Starting /dee2/code/volunteer_pipeline.sh SRR6958301 current disk space = 1549954322432 free memory = 1603669476 SRR6958301 SRAfilesize d47e8de0570ce4f29990d33bce693501 SRR6958301.sra SRR6958301.sra file validated SRR6958301 is paired end SRR6958301 is conventional basespace SRR6958301 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958301_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.66925 32.0 18.0 33.0 18.0 33.0 2 24.76325 25.0 18.0 29.0 18.0 33.0 3 28.404 29.0 27.0 31.0 25.0 33.0 4 30.488 31.0 29.0 33.0 27.0 33.0 5 31.8435 33.0 32.0 33.0 30.0 33.0 6 35.39725 37.0 35.0 38.0 29.0 38.0 7 36.56825 38.0 37.0 38.0 34.0 38.0 8 36.322 38.0 37.0 38.0 33.0 38.0 9 37.06875 38.0 38.0 38.0 36.0 38.0 10-14 37.3224 38.0 38.0 38.0 36.6 38.0 15-19 37.42355 38.0 38.0 38.0 37.0 38.0 20-24 37.454449999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.5692 38.0 38.0 38.0 37.8 38.0 30-34 37.636900000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.59565 38.0 38.0 38.0 37.8 38.0 40-44 37.5586 38.0 38.0 38.0 37.8 38.0 45-49 37.4734 38.0 38.0 38.0 37.8 38.0 50-54 37.22095 38.0 38.0 38.0 36.6 38.0 55-59 37.12345 38.0 38.0 38.0 36.0 38.0 60-64 37.042950000000005 38.0 38.0 38.0 35.8 38.0 65-69 36.984500000000004 38.0 38.0 38.0 35.2 38.0 70-74 37.164 38.0 38.0 38.0 36.0 38.0 75-79 37.06915 38.0 38.0 38.0 36.0 38.0 80-84 37.0655 38.0 38.0 38.0 36.0 38.0 85-89 37.1012 38.0 38.0 38.0 36.0 38.0 90-94 37.04675 38.0 38.0 38.0 35.4 38.0 95-99 36.81845 38.0 38.0 38.0 34.8 38.0 100-104 36.71695 38.0 38.0 38.0 34.4 38.0 105-109 36.651900000000005 38.0 38.0 38.0 34.4 38.0 110-114 36.47595 38.0 37.8 38.0 34.0 38.0 115-119 36.31515 38.0 37.2 38.0 33.8 38.0 120-124 36.20055 38.0 37.0 38.0 33.6 38.0 125-129 35.93725 38.0 36.6 38.0 32.6 38.0 130-134 35.859899999999996 38.0 36.0 38.0 32.2 38.0 135-139 35.4948 38.0 35.8 38.0 31.0 38.0 140-144 35.1312 38.0 35.0 38.0 29.6 38.0 145-149 34.380700000000004 38.0 33.6 38.0 27.0 38.0 150-151 30.62625 35.5 28.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 2.0 19 3.0 20 1.0 21 0.0 22 2.0 23 2.0 24 6.0 25 2.0 26 12.0 27 12.0 28 19.0 29 15.0 30 26.0 31 49.0 32 59.0 33 102.0 34 184.0 35 340.0 36 1031.0 37 2132.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.284552845528456 21.620934959349594 6.326219512195122 41.76829268292683 2 21.4 17.275 33.275 28.050000000000004 3 20.200000000000003 19.3 23.974999999999998 36.525 4 23.05 28.599999999999998 21.4 26.950000000000003 5 23.425 34.449999999999996 23.275000000000002 18.85 6 20.925 33.975 23.674999999999997 21.425 7 15.65 25.15 41.0 18.2 8 19.7 25.074999999999996 30.325000000000003 24.9 9 18.425 23.25 34.849999999999994 23.474999999999998 10-14 21.240000000000002 28.389999999999997 26.8 23.57 15-19 21.83 27.79 27.11 23.27 20-24 21.65324798719808 28.179226884032605 27.509126368955343 22.658398759813974 25-29 21.490000000000002 27.955000000000002 27.034999999999997 23.52 30-34 21.375 27.384999999999998 27.779999999999998 23.46 35-39 21.83 27.755000000000003 27.16 23.255 40-44 21.445 27.73 27.46 23.365 45-49 21.17317597639646 27.699154873230984 27.989198379756964 23.138470770615594 50-54 22.1 28.005000000000003 26.55 23.345 55-59 21.64 28.15 26.790000000000003 23.419999999999998 60-64 21.739782902306036 27.437346806062727 27.092191486168776 23.730678805462457 65-69 21.119223844768953 27.465493098619724 