Starting /dee2/code/volunteer_pipeline.sh SRR6958304 current disk space = 1549847576576 free memory = 1600701264 SRR6958304 SRAfilesize b1f69a12a76d38c8eeb14918ae7dcca2 SRR6958304.sra SRR6958304.sra file validated SRR6958304 is paired end SRR6958304 is conventional basespace SRR6958304 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958304_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.77875 18.0 18.0 31.0 2.0 32.0 2 29.04575 29.0 27.0 31.0 25.0 33.0 3 28.80375 30.0 27.0 33.0 18.0 33.0 4 32.2895 33.0 32.0 33.0 32.0 33.0 5 31.9285 33.0 33.0 33.0 31.0 34.0 6 36.03375 37.0 36.0 38.0 33.0 38.0 7 36.6405 38.0 37.0 38.0 34.0 38.0 8 37.1195 38.0 38.0 38.0 36.0 38.0 9 37.49825 38.0 38.0 38.0 37.0 38.0 10-14 37.45305 38.0 38.0 38.0 37.2 38.0 15-19 37.507349999999995 38.0 38.0 38.0 37.4 38.0 20-24 37.46325 38.0 38.0 38.0 37.4 38.0 25-29 37.1936 38.0 38.0 38.0 36.8 38.0 30-34 37.2515 38.0 38.0 38.0 36.8 38.0 35-39 37.558350000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.575599999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.438449999999996 38.0 38.0 38.0 37.4 38.0 50-54 37.36805 38.0 38.0 38.0 37.0 38.0 55-59 37.3703 38.0 38.0 38.0 37.0 38.0 60-64 37.41055 38.0 38.0 38.0 37.0 38.0 65-69 37.376099999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.38525 38.0 38.0 38.0 37.0 38.0 75-79 36.24225 38.0 36.8 38.0 30.8 38.0 80-84 37.12245 38.0 38.0 38.0 35.8 38.0 85-89 36.822449999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.581050000000005 38.0 38.0 38.0 34.4 38.0 95-99 36.16845 38.0 37.8 38.0 33.2 38.0 100-104 36.06054999999999 38.0 38.0 38.0 32.6 38.0 105-109 36.033249999999995 38.0 37.8 38.0 32.8 38.0 110-114 35.962 38.0 37.2 38.0 32.0 38.0 115-119 36.3562 38.0 38.0 38.0 33.8 38.0 120-124 36.566250000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.49185 38.0 38.0 38.0 33.8 38.0 130-134 36.27085 38.0 38.0 38.0 34.0 38.0 135-139 35.5752 38.0 36.2 38.0 30.8 38.0 140-144 35.429899999999996 38.0 36.0 38.0 31.0 38.0 145-149 33.554700000000004 38.0 33.0 38.0 22.4 38.0 150-151 29.68725 35.5 27.0 38.0 10.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.0 20 2.0 21 1.0 22 2.0 23 3.0 24 8.0 25 11.0 26 13.0 27 17.0 28 20.0 29 36.0 30 40.0 31 58.0 32 69.0 33 102.0 34 189.0 35 281.0 36 848.0 37 2294.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.53596614950635 10.719322990126939 12.101551480959097 36.643159379407614 2 25.35 13.825000000000001 33.074999999999996 27.750000000000004 3 23.7 18.224999999999998 25.775 32.300000000000004 4 27.150000000000002 25.900000000000002 21.775 25.174999999999997 5 24.375 28.9 24.3 22.425 6 23.3 31.95 23.625 21.125 7 17.875 21.525 40.9 19.7 8 20.275000000000002 22.35 30.025000000000002 27.35 9 19.525000000000002 21.475 32.6 26.400000000000002 10-14 23.335 26.275 25.56 24.83 15-19 23.5 25.61 26.205000000000002 24.685000000000002 20-24 22.93 26.085 26.115 24.87 25-29 22.8 25.34 25.979999999999997 25.88 30-34 23.494999999999997 25.47 25.955000000000002 25.080000000000002 35-39 23.36 25.365 25.775 25.5 40-44 22.855 24.87 