78775 38.0 36.0 38.0 31.0 38.0 9 36.65725 38.0 37.0 38.0 34.0 38.0 10-14 37.15775000000001 38.0 38.0 38.0 35.8 38.0 15-19 37.099199999999996 38.0 38.0 38.0 36.0 38.0 20-24 37.1416 38.0 38.0 38.0 36.0 38.0 25-29 36.9885 38.0 38.0 38.0 35.6 38.0 30-34 36.959799999999994 38.0 38.0 38.0 35.6 38.0 35-39 36.9145 38.0 38.0 38.0 35.4 38.0 40-44 36.91345 38.0 38.0 38.0 35.4 38.0 45-49 36.8317 38.0 38.0 38.0 35.2 38.0 50-54 36.45955 38.0 38.0 38.0 33.8 38.0 55-59 36.44355 38.0 37.8 38.0 33.8 38.0 60-64 36.6789 38.0 38.0 38.0 34.6 38.0 65-69 36.7564 38.0 38.0 38.0 34.6 38.0 70-74 36.3275 38.0 37.6 38.0 33.4 38.0 75-79 36.11925 38.0 37.0 38.0 32.6 38.0 80-84 35.88584999999999 38.0 37.0 38.0 31.0 38.0 85-89 36.1596 38.0 37.0 38.0 32.8 38.0 90-94 35.94725 38.0 36.8 38.0 32.6 38.0 95-99 35.567099999999996 38.0 36.0 38.0 30.2 38.0 100-104 34.9711 38.0 35.0 38.0 27.6 38.0 105-109 34.53515 38.0 34.4 38.0 24.8 38.0 110-114 34.40585 38.0 34.4 38.0 24.6 38.0 115-119 34.2484 38.0 34.0 38.0 23.6 38.0 120-124 34.0044 38.0 34.0 38.0 23.0 38.0 125-129 34.16085 38.0 34.0 38.0 24.2 38.0 130-134 33.890550000000005 38.0 34.0 38.0 23.2 38.0 135-139 33.0318 37.4 33.4 38.0 18.2 38.0 140-144 31.908000000000005 36.0 31.6 38.0 13.6 38.0 145-149 30.4689 35.2 29.8 38.0 11.0 38.0 150-151 26.316375 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 2.0 18 4.0 19 5.0 20 10.0 21 7.0 22 11.0 23 2.0 24 17.0 25 24.0 26 37.0 27 46.0 28 41.0 29 59.0 30 102.0 31 121.0 32 169.0 33 238.0 34 334.0 35 566.0 36 1212.0 37 988.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.807291666666664 12.552083333333334 5.130208333333333 41.510416666666664 2 22.25 16.400000000000002 23.674999999999997 37.675 3 20.075000000000003 18.875 25.575 35.475 4 28.925 20.150000000000002 22.3 28.625 5 25.75 27.700000000000003 22.7 23.849999999999998 6 23.825 32.1 22.575 21.5 7 19.075 23.775 37.875 19.275000000000002 8 21.85 23.525 27.05 27.575 9 19.525000000000002 21.65 32.6 26.224999999999998 10-14 23.105 26.090000000000003 25.985000000000003 24.82 15-19 22.905 25.605 26.224999999999998 25.264999999999997 20-24 22.625 25.465 26.215 25.695 25-29 22.735 25.855 25.790000000000003 25.619999999999997 30-34 22.96 25.41 25.34 26.290000000000003 35-39 23.035 25.840000000000003 24.995 26.13 40-44 22.509999999999998 26.0 25.545 25.945 45-49 23.64 25.415 25.564999999999998 25.380000000000003 50-54 23.080000000000002 24.975 25.805 26.14 55-59 23.474999999999998 25.19 25.509999999999998 25.825 60-64 23.599999999999998 25.465 25.430000000000003 25.505 65-69 23.305 25.31 25.465 25.919999999999998 70-74 23.555 25.035 25.380000000000003 26.029999999999998 75-79 23.465 25.03 25.575 25.929999999999996 80-84 22.64 25.174999999999997 25.505 26.68 85-89 23.195 24.515 26.06 26.229999999999997 90-94 23.47 24.610000000000003 25.319999999999997 26.6 95-99 23.285 25.485000000000003 25.805 25.424999999999997 100-104 23.465 24.779999999999998 25.535000000000004 26.22 105-109 23.794999999999998 24.695 25.624999999999996 25.885 110-114 24.154999999999998 24.990000000000002 25.295 25.56 115-119 23.965 25.15 24.86 26.025 120-124 24.08 24.585 25.2 26.135 125-129 24.13 25.095 25.105 25.669999999999998 130-134 23.380000000000003 24.55 25.900000000000002 26.169999999999998 135-139 23.84 24.759999999999998 25.64 25.759999999999998 140-144 24.11 24.224999999999998 25.28 26.384999999999998 145-149 23.915 24.425 25.53 26.13 150-151 23.724999999999998 24.5625 25.5375 26.