27.500500100020002 23.914782956591317 70-74 21.735 28.189999999999998 26.6 23.474999999999998 75-79 21.445 27.275 27.0 24.279999999999998 80-84 21.395 27.675 26.540000000000003 24.39 85-89 21.07 26.919999999999998 27.71 24.3 90-94 22.175 27.445000000000004 27.065 23.315 95-99 21.535 27.155 27.534999999999997 23.775 100-104 22.095000000000002 27.765 26.985 23.155 105-109 21.47 28.315 26.25 23.965 110-114 22.325 28.255000000000003 25.895000000000003 23.525 115-119 22.365 28.875 25.905 22.855 120-124 22.005 27.62 26.11 24.265 125-129 22.255 27.529999999999998 26.525 23.69 130-134 22.305 27.46 26.135 24.099999999999998 135-139 22.555 27.54 25.335 24.57 140-144 22.0 27.57 25.669999999999998 24.759999999999998 145-149 22.425 27.029999999999998 25.745 24.8 150-151 21.637500000000003 26.687499999999996 26.325 25.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 2.0 26 4.5 27 6.5 28 12.0 29 16.0 30 14.0 31 20.0 32 23.0 33 31.0 34 46.0 35 67.5 36 89.5 37 102.5 38 118.5 39 144.5 40 177.5 41 207.5 42 243.0 43 266.0 44 262.5 45 237.0 46 219.0 47 219.0 48 215.0 49 194.0 50 160.0 51 143.5 52 121.0 53 95.0 54 76.0 55 60.0 56 57.5 57 50.5 58 45.0 59 39.5 60 28.5 61 24.5 62 26.5 63 25.0 64 24.0 65 17.5 66 11.0 67 9.5 68 8.5 69 7.0 70 6.0 71 6.0 72 4.5 73 4.0 74 4.0 75 2.5 76 1.0 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.045 65-69 0.02 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.55 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 2.2125000000000004 0.0 0.0 0.0 0.0 104-105 2.6 0.0 0.0 0.0 0.0 106-107 3.0625 0.0 0.0 0.0 0.0 108-109 3.4875 0.0 0.0 0.0 0.0 110-111 3.9499999999999997 0.0 0.0 0.0 0.0 112-113 4.4875 0.0 0.0 0.0 0.0 114-115 5.0 0.0 0.0 0.0 0.0 116-117 5.775 0.0 0.0 0.0 0.0 118-119 6.5625 0.0 0.0 0.0 0.0 120-121 7.2125 0.0 0.0 0.0 0.0 122-123 7.975 0.0 0.0 0.0 0.0 124-125 8.7625 0.0 0.0 0.0 0.0 126-127 9.587499999999999 0.0 0.0 0.0 0.0 128-129 10.5625 0.0 0.0 0.0 0.0 130-131 11.525 0.0 0.0 0.0 0.0 132-133 12.425 0.0 0.0 0.0 0.0 134-135 13.462499999999999 0.0 0.0 0.0 0.0 136-137 14.6875 0.0 0.0 0.0 0.0 138-139 15.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCCAG 35 0.003540148 20.710714 140-144 >>END_MODULE SRR6958301 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958301_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15675 33.0 33.0 34.0 33.0 34.0 2 33.235 34.0 33.0 34.0 33.0 34.0 3 33.34225 34.0 33.0 34.0 33.0 34.0 4 33.3205 34.0 33.0 34.0 33.0 34.0 5 33.318 34.0 33.0 34.0 33.0 34.0 6 37.521 38.0 38.0 38.0 38.0 38.0 7 37.545 38.0 38.0 38.0 38.0 38.0 8 37.51025 38.0 38.0 38.0 38.0 38.0 9 37.4865 38.0 38.0 38.0 38.0 38.0 10-14 37.45485 38.0 38.0 38.0 37.8 38.0 15-19 37.476299999999995 38.0 38.0 38.0 38.0 38.0 20-24 36.761849999999995 38.0 37.8 38.0 34.2 38.0 25-29 37.5352 38.0 38.0 38.0 38.0 38.0 30-34 37.554950000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.00905 38.0 38.0 38.0 35.4 38.0 40-44 37.458450000000006 38.0 38.0 38.0 37.8 38.0 45-49 37.50065 38.0 38.0 38.0 38.0 38.0 50-54 37.492900000000006 38.0 38.0 38.0 38.0 38.0 55-59 36.862049999999996 38.0 37.8 38.0 35.0 38.0 60-64 37.4113 38.0 38.0 38.0 37.8 38.0 65-69 37.396100000000004 38.0 38.0 38.0 37.2 38.0 70-74 37.4152 38.0 38.0 38.0 37.4 38.0 75-79 37.3261 38.0 38.0 38.0 37.4 38.0 80-84 37.322500000000005 38.0 38.0 38.0 37.0 38.0 85-89 37.234750000000005 38.0 38.0 38.0 