Starting /dee2/code/volunteer_pipeline.sh SRR6958303 current disk space = 1549730189312 free memory = 1599032036 SRR6958303 SRAfilesize 5a14c42f7258b045afceac8bd411ef0d SRR6958303.sra SRR6958303.sra file validated SRR6958303 is paired end SRR6958303 is conventional basespace SRR6958303 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958303_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.24375 25.0 18.0 32.0 18.0 33.0 2 21.85375 18.0 18.0 27.0 18.0 31.0 3 27.5675 27.0 27.0 30.0 18.0 33.0 4 30.17025 31.0 29.0 33.0 27.0 33.0 5 31.635 33.0 32.0 33.0 30.0 33.0 6 36.2195 38.0 36.0 38.0 33.0 38.0 7 36.5525 38.0 37.0 38.0 34.0 38.0 8 36.69925 38.0 37.0 38.0 34.0 38.0 9 36.997 38.0 38.0 38.0 35.0 38.0 10-14 37.241499999999995 38.0 38.0 38.0 36.2 38.0 15-19 37.2315 38.0 38.0 38.0 36.6 38.0 20-24 37.237449999999995 38.0 38.0 38.0 36.6 38.0 25-29 37.29625 38.0 38.0 38.0 36.8 38.0 30-34 37.15795 38.0 38.0 38.0 36.0 38.0 35-39 37.17725 38.0 38.0 38.0 36.0 38.0 40-44 37.05765 38.0 38.0 38.0 36.0 38.0 45-49 37.048649999999995 38.0 38.0 38.0 35.6 38.0 50-54 36.935649999999995 38.0 38.0 38.0 35.4 38.0 55-59 36.5082 38.0 37.8 38.0 33.8 38.0 60-64 36.041399999999996 38.0 37.0 38.0 32.0 38.0 65-69 35.59654999999999 38.0 36.2 38.0 29.4 38.0 70-74 35.7316 38.0 36.4 38.0 30.6 38.0 75-79 36.2522 38.0 37.0 38.0 33.0 38.0 80-84 36.24185 38.0 37.0 38.0 33.2 38.0 85-89 36.0692 38.0 37.0 38.0 32.2 38.0 90-94 35.9416 38.0 37.0 38.0 31.8 38.0 95-99 35.63960000000001 38.0 36.4 38.0 30.6 38.0 100-104 35.25985 38.0 35.8 38.0 28.8 38.0 105-109 34.7134 38.0 34.8 38.0 26.4 38.0 110-114 34.1427 38.0 34.0 38.0 23.4 38.0 115-119 33.612199999999994 38.0 33.8 38.0 20.4 38.0 120-124 33.382 37.4 33.4 38.0 17.8 38.0 125-129 34.073 38.0 34.0 38.0 23.4 38.0 130-134 33.95765 38.0 34.0 38.0 23.2 38.0 135-139 33.595000000000006 38.0 34.0 38.0 21.8 38.0 140-144 33.171499999999995 38.0 33.6 38.0 18.6 38.0 145-149 31.610950000000003 36.0 32.2 38.0 11.4 38.0 150-151 26.51475 34.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 1.0 16 2.0 17 4.0 18 3.0 19 3.0 20 3.0 21 5.0 22 9.0 23 6.0 24 15.0 25 16.0 26 25.0 27 33.0 28 42.0 29 52.0 30 88.0 31 125.0 32 180.0 33 244.0 34 329.0 35 642.0 36 1136.0 37 1033.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.501577287066247 20.951629863301786 6.466876971608833 49.07991587802314 2 16.675 23.5 25.1 34.725 3 20.05 19.35 23.225 37.375 4 26.650000000000002 25.724999999999998 20.075000000000003 27.55 5 26.1 30.525000000000002 21.224999999999998 22.15 6 21.9 34.175 23.025000000000002 20.9 7 16.475 23.625 40.475 19.425 8 19.975 25.0 29.849999999999998 25.174999999999997 9 19.7 22.0 33.475 24.825 10-14 22.35 26.46 26.445 24.745 15-19 21.790000000000003 26.415 26.384999999999998 25.41 20-24 22.295 26.045 26.66 25.0 25-29 22.325 26.640000000000004 26.405 24.63 30-34 22.085 26.090000000000003 26.715 25.11 35-39 22.59 26.029999999999998 26.125 25.255 40-44 22.264999999999997 26.33 26.229999999999997 25.174999999999997 45-49 21.925 26.290000000000003 26.55 25.235000000000003 50-54 22.705000000000002 25.424999999999997 26.355 25.515 55-59 22.36 26.174999999999997 26.405 25.06 60-64 21.865000000000002 26.14 26.474999999999998 25.52 65-69 21.654999999999998 