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 2.0 26 3.0 27 2.0 28 2.5 29 3.0 30 5.5 31 10.5 32 15.0 33 19.5 34 27.0 35 35.0 36 52.5 37 60.5 38 68.5 39 95.0 40 123.5 41 161.0 42 182.5 43 180.5 44 187.5 45 201.0 46 204.0 47 202.5 48 207.5 49 193.5 50 165.5 51 145.0 52 134.5 53 125.0 54 106.5 55 89.5 56 75.5 57 68.0 58 66.5 59 78.0 60 82.0 61 72.5 62 57.0 63 54.0 64 61.0 65 56.5 66 51.5 67 39.5 68 36.0 69 38.5 70 35.0 71 32.5 72 21.0 73 14.5 74 17.0 75 14.5 76 7.0 77 4.0 78 3.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.2125 0.0 0.0 0.0 0.0 132-133 2.4749999999999996 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 3.0 0.0 0.0 0.0 0.0 138-139 3.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGTCT 10 0.005853838 152.57895 1 CTGTCTC 10 0.0068378756 144.95 2 >>END_MODULE SRR6958300 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958300_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3895 33.0 33.0 34.0 32.0 34.0 2 32.4515 33.0 33.0 34.0 31.0 34.0 3 32.35725 33.0 33.0 34.0 31.0 34.0 4 32.2415 33.0 33.0 34.0 31.0 34.0 5 32.28225 33.0 33.0 34.0 31.0 34.0 6 36.20775 38.0 38.0 38.0 33.0 38.0 7 36.28775 38.0 38.0 38.0 33.0 38.0 8 36.14875 38.0 38.0 38.0 33.0 38.0 9 35.85025 38.0 37.0 38.0 31.0 38.0 10-14 36.187650000000005 38.0 38.0 38.0 32.6 38.0 15-19 36.29705 38.0 38.0 38.0 33.8 38.0 20-24 36.465149999999994 38.0 38.0 38.0 34.2 38.0 25-29 36.2134 38.0 38.0 38.0 33.6 38.0 30-34 36.383250000000004 38.0 38.0 38.0 34.0 38.0 35-39 36.118100000000005 38.0 38.0 38.0 33.4 38.0 40-44 35.98475 38.0 37.8 38.0 32.6 38.0 45-49 36.00645 38.0 37.8 38.0 32.6 38.0 50-54 35.967150000000004 38.0 37.8 38.0 32.6 38.0 55-59 36.128299999999996 38.0 38.0 38.0 33.4 38.0 60-64 35.844500000000004 38.0 37.4 38.0 32.0 38.0 65-69 35.599000000000004 38.0 37.0 38.0 30.2 38.0 70-74 35.32770000000001 38.0 36.6 38.0 29.2 38.0 75-79 35.2685 38.0 36.4 38.0 28.8 38.0 80-84 35.16545 38.0 36.4 38.0 28.8 38.0 85-89 35.06695 38.0 36.0 38.0 28.4 38.0 90-94 34.8716 38.0 35.8 38.0 27.6 38.0 95-99 34.364850000000004 38.0 35.0 38.0 23.4 38.0 100-104 33.870999999999995 38.0 34.2 38.0 21.4 38.0 105-109 33.9261 38.0 34.4 38.0 21.0 38.0 110-114 33.6668 38.0 34.0 38.0 21.8 38.0 115-119 32.959 37.6 32.8 38.0 17.8 38.0 120-124 32.7479 37.8 33.0 38.0 15.0 38.0 125-129 32.16825 37.2 31.6 38.0 14.4 38.0 130-134 31.4286 36.2 30.6 38.0 13.2 38.0 135-139 30.528699999999997 35.8 28.8 38.0 13.0 38.0 140-144 29.45995 34.4 26.0 38.0 8.2 38.0 145-149 27.555200000000003 33.4 19.2 38.0 2.0 38.0 150-151 21.55825 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 9.0 4 9.0 5 3.0 6 4.0 7 2.0 8 2.0 9 2.0 10 6.0 11 4.0 12 3.0 13 3.0 14 2.0 15 6.0 16 7.0 17 10.0 18 15.0 19 11.0 20 13.0 21 13.0 22 21.0 23 17.0 24 34.0 25 36.0 26 41.0 27 71.0 28 73.0 29 69.0 30 109.0 31 141.0 32 166.0 33 240.0 34 296.0 35 496.0 36 879.0 37 1171.