36.8 38.0 90-94 37.1351 38.0 38.0 38.0 36.6 38.0 95-99 37.08565 38.0 38.0 38.0 36.2 38.0 100-104 36.2636 38.0 37.4 38.0 32.2 38.0 105-109 36.23905 38.0 37.2 38.0 31.0 38.0 110-114 36.30575 38.0 37.4 38.0 33.0 38.0 115-119 36.72075 38.0 38.0 38.0 35.0 38.0 120-124 34.71655 38.0 35.4 38.0 24.8 38.0 125-129 35.799749999999996 38.0 36.4 38.0 32.0 38.0 130-134 34.4224 38.0 34.4 38.0 24.4 38.0 135-139 33.076299999999996 37.4 31.4 38.0 21.4 38.0 140-144 34.08765 38.0 33.4 38.0 24.0 38.0 145-149 34.1873 38.0 34.8 38.0 26.2 38.0 150-151 28.3225 34.5 18.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 2.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 0.0 18 2.0 19 5.0 20 4.0 21 1.0 22 3.0 23 8.0 24 6.0 25 11.0 26 9.0 27 13.0 28 21.0 29 22.0 30 27.0 31 26.0 32 62.0 33 93.0 34 149.0 35 309.0 36 1028.0 37 2192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.775 18.7 10.75 30.775000000000002 2 28.299999999999997 24.975 29.925 16.8 3 22.025 25.874999999999996 31.175000000000004 20.925 4 26.05 32.5 21.25 20.200000000000003 5 26.275 35.375 20.674999999999997 17.675 6 21.55 37.925 21.7 18.825 7 21.775 20.225 36.9 21.099999999999998 8 22.875 22.825 27.125 27.175 9 23.95 23.1 29.725 23.225 10-14 24.529999999999998 28.155 25.124999999999996 22.189999999999998 15-19 24.175 27.134999999999998 26.16 22.53 20-24 24.39 26.979999999999997 26.85 21.78 25-29 24.025 26.805 26.75 22.42 30-34 24.085 27.169999999999998 26.595000000000002 22.15 35-39 24.29 26.979999999999997 26.965 21.765 40-44 24.365000000000002 27.224999999999998 26.900000000000002 21.51 45-49 23.61 26.825 27.065 22.5 50-54 23.89 27.57 26.82 21.72 55-59 24.095 27.339999999999996 26.450000000000003 22.115000000000002 60-64 24.545 26.39 27.115000000000002 21.95 65-69 24.03 27.045 27.325 21.6 70-74 24.03 26.974999999999998 27.515 21.48 75-79 23.915 26.939999999999998 27.785 21.36 80-84 23.555 27.065 27.87 21.51 85-89 24.115000000000002 27.715 26.58 21.59 90-94 24.279999999999998 27.41 27.029999999999998 21.279999999999998 95-99 24.305 27.665 26.865 21.165 100-104 24.465 27.575 26.655 21.305 105-109 24.265 27.725 26.840000000000003 21.17 110-114 24.585 28.01 26.305 21.099999999999998 115-119 25.169999999999998 27.985 26.07 20.775 120-124 24.455 27.625 26.669999999999998 21.25 125-129 25.380000000000003 27.91 26.240000000000002 20.47 130-134 25.75 26.97 27.0 20.28 135-139 26.36 27.71 26.064999999999998 19.865 140-144 26.57 27.27 26.38 19.78 145-149 27.42 27.1 26.245 19.235 150-151 27.212500000000002 26.387500000000003 26.950000000000003 19.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 3.0 24 2.5 25 2.0 26 2.5 27 3.5 28 7.0 29 8.5 30 11.5 31 15.0 32 22.5 33 34.5 34 47.5 35 59.5 36 73.5 37 93.5 38 105.0 39 139.5 40 183.0 41 192.0 42 202.5 43 228.0 44 247.0 45 245.0 46 238.0 47 224.5 48 206.5 49 185.5 50 166.0 51 148.0 52 121.0 53 105.0 54 87.5 55 81.0 56 72.0 57 59.5 58 59.5 59 47.5 60 37.5 61 37.5 62 34.5 63 24.5 64 23.0 65 26.0 66 23.5 67 17.0 68 8.0 69 7.5 70 9.5 71 6.0 72 4.5 73 4.0 74 2.5 75 1.