26.655 26.355 25.335 70-74 22.355 25.805 26.405 25.435000000000002 75-79 22.07 26.025 26.555 25.35 80-84 22.795 25.635 26.36 25.21 85-89 22.29 26.0 26.669999999999998 25.040000000000003 90-94 22.93 25.900000000000002 25.7 25.47 95-99 22.57 25.41 26.38 25.64 100-104 22.845 25.759999999999998 25.905 25.490000000000002 105-109 22.85 25.845000000000002 26.169999999999998 25.135 110-114 23.044999999999998 25.655 26.3 25.0 115-119 22.564999999999998 25.85 26.810000000000002 24.775 120-124 22.71 26.305 26.47 24.515 125-129 22.585 25.795 26.39 25.230000000000004 130-134 22.625 25.729999999999997 26.365 25.28 135-139 22.935 25.575 26.314999999999998 25.174999999999997 140-144 22.89 25.545 26.169999999999998 25.395 145-149 23.105 25.619999999999997 25.795 25.480000000000004 150-151 23.599999999999998 25.637500000000003 25.45 25.3125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 1.0 24 1.0 25 1.5 26 1.5 27 2.5 28 3.0 29 5.0 30 7.5 31 10.5 32 14.5 33 20.5 34 29.5 35 41.5 36 58.5 37 72.5 38 90.5 39 116.0 40 147.0 41 178.0 42 197.0 43 213.5 44 216.0 45 215.5 46 219.5 47 215.0 48 215.0 49 190.5 50 165.5 51 159.5 52 136.0 53 110.5 54 105.5 55 103.5 56 88.5 57 78.5 58 71.0 59 60.5 60 61.5 61 53.0 62 34.5 63 41.0 64 44.5 65 37.5 66 37.5 67 31.0 68 20.0 69 16.5 70 14.0 71 10.0 72 9.5 73 6.5 74 4.5 75 4.5 76 2.5 77 2.0 78 1.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24395161290323 98.45 2 0.7056451612903225 1.4000000000000001 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.55 0.0 0.0 0.0 0.0 124-125 1.7875 0.0 0.0 0.0 0.0 126-127 1.9625 0.0 0.0 0.0 0.0 128-129 2.125 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 2.7625 0.0 0.0 0.0 0.0 136-137 3.0625 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGCT 10 0.005853838 152.57895 1 >>END_MODULE SRR6958303 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958303_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84025 33.0 33.0 34.0 32.0 34.0 2 32.91825 34.0 33.0 34.0 32.0 34.0 3 32.89175 34.0 33.0 34.0 32.0 34.0 4 32.8655 34.0 33.0 34.0 32.0 34.0 5 32.78525 34.0 33.0 34.0 32.0 34.0 6 36.831 38.0 38.0 38.0 36.0 38.0 7 36.73975 38.0 38.0 38.0 35.0 38.0 8 36.49375 38.0 38.0 38.0 34.0 38.0 9 36.68725 38.0 38.0 38.0 34.0 38.0 10-14 36.7503 38.0 38.0 38.0 34.8 38.0 15-19 36.74550000000001 38.0 38.0 38.0 35.0 38.0 20-24 36.86415 38.0 38.0 38.0 35.8 38.0 25-29 36.8115 38.0 38.0 38.0 35.4 38.0 30-34 36.73125 38.0 38.0 38.0 35.2 38.0 35-39 36.53645 38.0 38.0 38.0 34.4 38.0 40-44 36.4918 38.0 38.0 38.0 34.0 38.0 45-49 36.551300000000005 38.0 38.0 38.0 34.4 38.0 50-54 36.537150000000004 38.0 38.0 38.0 34.4 38.0 55-59 36.50875 38.0 38.0 38.0 34.0 38.0 60-64 36.4328 38.0 38.0 38.0 34.0 38.0 65-69 36.3742 38.0 38.0 38.0 33.8 38.0 70-74 36.33975 38.0 38.0 38.0 34.0 38.0 75-79 36.1923 38.0 38.0 38.0 33.4 38.0 80-84 35.95475 38.0 37.2 38.0 32.6 38.0 85-89 35.920300000000005 38.0 37.2 38.0 32.6 38.0 90-94 35.89185 38.0 37.0 38.0 33.0 38.0 95-99 35.728950000000005 38.0 37.0 38.0 31.6 38.0 100-104 35.50935 38.0 36.6 38.0 31.0 38.0 105-109 35.079049999999995 38.0 36.0 38.0 28.2 38.0 110-114 34.7414 38.0 35.2 38.0 26.4 38.0 115-119 34.5296 38.0 35.0 38.0 25.4 38.0 120-124 34.11375 38.0 34.8 38.0 23.0 38.0 125-129 