Starting /dee2/code/volunteer_pipeline.sh SRR6958302 current disk space = 1549738655744 free memory = 1598933220 SRR6958302 SRAfilesize 80ac15ab2323b9d007d19c1d1317af92 SRR6958302.sra SRR6958302.sra file validated SRR6958302 is paired end SRR6958302 is conventional basespace SRR6958302 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958302_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.04075 18.0 18.0 28.0 18.0 32.0 2 26.2015 26.0 25.0 30.0 18.0 33.0 3 28.2525 29.0 27.0 31.0 18.0 33.0 4 28.785 31.0 28.0 33.0 15.0 33.0 5 29.5535 31.0 29.0 33.0 25.0 33.0 6 35.844 37.0 36.0 38.0 31.0 38.0 7 36.539 38.0 37.0 38.0 34.0 38.0 8 37.21225 38.0 38.0 38.0 36.0 38.0 9 37.29025 38.0 38.0 38.0 36.0 38.0 10-14 37.31545 38.0 38.0 38.0 36.6 38.0 15-19 37.44865 38.0 38.0 38.0 37.0 38.0 20-24 37.346199999999996 38.0 38.0 38.0 36.8 38.0 25-29 37.1866 38.0 38.0 38.0 36.4 38.0 30-34 36.99895 38.0 38.0 38.0 36.0 38.0 35-39 37.049 38.0 38.0 38.0 36.0 38.0 40-44 36.884750000000004 38.0 38.0 38.0 35.4 38.0 45-49 36.8478 38.0 38.0 38.0 35.0 38.0 50-54 36.35685 38.0 37.8 38.0 33.2 38.0 55-59 36.4108 38.0 37.6 38.0 33.6 38.0 60-64 36.741049999999994 38.0 38.0 38.0 34.4 38.0 65-69 36.84075 38.0 38.0 38.0 34.8 38.0 70-74 36.53065 38.0 38.0 38.0 34.0 38.0 75-79 36.021100000000004 38.0 36.8 38.0 32.2 38.0 80-84 36.09625 38.0 37.0 38.0 32.6 38.0 85-89 36.27890000000001 38.0 37.4 38.0 33.4 38.0 90-94 36.2152 38.0 37.2 38.0 33.2 38.0 95-99 35.8215 38.0 36.6 38.0 31.4 38.0 100-104 35.18445 38.0 35.4 38.0 28.2 38.0 105-109 34.711200000000005 38.0 35.0 38.0 26.0 38.0 110-114 34.8455 38.0 35.0 38.0 27.4 38.0 115-119 34.416500000000006 38.0 34.4 38.0 24.8 38.0 120-124 34.3505 38.0 34.4 38.0 25.2 38.0 125-129 34.2336 38.0 34.2 38.0 24.0 38.0 130-134 33.61845 38.0 33.6 38.0 21.2 38.0 135-139 33.1223 37.6 32.2 38.0 19.0 38.0 140-144 32.01 36.2 31.0 38.0 14.6 38.0 145-149 29.650449999999996 34.8 27.6 38.0 6.4 38.0 150-151 23.67975 30.5 7.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 2.0 18 5.0 19 3.0 20 4.0 21 8.0 22 3.0 23 11.0 24 22.0 25 22.0 26 33.0 27 33.0 28 49.0 29 61.0 30 92.0 31 121.0 32 149.0 33 217.0 34 332.0 35 614.0 36 1104.0 37 1108.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.16684841875682 22.137404580152673 2.7535441657579063 33.94220283533261 2 18.85 13.575000000000001 31.525 36.05 3 19.725 15.475 24.4 40.400000000000006 4 25.525 24.025 22.1 28.349999999999998 5 24.875 27.500000000000004 24.375 23.25 6 23.599999999999998 29.825000000000003 23.525 23.05 7 18.475 24.025 37.225 20.275000000000002 8 20.3 23.974999999999998 27.750000000000004 27.975 9 20.625 22.5 30.9 25.974999999999998 10-14 23.325000000000003 25.6 25.4 25.674999999999997 15-19 23.56 24.625 25.855 25.96 20-24 23.549999999999997 24.779999999999998 25.835 25.835 25-29 23.36 25.040000000000003 25.865 25.735000000000003 30-34 24.38 24.75 25.074999999999996 25.795 35-39 23.905 24.02 26.025 26.05 40-44 23.57 24.895 25.430000000000003 26.105 45-49 24.025 24.95 25.064999999999998 25.96 50-54 24.03 24.82 25.305 25.845000000000002 55-59 24.285 24.69 25.4 25.624999999999996 60-64 24.22 24.355 25.169999999999998 26.255 65-69 24.2 24.595 25.055 26.150000000000002 70-74 24.015 24.54 25.355 26.090000000000003 75-79 23.76 24.474999999999998 25.724999999999998 26.040000000000003 