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.35167043456417985 0.7000000000000001 3 0.025119316754584273 0.075 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.7250000000000001 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 2.1624999999999996 0.0 0.0 0.0 0.0 104-105 2.525 0.0 0.0 0.0 0.0 106-107 2.9375 0.0 0.0 0.0 0.0 108-109 3.3375000000000004 0.0 0.0 0.0 0.0 110-111 3.7874999999999996 0.0 0.0 0.0 0.0 112-113 4.2875 0.0 0.0 0.0 0.0 114-115 4.75 0.0 0.0 0.0 0.0 116-117 5.4375 0.0 0.0 0.0 0.0 118-119 6.15 0.0 0.0 0.0 0.0 120-121 6.675 0.0 0.0 0.0 0.0 122-123 7.275 0.0 0.0 0.0 0.0 124-125 7.8625 0.0 0.0 0.0 0.0 126-127 8.475 0.0 0.0 0.0 0.0 128-129 9.2875 0.0 0.0 0.0 0.0 130-131 10.0125 0.0 0.0 0.0 0.0 132-133 10.787500000000001 0.0 0.0 0.0 0.0 134-135 11.675 0.0 0.0 0.0 0.0 136-137 12.725000000000001 0.0 0.0 0.0 0.0 138-139 13.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTCAA 10 0.006830828 145.0 9 GTAGGGA 40 0.0076550315 18.125 135-139 GAGCGTC 65 0.0076375785 13.384615 140-144 AGAGCGT 65 0.0076375785 13.384615 140-144 >>END_MODULE Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554228 spots for SRR6958301.sra Written 554228 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra Read 554217 spots for SRR6958301.sra Written 554217 spots for SRR6958301.sra SRR ids: ['SRR6958301.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4gq1xkuw SRR6958301.sra spots: 11084351 blocks: [[1, 554217], [554218, 1108434], [1108435, 1662651], [1662652, 2216868], [2216869, 2771085], [2771086, 3325302], [3325303, 3879519], [3879520, 4433736], [4433737, 4987953], [4987954, 5542170], [5542171, 6096387], [6096388, 6650604], [6650605, 7204821], [7204822, 7759038], [7759039, 8313255], [8313256, 8867472], [8867473, 9421689], [9421690, 9975906], [9975907, 10530123], [10530124, 11084351]] SRR6958301 file size 3734422 SRR6958301 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958301 SRR6958301_1.fastq SRR6958301_2.fastq Input file: SRR6958301_1.fastq Paired file: SRR6958301_2.fastq trimmed: SRR6958301-trimmed-pair1.fastq, SRR6958301-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:11:45 2024 >> started Fri Dec 6 19:11:57 2024 >> done (11.826s) 11084351 read pairs processed; of these: 4427 ( 0.04%) short read pairs filtered out after trimming by size control 7710 ( 0.07%) empty read pairs filtered out after trimming by size control 11072214 (99.89%) read pairs available; of these: 6666063 (60.21%) trimmed read pairs available after processing 4406151 (39.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 6 0.00% 21 4 0.00% 22 7 0.00% 23 7 0.00% 24 9 0.00% 25 6 0.00% 26 7 0.00% 27 10 0.00% 28 18 0.00% 29 9 0.00% 30 19 0.00% 31 12 0.00% 32 12 0.00% 33 19 0.00% 34 15 0.00% 35 12 0.00% 36 17 0.00% 37 15 0.00% 38 28 0.00% 39 34 0.00% 40 38 0.00% 41 31 0.00% 42 42 0.00% 43 43 0.00% 44 32 0.00% 45 44 0.00% 46 52 0.00% 47 60 0.00% 48 58 0.00% 49 85 0.00% 50 94 0.00% 51 122 0.00% 52 97 0.00% 53 129 0.00% 54 126 0.00% 55 128 0.00% 56 156 0.00% 57 173 0.00% 58 195 0.00% 59 265 0.00% 60 297 0.00% 61 307 0.00% 62 363 0.00% 63 354 0.00% 64 475 0.00% 65 468 0.00% 66 508 0.00% 67 637 0.01% 68 684 0.01% 69 733 0.01% 70 946 0.01% 71 1075 0.01% 72 1120 0.01% 73 1302 0.01% 74 1534 0.01% 75 1807 0.02% 76 2000 0.02% 77 2215 0.02% 78 2358 0.02% 79 2679 0.02% 80 2854 0.03% 81 3256 0.03% 82 3760 0.03% 83 4082 0.04% 84 4694 0.04% 85 5473 0.05% 86 5675 0.05% 87 6400 0.06% 88 6802 0.06% 89 7407 0.07% 90 8125 0.07% 91 8803 0.08% 92 9753 0.09% 93 10629 0.10% 94 11668 0.11% 95 12386 0.11% 96 13202 0.12% 97 13882 0.13% 98 14553 0.13% 99 15966 0.14% 100 17302 0.16% 101 18765 0.17% 102 19771 0.18% 103 20343 0.18% 