33.530950000000004 38.0 33.8 38.0 20.2 38.0 130-134 32.6201 37.8 33.0 38.0 14.6 38.0 135-139 31.175600000000003 35.8 29.0 38.0 14.0 38.0 140-144 30.873699999999996 35.8 29.4 38.0 13.2 38.0 145-149 30.8187 36.0 31.0 38.0 8.6 38.0 150-151 26.259625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 7.0 4 4.0 5 2.0 6 2.0 7 0.0 8 0.0 9 3.0 10 0.0 11 4.0 12 3.0 13 1.0 14 3.0 15 7.0 16 2.0 17 1.0 18 3.0 19 5.0 20 13.0 21 8.0 22 13.0 23 26.0 24 18.0 25 26.0 26 35.0 27 38.0 28 46.0 29 54.0 30 83.0 31 105.0 32 138.0 33 161.0 34 241.0 35 450.0 36 812.0 37 1680.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.275 18.7 14.075 31.95 2 29.075 23.9 27.700000000000003 19.325 3 23.200000000000003 26.424999999999997 27.925 22.45 4 24.95 31.7 21.875 21.475 5 26.8 32.0 20.9 20.3 6 23.65 35.125 20.599999999999998 20.625 7 21.85 20.4 35.375 22.375 8 24.224999999999998 23.775 24.224999999999998 27.775 9 23.799999999999997 23.025000000000002 27.425 25.75 10-14 25.17625881294065 26.226311315565777 24.06120306015301 24.536226811340565 15-19 25.145 25.900000000000002 25.16 23.794999999999998 20-24 25.259999999999998 26.69 24.795 23.255 25-29 25.226261313065653 26.3863193159658 24.89624481224061 23.491174558727938 30-34 25.605 26.525 24.45 23.419999999999998 35-39 25.185000000000002 26.22 25.130000000000003 23.465 40-44 25.124999999999996 26.305 25.295 23.275000000000002 45-49 25.369999999999997 25.855 25.52 23.255 50-54 25.81 25.905 25.355 22.93 55-59 25.72 25.979999999999997 24.785 23.515 60-64 25.89 26.085 25.045 22.98 65-69 25.295 25.900000000000002 25.46 23.345 70-74 25.490000000000002 25.665 25.430000000000003 23.415 75-79 25.874999999999996 25.275 25.679999999999996 23.169999999999998 80-84 25.06 25.97 25.540000000000003 23.43 85-89 25.485000000000003 25.645 25.705 23.165 90-94 25.264999999999997 25.840000000000003 26.13 22.765 95-99 25.21 26.005 25.695 23.09 100-104 25.035 26.515 25.665 22.785 105-109 26.314999999999998 26.314999999999998 24.765 22.605 110-114 25.119999999999997 26.625 25.374999999999996 22.88 115-119 25.575 26.224999999999998 25.22 22.98 120-124 25.39 26.179999999999996 25.580000000000002 22.85 125-129 25.474999999999998 26.314999999999998 25.174999999999997 23.035 130-134 25.766288314415718 26.516325816290813 25.12625631281564 22.591129556477824 135-139 25.358803820573083 25.908886332949944 26.128919337900687 22.603390508576286 140-144 26.128919337900687 25.73386007901185 25.77386607991199 22.363354503175476 145-149 26.029999999999998 26.6 25.19 22.18 150-151 25.324999999999996 26.2875 25.5375 22.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 1.0 26 0.0 27 0.5 28 3.5 29 7.5 30 8.0 31 6.5 32 10.0 33 17.0 34 30.5 35 42.5 36 42.5 37 57.0 38 92.5 39 111.5 40 120.5 41 148.0 42 170.5 43 186.5 44 204.0 45 221.5 46 225.0 47 214.0 48 200.5 49 192.5 50 172.5 51 157.5 52 145.0 53 121.0 54 106.0 55 91.5 56 84.0 57 79.0 58 81.5 59 78.0 60 64.5 61 59.5 62 56.5 63 54.0 64 50.5 65 45.5 66 43.5 67 39.5 68 33.0 69 27.0 70 25.5 71 18.0 72 15.0 73 13.5 74 6.5 75 4.5 76 4.0 77 2.0 78 0.5 79 0.5 80 0.0 81 1.0 82 1.