26.88 25.395 45-49 23.335 24.5 26.13 26.035000000000004 50-54 23.200000000000003 25.215 26.345000000000002 25.240000000000002 55-59 22.85 24.995 26.634999999999998 25.52 60-64 23.044999999999998 24.925 26.11 25.919999999999998 65-69 23.65 25.755 25.509999999999998 25.085 70-74 23.51 24.815 25.755 25.919999999999998 75-79 23.48 25.064999999999998 25.805 25.650000000000002 80-84 23.080000000000002 25.165 25.965 25.790000000000003 85-89 23.575 25.064999999999998 25.874999999999996 25.485000000000003 90-94 23.615 24.615000000000002 25.795 25.974999999999998 95-99 23.255 24.81 25.840000000000003 26.095000000000002 100-104 22.8 25.4 25.840000000000003 25.96 105-109 23.13 25.405 25.869999999999997 25.595000000000002 110-114 23.97 25.405 25.28 25.345000000000002 115-119 23.375 25.335 25.7 25.590000000000003 120-124 24.11 25.045 25.52 25.324999999999996 125-129 24.265 24.515 25.290000000000003 25.929999999999996 130-134 23.755000000000003 25.105 25.319999999999997 25.82 135-139 23.830000000000002 25.0 25.629999999999995 25.540000000000003 140-144 23.400000000000002 24.995 26.174999999999997 25.430000000000003 145-149 23.59 25.965 24.865000000000002 25.580000000000002 150-151 24.9 24.8 24.2625 26.0375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 3.0 29 4.0 30 5.0 31 12.5 32 19.0 33 22.0 34 26.5 35 34.0 36 47.0 37 62.5 38 75.0 39 102.5 40 130.0 41 150.0 42 168.5 43 195.0 44 212.0 45 208.5 46 211.5 47 217.0 48 211.0 49 186.5 50 172.5 51 150.5 52 131.0 53 115.5 54 96.5 55 97.0 56 96.5 57 78.5 58 71.5 59 83.5 60 85.0 61 66.5 62 52.5 63 58.5 64 59.5 65 52.5 66 42.0 67 40.0 68 37.0 69 26.0 70 18.5 71 13.0 72 15.0 73 12.0 74 6.5 75 7.0 76 4.0 77 1.5 78 2.0 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14141414141415 98.15 2 0.7323232323232324 1.4500000000000002 3 0.10101010101010101 0.3 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.6499999999999999 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 2.15 0.0 0.0 0.0 0.0 124-125 2.475 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.1375 0.0 0.0 0.0 0.0 132-133 3.4125 0.0 0.0 0.0 0.0 134-135 3.75 0.0 0.0 0.0 0.0 136-137 4.2125 0.0 0.0 0.0 0.0 138-139 4.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958304 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958304_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0315 33.0 33.0 34.0 32.0 34.0 2 33.08725 34.0 33.0 34.0 32.0 34.0 3 33.2195 34.0 33.0 34.0 33.0 34.0 4 33.1535 34.0 33.0 34.0 33.0 34.0 5 33.2065 34.0 33.0 34.0 33.0 34.0 6 37.2665 38.0 38.0 38.0 37.0 38.0 7 37.168 38.0 38.0 38.0 37.0 38.0 8 37.2575 38.0 38.0 38.0 37.0 38.0 9 37.29325 38.0 38.0 38.0 37.0 38.0 10-14 37.074400000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.015649999999994 38.0 38.0 38.0 36.6 38.0 20-24 37.0166 38.0 38.0 38.0 36.6 38.0 25-29 37.1407 38.0 38.0 38.0 37.0 38.0 30-34 37.318799999999996 38.0 38.0 38.0 37.4 38.0 35-39 37.36370000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.3439 38.0 38.0 38.0 37.8 38.0 45-49 37.2497 38.0 38.0 38.0 37.0 38.0 50-54 36.930150000000005 