104 22173 0.20% 105 22814 0.21% 106 24260 0.22% 107 25369 0.23% 108 26071 0.24% 109 27776 0.25% 110 28317 0.26% 111 29160 0.26% 112 30733 0.28% 113 31658 0.29% 114 34017 0.31% 115 35649 0.32% 116 36760 0.33% 117 37785 0.34% 118 39021 0.35% 119 39131 0.35% 120 40623 0.37% 121 41965 0.38% 122 43626 0.39% 123 45646 0.41% 124 47459 0.43% 125 48871 0.44% 126 50129 0.45% 127 51754 0.47% 128 52790 0.48% 129 54186 0.49% 130 56777 0.51% 131 57840 0.52% 132 59752 0.54% 133 62862 0.57% 134 65240 0.59% 135 67998 0.61% 136 70959 0.64% 137 74205 0.67% 138 77144 0.70% 139 82094 0.74% 140 85854 0.78% 141 92942 0.84% 142 100561 0.91% 143 111538 1.01% 144 124652 1.13% 145 147341 1.33% 146 177254 1.60% 147 229511 2.07% 148 334211 3.02% 149 640687 5.79% 150 2709240 24.47% 151 4406151 39.79% 11072214 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=31 prefix-density=0.27 prefix-fanout=2.8 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=204.87 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=24.3 sequence=TTCTTCTTGTCCA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=6.00 fanout-score-rank=12 prefix-density=0.39 prefix-fanout=3.8 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=39.19 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=3.8 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958301 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:12:40 Started mapping on | Dec 06 19:12:40 Finished on | Dec 06 19:13:42 Mapping speed, Million of reads per hour | 642.90 Number of input reads | 11072214 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 10856049 Uniquely mapped reads % | 98.05% Average mapped length | 288.99 Number of splices: Total | 12387391 Number of splices: Annotated (sjdb) | 11645248 Number of splices: GT/AG | 12223073 Number of splices: GC/AG | 139901 Number of splices: AT/AC | 5767 Number of splices: Non-canonical | 18650 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 121365 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 4983 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 97281 97281 97281 N_multimapping 121365 121365 121365 N_noFeature 502669 10560458 606984 N_ambiguous 225587 1181 34894 UnstrandedReadsAssigned:10127793 PositiveStrandReadsAssigned:294410 NegativeStrandReadsAssigned:10214171 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR6958301 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958301-trimmed-pair1.fastq SRR6958301-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,072,214 reads, 10,252,794 reads pseudoaligned [quant] estimated average fragment length: 203.053 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 SRR6958301.ke.tsv 35125 SRR6958301.se.tsv 88098 total ==> SRR6958301.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 734.277 0 0 PNS24247 1044 841.947 33.387 6.18213 PNS24249 1928 1725.95 22.805 2.05991 PNS24246 1044 841.947 33.387 6.18213 PNS24248 1044 841.947 33.387 6.18213 PNS24244 1471 1268.95 27.0341 3.32134 PNS24243 293 109.951 0 0 KQK14069 1603 1400.95 1278.42 142.265 KQK14071 474 274.97 44.0679 24.9852 ==> SRR6958301.se.tsv <== BRADI_1g14170v3 1612 BRADI_1g53295v3 180 BRADI_1g59795v3 295 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 219 BRADI_1g74790v3 54 BRADI_1g09890v3 0 BRADI_1g77505v3 245 BRADI_1g48960v3 0 SRR6958301 completed mapping pipeline successfully