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.015 140-144 0.015 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2936427850656 98.4 2 0.5802219979818365 1.15 3 0.07568113017154389 0.22499999999999998 4 0.025227043390514632 0.1 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.55 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.1 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 2.7125 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAAAC 10 0.006830828 145.0 7 >>END_MODULE Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 828007 spots for SRR6958303.sra Written 828007 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra Read 827995 spots for SRR6958303.sra Written 827995 spots for SRR6958303.sra SRR ids: ['SRR6958303.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hymtd1bg SRR6958303.sra spots: 16559912 blocks: [[1, 827995], [827996, 1655990], [1655991, 2483985], [2483986, 3311980], [3311981, 4139975], [4139976, 4967970], [4967971, 5795965], [5795966, 6623960], [6623961, 7451955], [7451956, 8279950], [8279951, 9107945], [9107946, 9935940], [9935941, 10763935], [10763936, 11591930], [11591931, 12419925], [12419926, 13247920], [13247921, 14075915], [14075916, 14903910], [14903911, 15731905], [15731906, 16559912]] SRR6958303 file size 5589910 SRR6958303 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958303 SRR6958303_1.fastq SRR6958303_2.fastq Input file: SRR6958303_1.fastq Paired file: SRR6958303_2.fastq trimmed: SRR6958303-trimmed-pair1.fastq, SRR6958303-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:17:56 2024 >> started Fri Dec 6 19:18:14 2024 >> done (18.338s) 16559912 read pairs processed; of these: 15420 ( 0.09%) short read pairs filtered out after trimming by size control 10374 ( 0.06%) empty read pairs filtered out after trimming by size control 16534118 (99.84%) read pairs available; of these: 6796030 (41.10%) trimmed read pairs available after processing 9738088 (58.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 3 0.00% 21 4 0.00% 22 6 0.00% 23 0 0.00% 24 3 0.00% 25 5 0.00% 26 4 0.00% 27 3 0.00% 28 1 0.00% 29 6 0.00% 30 8 0.00% 31 4 0.00% 32 9 0.00% 33 4 0.00% 34 8 0.00% 35 5 0.00% 36 10 0.00% 37 6 0.00% 38 9 0.00% 39 12 0.00% 40 11 0.00% 41 14 0.00% 42 15 0.00% 43 19 0.00% 44 12 0.00% 45 19 0.00% 46 15 0.00% 47 25 0.00% 48 29 0.00% 49 19 0.00% 50 27 0.00% 51 32 0.00% 52 38 0.00% 53 33 0.00% 54 44 0.00% 55 44 0.00% 56 53 0.00% 57 61 0.00% 58 72 0.00% 59 56 0.00% 60 82 0.00% 61 104 0.00% 62 112 0.00% 63 140 0.00% 64 138 0.00% 65 158 0.00% 66 166 0.00% 67 199 0.00% 68 211 0.00% 69 221 0.00% 70 249 0.00% 71 277 0.00% 72 378 0.00% 73 432 0.00% 74 450 0.00% 75 520 0.00% 76 558 0.00% 77 614 0.00% 78 705 0.00% 79 753 0.00% 80 890 0.01% 81 1100 0.01% 82 1196 0.01% 83 1400 0.01% 84 2240 0.01% 85 2502 0.02% 86 2779 0.02% 87 2783 0.02% 88 2915 0.02% 89 3060 0.02% 90 3150 0.02% 91 3592 0.02% 92 3795 0.02% 93 4182 0.03% 94 4508 0.03% 95 4764 0.03% 96 4996 0.03% 97 5379 0.03% 98 5494 0.03% 99 6011 0.04% 100 6572 0.04% 101 6894 0.04% 102 7487 0.05% 103 8112 0.05% 104 8634 0.05% 105 9355 0.06% 106 9832 0.06% 107 10146 0.06% 108 10847 0.07% 109 11387 0.07% 110 11936 0.07% 111 12617 0.08% 112 13703 0.08% 113 14669 0.09% 114 15649 0.09% 115 16627 0.10% 116 17718 0.11% 117 18037 0.11% 118 19162 0.12% 119 20140 0.12% 120 20879 0.13% 121 21843 0.13% 