38.0 38.0 38.0 36.4 38.0 55-59 37.01165 38.0 38.0 38.0 36.2 38.0 60-64 36.97345 38.0 38.0 38.0 36.0 38.0 65-69 36.9097 38.0 38.0 38.0 36.0 38.0 70-74 36.8759 38.0 38.0 38.0 36.0 38.0 75-79 36.597899999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.32645 38.0 38.0 38.0 33.6 38.0 85-89 36.11825 38.0 38.0 38.0 33.2 38.0 90-94 36.5869 38.0 38.0 38.0 34.6 38.0 95-99 36.72325 38.0 38.0 38.0 35.0 38.0 100-104 36.757000000000005 38.0 38.0 38.0 35.0 38.0 105-109 36.622299999999996 38.0 38.0 38.0 34.8 38.0 110-114 36.39615 38.0 38.0 38.0 34.0 38.0 115-119 33.91755 37.2 31.8 38.0 25.8 38.0 120-124 32.6517 36.8 28.4 38.0 20.6 38.0 125-129 34.817350000000005 38.0 35.2 38.0 27.0 38.0 130-134 33.6899 37.6 32.4 38.0 22.4 38.0 135-139 30.1116 33.6 24.4 38.0 16.6 38.0 140-144 34.6947 38.0 35.2 38.0 28.2 38.0 145-149 34.049699999999994 38.0 35.2 38.0 24.8 38.0 150-151 28.4345 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 3.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 0.0 15 2.0 16 2.0 17 6.0 18 2.0 19 2.0 20 2.0 21 12.0 22 11.0 23 7.0 24 7.0 25 20.0 26 23.0 27 25.0 28 30.0 29 29.0 30 54.0 31 61.0 32 78.0 33 134.0 34 170.0 35 358.0 36 1008.0 37 1940.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.574999999999996 20.150000000000002 11.475 29.799999999999997 2 29.025000000000002 23.400000000000002 27.950000000000003 19.625 3 23.35 25.374999999999996 28.449999999999996 22.825 4 25.6 32.125 20.200000000000003 22.075 5 26.424999999999997 32.6 19.85 21.125 6 22.325 36.125 21.15 20.4 7 21.525 19.55 36.175000000000004 22.75 8 25.224999999999998 23.35 22.625 28.799999999999997 9 22.95 23.65 26.625 26.775 10-14 25.979999999999997 25.635 23.27 25.115 15-19 25.759999999999998 25.665 24.19 24.385 20-24 24.905 26.11 23.925 25.06 25-29 25.814999999999998 25.629999999999995 24.060000000000002 24.495 30-34 25.085 26.715 23.765 24.435000000000002 35-39 25.755 25.624999999999996 24.37 24.25 40-44 25.82 25.71 23.915 24.555 45-49 25.929999999999996 26.255 24.145 23.669999999999998 50-54 25.85 25.990000000000002 24.15 24.01 55-59 25.740000000000002 25.89 24.04 24.33 60-64 25.19 25.75 24.615000000000002 24.445 65-69 25.369999999999997 26.119999999999997 24.07 24.44 70-74 26.165 25.355 24.55 23.93 75-79 25.455 25.319999999999997 24.985 24.240000000000002 80-84 25.83 25.590000000000003 24.905 23.674999999999997 85-89 25.480000000000004 25.64 24.635 24.245 90-94 25.005 25.674999999999997 25.095 24.224999999999998 95-99 25.735000000000003 25.69 24.795 23.78 100-104 26.11 25.685000000000002 24.67 23.535 105-109 25.615 25.855 24.865000000000002 23.665 110-114 25.88 26.055 24.990000000000002 23.075000000000003 115-119 25.790000000000003 25.790000000000003 24.765 23.655 120-124 25.900000000000002 26.27 24.145 23.685000000000002 125-129 26.040000000000003 26.05 24.575 23.335 130-134 26.200000000000003 25.94 24.715 23.145 135-139 26.490000000000002 25.5 24.65 23.36 140-144 26.724999999999998 25.305 25.009999999999998 22.96 145-149 26.445 27.084999999999997 24.135 22.335 150-151 27.05 26.8125 23.4625 22.