80-84 23.855 24.325 25.585 26.235000000000003 85-89 24.315 23.945 25.82 25.919999999999998 90-94 24.27 24.335 25.275 26.119999999999997 95-99 24.57 24.22 24.975 26.235000000000003 100-104 24.13 24.36 25.535000000000004 25.974999999999998 105-109 24.740000000000002 24.085 25.165 26.009999999999998 110-114 24.425 24.709999999999997 24.91 25.955000000000002 115-119 24.11 24.959999999999997 25.259999999999998 25.669999999999998 120-124 24.044999999999998 23.855 25.72 26.38 125-129 24.095 24.605 25.380000000000003 25.919999999999998 130-134 24.47 24.425 25.040000000000003 26.064999999999998 135-139 24.52 25.145 24.745 25.590000000000003 140-144 24.165 24.785 24.915000000000003 26.135 145-149 24.560000000000002 24.58 25.130000000000003 25.729999999999997 150-151 24.275 24.2375 25.4 26.087500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.0 27 0.5 28 1.0 29 1.5 30 3.5 31 6.0 32 11.0 33 14.5 34 20.5 35 31.0 36 36.5 37 49.0 38 58.0 39 78.0 40 109.5 41 142.5 42 173.5 43 189.0 44 192.5 45 202.5 46 216.5 47 204.0 48 185.0 49 181.0 50 160.5 51 137.5 52 134.5 53 127.5 54 106.5 55 95.0 56 106.0 57 101.5 58 91.5 59 86.0 60 91.5 61 82.5 62 62.5 63 65.0 64 61.0 65 57.0 66 53.5 67 49.5 68 47.5 69 39.5 70 32.5 71 29.5 72 21.0 73 13.5 74 13.5 75 10.0 76 6.5 77 3.5 78 2.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47156517362859 98.825 2 0.40261701056869653 0.8 3 0.12581781580271767 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.7000000000000002 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.8375 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.9 0.0 0.0 0.0 0.0 120-121 4.475 0.0 0.0 0.0 0.0 122-123 5.0625 0.0 0.0 0.0 0.0 124-125 5.5875 0.0 0.0 0.0 0.0 126-127 6.05 0.0 0.0 0.0 0.0 128-129 6.575 0.0 0.0 0.0 0.0 130-131 7.125 0.0 0.0 0.0 0.0 132-133 7.875 0.0 0.0 0.0 0.0 134-135 8.6375 0.0 0.0 0.0 0.0 136-137 9.2125 0.0 0.0 0.0 0.0 138-139 9.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGTGC 10 0.0056249425 154.6 1 GTCATTG 10 0.0068396386 144.9375 5 TCATTGT 10 0.0068396386 144.9375 6 GCATCCA 10 0.0068396386 144.9375 4 >>END_MODULE SRR6958302 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958302_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.425 33.0 33.0 34.0 32.0 34.0 2 32.2905 33.0 33.0 34.0 31.0 34.0 3 32.3915 33.0 33.0 34.0 31.0 34.0 4 32.27075 33.0 33.0 34.0 31.0 34.0 5 32.3375 33.0 33.0 34.0 31.0 34.0 6 36.40875 38.0 38.0 38.0 34.0 38.0 7 36.38275 38.0 38.0 38.0 34.0 38.0 8 36.3315 38.0 38.0 38.0 34.0 38.0 9 36.40475 38.0 38.0 38.0 34.0 38.0 10-14 36.3712 38.0 38.0 38.0 34.2 38.0 15-19 36.49545 38.0 38.0 38.0 34.8 38.0 20-24 36.49015 38.0 38.0 38.0 34.6 38.0 25-29 36.496449999999996 38.0 38.0 38.0 35.0 38.0 30-34 36.52995 38.0 38.0 38.0 35.0 38.0 35-39 36.3393 38.0 38.0 38.0 34.2 38.0 40-44 36.2832 38.0 38.0 38.0 34.2 38.0 45-49 36.374199999999995 38.0 38.0 38.0 34.2 38.0 50-54 36.29514999999999 38.0 38.0 38.0 34.0 38.0 55-59 36.21935 38.0 38.0 38.0 33.8 38.0 60-64 36.03945 38.0 38.0 38.0 33.4 38.0 65-69 35.86535 38.0 37.6 38.0 32.2 38.0 70-74 35.8417 38.0 37.8 38.0 32.6 38.0 75-79 35.726150000000004 38.0 37.0 38.0 31.6 38.0 80-84 35.524649999999994 38.0 37.0 38.0 30.2 38.0 85-89 35.61135 38.0 37.0 38.0 31.4 38.0 90-94 35.287549999999996 38.0 36.4 38.0 29.8 38.0 95-99 35.10075 38.0 36.0 38.0 28.8 38.0 100-104 34.6806 38.0 35.4 38.0 26.4 38.0 105-109 34.48075 38.0 34.8 38.0 25.4 38.0 110-114 33.93745 38.0 34.4 38.0 22.6 38.0 115-119 33.73615 38.0 34.0 38.0 22.4 38.0 120-124 33.318000000000005 38.0 33.2 38.0 19.8 38.0 125-129 32.5938 38.0 32.0 38.0 14.6 38.0 130-134 31.406949999999995 36.2 30.2 38.0 13.0 38.0 135-139 30.923899999999996 36.0 29.8 38.0 12.6 38.0 140-144 30.28575 36.0 28.0 38.0 9.2 38.0 145-149 28.66245 35.4 24.6 38.0 2.0 38.0 150-151 22.2825 27.