122 23451 0.14% 123 24707 0.15% 124 26378 0.16% 125 27875 0.17% 126 29457 0.18% 127 30937 0.19% 128 32355 0.20% 129 34084 0.21% 130 36040 0.22% 131 38335 0.23% 132 41044 0.25% 133 44406 0.27% 134 48112 0.29% 135 51665 0.31% 136 56129 0.34% 137 60705 0.37% 138 65293 0.39% 139 72372 0.44% 140 79533 0.48% 141 86981 0.53% 142 95150 0.58% 143 102916 0.62% 144 112812 0.68% 145 125393 0.76% 146 152284 0.92% 147 208010 1.26% 148 336812 2.04% 149 707728 4.28% 150 3678862 22.25% 151 9738088 58.90% 16534118 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=19 prefix-density=0.73 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=12.48 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=3.6 sequence=CCGCACTTGCACTTGCCGTCGTTCTCCGCCGCGGACTCCTGCACCTCGAAGTGGCTCTTCTCGGTGTCAACCATGACGATGCCGTAGCCGTTTCCCTTCTTCACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGCCGCAGCCGCTCGACATGGTGGCCTTAACTTGCTGGGGAGATCGAGTACACGAATCAGCTGTGTTTTGCCTGTGTGTG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=15 prefix-density=0.46 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=80.75 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG SRR6958303 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:19:17 Started mapping on | Dec 06 19:19:17 Finished on | Dec 06 19:21:36 Mapping speed, Million of reads per hour | 428.22 Number of input reads | 16534118 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15888919 Uniquely mapped reads % | 96.10% Average mapped length | 296.21 Number of splices: Total | 18675602 Number of splices: Annotated (sjdb) | 17569528 Number of splices: GT/AG | 18419492 Number of splices: GC/AG | 215795 Number of splices: AT/AC | 6634 Number of splices: Non-canonical | 33681 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 186030 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 11172 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.30% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 469082 469082 469082 N_multimapping 186030 186030 186030 N_noFeature 594764 15406956 723540 N_ambiguous 413098 2189 60386 UnstrandedReadsAssigned:14881057 PositiveStrandReadsAssigned:479774 NegativeStrandReadsAssigned:15104993 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958303 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958303-trimmed-pair1.fastq SRR6958303-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,534,118 reads, 15,102,763 reads pseudoaligned [quant] estimated average fragment length: 269.137 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR6958303.ke.tsv 35125 SRR6958303.se.tsv 88098 total ==> SRR6958303.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.282 0 0 PNS24247 1044 775.863 49.1831 6.43548 PNS24249 1928 1659.86 31.8141 1.9458 PNS24246 1044 775.863 49.1831 6.43548 PNS24248 1044 775.863 49.1831 6.43548 PNS24244 1471 1202.86 40.6364 3.42964 PNS24243 293 81.6631 0 0 KQK14069 1603 1334.86 5027.63 382.363 KQK14071 474 221.036 78.921 36.2477 ==> SRR6958303.se.tsv <== BRADI_1g14170v3 5684 BRADI_1g53295v3 852 BRADI_1g59795v3 102 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 215 BRADI_1g74790v3 53 BRADI_1g09890v3 0 BRADI_1g77505v3 194 BRADI_1g48960v3 0 SRR6958303 completed mapping pipeline successfully