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.470735367683844 20.910455227613806 10.930465232616308 26.688344172086044 2 29.9 23.375 24.9 21.825 3 23.525 27.224999999999998 27.125 22.125 4 25.424999999999997 31.5 20.95 22.125 5 28.050000000000004 32.800000000000004 19.3 19.85 6 24.85 34.375 21.5 19.275000000000002 7 23.825 19.425 32.95 23.799999999999997 8 25.124999999999996 23.575 21.475 29.825000000000003 9 24.9 23.375 26.25 25.474999999999998 10-14 26.534999999999997 25.955000000000002 23.005 24.505 15-19 26.25 25.669999999999998 24.32 23.76 20-24 25.35 25.629999999999995 24.215 24.805 25-29 26.32 25.380000000000003 24.060000000000002 24.240000000000002 30-34 26.56 25.724999999999998 23.669999999999998 24.044999999999998 35-39 25.919999999999998 26.495 23.794999999999998 23.79 40-44 25.525 26.085 24.0 24.39 45-49 26.029999999999998 24.98 24.55 24.44 50-54 26.284999999999997 25.580000000000002 24.505 23.630000000000003 55-59 26.71 25.495 23.535 24.26 60-64 26.035000000000004 25.814999999999998 24.125 24.025 65-69 26.424999999999997 25.180000000000003 24.610000000000003 23.785 70-74 26.3 24.87 24.485 24.345 75-79 25.89 25.03 24.84 24.240000000000002 80-84 25.995 25.645 24.585 23.775 85-89 26.415 25.14 24.29 24.154999999999998 90-94 25.990000000000002 26.22 24.09 23.7 95-99 26.555 25.135 24.855 23.455000000000002 100-104 26.36 25.61 24.175 23.855 105-109 26.11 25.180000000000003 24.345 24.365000000000002 110-114 26.3 25.724999999999998 24.245 23.73 115-119 26.314999999999998 25.105 24.635 23.945 120-124 26.035000000000004 25.540000000000003 24.185000000000002 24.240000000000002 125-129 26.474999999999998 25.814999999999998 24.22 23.49 130-134 26.919999999999998 25.7 24.125 23.255 135-139 26.484999999999996 25.485000000000003 24.435000000000002 23.595 140-144 26.700000000000003 25.395 24.715 23.189999999999998 145-149 26.875 25.590000000000003 24.725 22.81 150-151 26.674999999999997 25.387500000000003 24.5125 23.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 2.0 26 2.5 27 1.0 28 2.0 29 3.5 30 4.0 31 6.0 32 12.0 33 15.5 34 15.0 35 19.5 36 27.5 37 44.5 38 71.0 39 89.0 40 122.0 41 151.5 42 166.5 43 171.5 44 183.0 45 202.0 46 200.0 47 197.5 48 202.5 49 183.0 50 159.5 51 146.5 52 128.0 53 130.0 54 116.0 55 99.5 56 88.5 57 83.5 58 86.5 59 83.0 60 78.5 61 73.5 62 73.5 63 66.0 64 58.5 65 57.0 66 55.0 67 52.0 68 54.5 69 51.5 70 42.0 71 32.5 72 23.0 73 20.0 74 16.0 75 8.5 76 4.5 77 5.0 78 4.5 79 2.5 80 1.