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 8.0 4 6.0 5 2.0 6 2.0 7 1.0 8 1.0 9 2.0 10 2.0 11 5.0 12 3.0 13 2.0 14 3.0 15 8.0 16 4.0 17 8.0 18 10.0 19 8.0 20 9.0 21 16.0 22 11.0 23 21.0 24 30.0 25 25.0 26 37.0 27 49.0 28 61.0 29 60.0 30 86.0 31 107.0 32 148.0 33 181.0 34 298.0 35 481.0 36 932.0 37 1345.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.575 19.725 7.6 26.1 2 28.125 23.3 25.775 22.8 3 22.5 26.25 27.375 23.875 4 26.974999999999998 31.525 19.45 22.05 5 25.674999999999997 33.525 19.575 21.224999999999998 6 24.625 33.425 19.725 22.225 7 23.275000000000002 20.375 33.475 22.875 8 24.4 23.775 22.7 29.125 9 25.025 22.525000000000002 26.1 26.35 10-14 26.06 25.655 22.75 25.535000000000004 15-19 26.115 24.884999999999998 24.05 24.95 20-24 26.195 25.290000000000003 24.065 24.45 25-29 26.595000000000002 25.580000000000002 23.285 24.54 30-34 25.900000000000002 24.59 24.25 25.259999999999998 35-39 26.169999999999998 24.9 23.91 25.019999999999996 40-44 26.334999999999997 24.805 23.915 24.945 45-49 26.369999999999997 24.875 23.375 25.380000000000003 50-54 26.590000000000003 24.62 24.195 24.595 55-59 26.115 24.665 24.125 25.095 60-64 26.115 24.884999999999998 24.255 24.745 65-69 26.095000000000002 25.195 24.015 24.695 70-74 26.645000000000003 25.19 23.805 24.36 75-79 26.22 24.495 24.099999999999998 25.185000000000002 80-84 26.179999999999996 24.595 24.22 25.005 85-89 26.645000000000003 24.86 23.895 24.6 90-94 26.39 25.645 23.724999999999998 24.240000000000002 95-99 26.545 25.47 23.595 24.39 100-104 26.484999999999996 24.495 24.595 24.425 105-109 26.325 25.130000000000003 24.41 24.135 110-114 26.26 25.369999999999997 24.279999999999998 24.09 115-119 27.33 25.619999999999997 23.62 23.43 120-124 26.795 25.245 24.3 23.66 125-129 27.584999999999997 25.235000000000003 23.705000000000002 23.474999999999998 130-134 28.08 25.080000000000002 23.855 22.985 135-139 27.560000000000002 25.564999999999998 24.115000000000002 22.759999999999998 140-144 27.955000000000002 26.115 23.45 22.48 145-149 28.685 25.569999999999997 23.724999999999998 22.02 150-151 29.525000000000002 24.712500000000002 23.375 22.3875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.0 28 3.5 29 3.0 30 2.5 31 4.5 32 7.0 33 10.0 34 14.5 35 20.5 36 28.0 37 39.5 38 55.5 39 77.0 40 99.5 41 123.5 42 145.5 43 157.0 44 165.5 45 169.0 46 177.0 47 183.5 48 189.5 49 189.0 50 177.5 51 163.5 52 139.0 53 121.5 54 118.5 55 116.0 56 109.5 57 103.5 58 98.0 59 104.5 60 109.5 61 98.0 62 91.5 63 81.0 64 69.0 65 63.5 66 63.5 67 62.5 68 52.5 69 44.0 70 36.0 71 29.5 72 22.5 73 18.0 74 13.5 75 8.0 76 5.0 77 5.0 78 4.0 79 1.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7036095577021 97.075 2 1.0676156583629894 2.1 3 0.12709710218607015 0.375 4 0.05083884087442806 0.2 5 0.05083884087442806 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.9 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.2000000000000002 0.0 0.0 0.0 0.0 98-99 1.3875000000000002 0.0 0.0 0.0 0.0 100-101 1.5750000000000002 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.35 0.0 0.0 0.0 0.0 118-119 3.975 0.0 0.0 0.0 0.0 120-121 4.512499999999999 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.6125 0.0 0.0 0.0 0.0 126-127 6.075 0.0 0.0 0.0 0.0 128-129 6.5875 0.0 0.0 0.0 0.0 130-131 7.125 0.0 0.0 0.0 0.0 132-133 7.862500000000001 0.0 0.0 0.0 0.0 134-135 8.600000000000001 0.0 0.0 0.0 0.0 136-137 9.175 0.0 0.0 0.0 0.0 138-139 9.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116351 spots for SRR6958302.sra Written 1116351 spots for SRR6958302.sra Read 1116353 spots for SRR6958302.sra Written 1116353 spots for SRR6958302.sra SRR ids: ['SRR6958302.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bee7rzid SRR6958302.sra spots: 22327022 blocks: [[1, 1116351], [1116352, 2232702], [2232703, 3349053], [3349054, 4465404], [4465405, 5581755], [5581756, 6698106], [6698107, 7814457], [7814458, 8930808], [8930809, 10047159], [10047160, 11163510], [11163511, 12279861], [12279862, 13396212], [13396213, 14512563], [14512564, 15628914], [15628915, 16745265], [16745266, 17861616], [17861617, 18977967], [18977968, 20094318], [20094319, 21210669], [21210670, 22327022]] SRR6958302 file size 7544194 SRR6958302 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958302 SRR6958302_1.fastq SRR6958302_2.fastq Input file: SRR6958302_1.fastq Paired file: SRR6958302_2.fastq trimmed: SRR6958302-trimmed-pair1.fastq, SRR6958302-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:18:39 2024 >> started Fri Dec 6 19:19:09 2024 >> done (29.825s) 22327022 read pairs processed; of these: 44559 ( 0.20%) short read pairs filtered out after trimming by size control 42450 ( 0.19%) empty read pairs filtered out after trimming by size control 22240013 (99.61%) read pairs available; of these: 11284338 (50.74%) trimmed read pairs available after processing 10955675 (49.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 5 0.00% 21 6 0.00% 22 4 0.00% 23 16 0.00% 24 10 0.00% 25 7 0.00% 26 6 0.00% 27 10 0.00% 28 12 0.00% 29 12 0.00% 30 19 0.00% 31 17 0.00% 32 20 0.00% 33 17 0.00% 34 21 0.00% 35 22 0.00% 36 24 0.00% 37 25 0.00% 38 28 0.00% 39 40 0.00% 40 57 0.00% 41 52 0.00% 42 57 0.00% 43 47 0.00% 44 60 0.00% 45 65 0.00% 46 84 0.00% 47 90 0.00% 48 107 0.00% 49 137 0.00% 50 166 0.00% 51 207 0.00% 52 204 0.00% 53 221 0.00% 54 258 0.00% 55 278 0.00% 56 295 0.00% 57 346 0.00% 58 424 0.00% 59 520 0.00% 60 570 0.00% 61 653 0.00% 62 774 0.00% 63 799 0.00% 64 922 0.00% 65 994 0.00% 66 1130 0.01% 67 1269 0.01% 68 1391 0.01% 69 1587 0.01% 70 1869 0.01% 71 2096 0.01% 72 2452 0.01% 73 2801 0.01% 74 3045 0.01% 75 3469 0.02% 76 3628 0.02% 77 4147 0.02% 78 4582 0.02% 79 5128 0.02% 80 5866 0.03% 81 6537 0.03% 82 7503 0.03% 83 8411 0.04% 84 11067 0.05% 85 12618 0.06% 86 13134 0.06% 87 13704 0.06% 88 14728 0.07% 89 15243 0.07% 90 16349 0.07% 91 17507 0.08% 92 18798 0.08% 93 20618 0.09% 94 22021 0.10% 95 23561 0.11% 96 24376 0.11% 97 25613 0.12% 98 26736 0.12% 99 28098 0.13% 100 29531 0.13% 101 31295 0.14% 102 33407 0.15% 103 35229 0.16% 104 37057 0.17% 105 38735 0.17% 106 41023 0.18% 107 41712 