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4275653923541248 0.8500000000000001 3 0.05030181086519115 0.15 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 0.9874999999999999 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.4500000000000002 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.9874999999999998 0.0 0.0 0.0 0.0 130-131 2.2125 0.0 0.0 0.0 0.0 132-133 2.4749999999999996 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAACTG 10 0.006830828 145.0 1 >>END_MODULE Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889964 spots for SRR6958300.sra Written 889964 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra Read 889947 spots for SRR6958300.sra Written 889947 spots for SRR6958300.sra SRR ids: ['SRR6958300.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o89m82zs SRR6958300.sra spots: 17798957 blocks: [[1, 889947], [889948, 1779894], [1779895, 2669841], [2669842, 3559788], [3559789, 4449735], [4449736, 5339682], [5339683, 6229629], [6229630, 7119576], [7119577, 8009523], [8009524, 8899470], [8899471, 9789417], [9789418, 10679364], [10679365, 11569311], [11569312, 12459258], [12459259, 13349205], [13349206, 14239152], [14239153, 15129099], [15129100, 16019046], [16019047, 16908993], [16908994, 17798957]] SRR6958300 file size 6009782 SRR6958300 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958300 SRR6958300_1.fastq SRR6958300_2.fastq Input file: SRR6958300_1.fastq Paired file: SRR6958300_2.fastq trimmed: SRR6958300-trimmed-pair1.fastq, SRR6958300-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:07:33 2024 >> started Fri Dec 6 19:07:55 2024 >> done (21.855s) 17798957 read pairs processed; of these: 39416 ( 0.22%) short read pairs filtered out after trimming by size control 35814 ( 0.20%) empty read pairs filtered out after trimming by size control 17723727 (99.58%) read pairs available; of these: 7770693 (43.84%) trimmed read pairs available after processing 9953034 (56.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 5 0.00% 21 3 0.00% 22 5 0.00% 23 1 0.00% 24 6 0.00% 25 6 0.00% 26 13 0.00% 27 4 0.00% 28 9 0.00% 29 7 0.00% 30 8 0.00% 31 8 0.00% 32 10 0.00% 33 9 0.00% 34 10 0.00% 35 4 0.00% 36 8 0.00% 37 12 0.00% 38 17 0.00% 39 17 0.00% 40 18 0.00% 41 18 0.00% 42 14 0.00% 43 19 0.00% 44 32 0.00% 45 25 0.00% 46 27 0.00% 47 29 0.00% 48 26 0.00% 49 39 0.00% 50 34 0.00% 51 40 0.00% 52 41 0.00% 53 56 0.00% 54 61 0.00% 55 60 0.00% 56 82 0.00% 57 78 0.00% 58 90 0.00% 59 90 0.00% 60 131 0.00% 61 123 0.00% 62 146 0.00% 63 158 0.00% 64 154 0.00% 65 179 0.00% 66 199 0.00% 67 228 0.00% 68 248 0.00% 69 247 0.00% 70 296 0.00% 71 328 0.00% 72 383 0.00% 73 445 0.00% 74 491 0.00% 75 563 0.00% 76 630 0.00% 77 682 0.00% 78 739 0.00% 79 857 0.00% 80 997 0.01% 81 1155 0.01% 82 1325 0.01% 83 1659 0.01% 84 3198 0.02% 85 4029 0.02% 86 3985 0.02% 87 4033 0.02% 88 4154 0.02% 89 4222 0.02% 90 4373 0.02% 91 4518 0.03% 92 4718 0.03% 93 4992 0.03% 94 5550 0.03% 95 5642 0.03% 96 6022 0.03% 97 6372 0.04% 98 6673 0.04% 99 7038 0.04% 100 7608 0.04% 101 8036 0.05% 102 8608 0.05% 103 9189 0.05% 104 9968 0.06% 105 10727 0.06% 106 11216 0.06% 107 11888 0.07% 108 12521 0.07% 109 13109 0.07% 110 13995 0.08% 111 14661 0.08% 112 15929 0.09% 113 17000 0.10% 114 17797 0.10% 115 19008 0.11% 116 19786 0.11% 117 20780 0.12% 118 21416 0.12% 119 22501 0.13% 120 23652 0.13% 121 24695 0.14% 122 26121 0.15% 123 27656 0.16% 124 29605 0.17% 125 31417 0.18% 126 32780 0.18% 127 34979 0.20% 128 36060 0.20% 129 37658 0.21% 130 39826 0.22% 131 41963 0.24% 132 44774 0.25% 133 47593 0.27% 134 50219 0.28% 135 54142 0.31% 136 57665 0.33% 137 60795 0.34% 138 64835 0.37% 139 70787 0.40% 140 76444 0.43% 141 83512 0.47% 142 93129 0.53% 143 106083 0.60% 144 123852 0.70% 145 150132 0.85% 146 191081 1.08% 147 259672 1.47% 148 397113 2.24% 149 800828 4.52% 150 4272954 24.11% 151 9953034 56.16% 17723727 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.64 fanout-score-rank=22 prefix-density=0.41 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=199.70 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=10.1 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.84 fanout-score-rank=14 prefix-density=0.30 prefix-fanout=4.0 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=83.44 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=14.0 sequence=GCCGCCGCCGCCA SRR6958300 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:11:44 Started mapping on | Dec 06 19:11:44 Finished on | Dec 06 19:13:19 Mapping speed, Million of reads per hour | 671.64 Number of input reads | 17723727 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17026448 Uniquely mapped reads % | 96.07% Average mapped length | 296.11 Number of splices: Total | 18145064 Number of splices: Annotated (sjdb) | 16988773 Number of splices: GT/AG | 17905774 Number of splices: GC/AG | 204914 Number of splices: AT/AC | 8924 Number of splices: Non-canonical | 25452 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 158155 % of reads mapped to multiple loci | 0.89% Number of reads mapped to too many loci | 13545 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 561530 561530 561530 N_multimapping 158155 158155 158155 N_noFeature 566940 16545424 721451 N_ambiguous 391088 2715 65750 UnstrandedReadsAssigned:16068420 PositiveStrandReadsAssigned:478309 NegativeStrandReadsAssigned:16239247 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958300 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958300-trimmed-pair1.fastq SRR6958300-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,723,727 reads, 16,238,259 reads pseudoaligned [quant] estimated average fragment length: 254.021 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR6958300.ke.tsv 35125 SRR6958300.se.tsv 88098 total ==> SRR6958300.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.453 128.716 16.5858 PNS24247 1044 790.979 31.8763 3.54907 PNS24249 1928 1674.98 103.93 5.4644 PNS24246 1044 790.979 31.8763 3.54907 PNS24248 1044 790.979 31.8763 3.54907 PNS24244 1471 1217.98 71.7252 5.18614 PNS24243 293 84.4771 0 0 KQK14069 1603 1349.98 1488.21 97.0845 KQK14071 474 231.032 29.3566 11.1904 ==> SRR6958300.se.tsv <== BRADI_1g14170v3 1636 BRADI_1g53295v3 284 BRADI_1g59795v3 270 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 509 BRADI_1g74790v3 507 BRADI_1g09890v3 0 BRADI_1g77505v3 248 BRADI_1g48960v3 0 SRR6958300 completed mapping pipeline successfully