0.19% 108 42636 0.19% 109 45074 0.20% 110 45463 0.20% 111 48027 0.22% 112 50145 0.23% 113 51514 0.23% 114 53886 0.24% 115 56516 0.25% 116 58958 0.27% 117 59968 0.27% 118 60545 0.27% 119 61554 0.28% 120 63838 0.29% 121 64986 0.29% 122 66652 0.30% 123 70292 0.32% 124 73548 0.33% 125 75624 0.34% 126 78154 0.35% 127 79910 0.36% 128 81503 0.37% 129 84145 0.38% 130 86002 0.39% 131 88661 0.40% 132 92276 0.41% 133 95976 0.43% 134 99087 0.45% 135 104099 0.47% 136 107256 0.48% 137 111092 0.50% 138 116130 0.52% 139 122325 0.55% 140 129210 0.58% 141 136928 0.62% 142 148755 0.67% 143 163683 0.74% 144 185416 0.83% 145 215760 0.97% 146 262265 1.18% 147 345277 1.55% 148 514792 2.31% 149 1007023 4.53% 150 5111597 22.98% 151 10955675 49.26% 22240013 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=16 prefix-density=0.67 prefix-fanout=3.0 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=89.04 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.4 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=16 prefix-density=0.65 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=57.81 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.5 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGC SRR6958302 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:19:54 Started mapping on | Dec 06 19:19:56 Finished on | Dec 06 19:22:20 Mapping speed, Million of reads per hour | 556.00 Number of input reads | 22240013 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 21168589 Uniquely mapped reads % | 95.18% Average mapped length | 290.70 Number of splices: Total | 23583679 Number of splices: Annotated (sjdb) | 22173079 Number of splices: GT/AG | 23258523 Number of splices: GC/AG | 275336 Number of splices: AT/AC | 7294 Number of splices: Non-canonical | 42526 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234756 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 27247 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.01% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 861861 861861 861861 N_multimapping 234756 234756 234756 N_noFeature 582686 20504085 736193 N_ambiguous 588132 2576 78039 UnstrandedReadsAssigned:19997771 PositiveStrandReadsAssigned:661928 NegativeStrandReadsAssigned:20354357 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR6958302 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958302-trimmed-pair1.fastq SRR6958302-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,240,013 reads, 20,341,877 reads pseudoaligned [quant] estimated average fragment length: 233.608 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR6958302.ke.tsv 35125 SRR6958302.se.tsv 88098 total ==> SRR6958302.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.791 0 0 PNS24247 1044 811.392 55.4307 4.89044 PNS24249 1928 1695.39 22.667 0.957088 PNS24246 1044 811.392 55.4307 4.89044 PNS24248 1044 811.392 55.4307 4.89044 PNS24244 1471 1238.39 35.0409 2.02556 PNS24243 293 100.574 0 0 KQK14069 1603 1370.39 5284.54 276.052 KQK14071 474 251.277 83.3012 23.7316 ==> SRR6958302.se.tsv <== BRADI_1g14170v3 5891 BRADI_1g53295v3 1058 BRADI_1g59795v3 102 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 299 BRADI_1g74790v3 122 BRADI_1g09890v3 1 BRADI_1g77505v3 250 BRADI_1g48960v3 0 SRR6958302 completed mapping pipeline successfully