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 1.0 27 2.0 28 1.5 29 2.5 30 6.0 31 5.5 32 5.5 33 8.0 34 18.0 35 30.0 36 39.5 37 56.5 38 74.5 39 96.0 40 131.0 41 143.5 42 149.5 43 168.0 44 193.5 45 204.0 46 208.5 47 202.0 48 185.0 49 195.0 50 177.0 51 145.5 52 129.0 53 120.0 54 110.0 55 106.5 56 99.0 57 90.0 58 87.5 59 85.0 60 87.0 61 74.5 62 71.0 63 72.5 64 61.5 65 59.5 66 53.0 67 46.5 68 44.5 69 37.0 70 29.0 71 23.0 72 19.5 73 15.5 74 9.5 75 5.5 76 4.5 77 2.0 78 2.5 79 2.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62874555611985 97.1 2 1.218892839004571 2.4 3 0.12696800406297612 0.375 4 0.0 0.0 5 0.025393600812595223 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.6499999999999999 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.725 0.0 0.0 0.0 0.0 122-123 2.0875000000000004 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.6375 0.0 0.0 0.0 0.0 128-129 2.7625 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.4000000000000004 0.0 0.0 0.0 0.0 136-137 3.8125 0.0 0.0 0.0 0.0 138-139 4.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTCA 10 0.006830828 145.0 4 TCTTATA 10 0.006830828 145.0 7 >>END_MODULE Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146758 spots for SRR6958304.sra Written 1146758 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra Read 1146750 spots for SRR6958304.sra Written 1146750 spots for SRR6958304.sra SRR ids: ['SRR6958304.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tj5oggsv SRR6958304.sra spots: 22935008 blocks: [[1, 1146750], [1146751, 2293500], [2293501, 3440250], [3440251, 4587000], [4587001, 5733750], [5733751, 6880500], [6880501, 8027250], [8027251, 9174000], [9174001, 10320750], [10320751, 11467500], [11467501, 12614250], [12614251, 13761000], [13761001, 14907750], [14907751, 16054500], [16054501, 17201250], [17201251, 18348000], [18348001, 19494750], [19494751, 20641500], [20641501, 21788250], [21788251, 22935008]] SRR6958304 file size 7750221 SRR6958304 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958304 SRR6958304_1.fastq SRR6958304_2.fastq Input file: SRR6958304_1.fastq Paired file: SRR6958304_2.fastq trimmed: SRR6958304-trimmed-pair1.fastq, SRR6958304-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:20:56 2024 >> started Fri Dec 6 19:21:34 2024 >> done (38.019s) 22935008 read pairs processed; of these: 15697 ( 0.07%) short read pairs filtered out after trimming by size control 12226 ( 0.05%) empty read pairs filtered out after trimming by size control 22907085 (99.88%) read pairs available; of these: 7854583 (34.29%) trimmed read pairs available after processing 15052502 (65.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 3 0.00% 21 2 0.00% 22 7 0.00% 23 11 0.00% 24 13 0.00% 25 8 0.00% 26 9 0.00% 27 13 0.00% 28 9 0.00% 29 10 0.00% 30 8 0.00% 31 8 0.00% 32 19 0.00% 33 11 0.00% 34 6 0.00% 35 7 0.00% 36 14 0.00% 37 14 0.00% 38 13 0.00% 39 16 0.00% 40 17 0.00% 41 19 0.00% 42 23 0.00% 43 20 0.00% 44 22 0.00% 45 31 0.00% 46 24 0.00% 47 18 0.00% 48 32 0.00% 49 34 0.00% 50 33 0.00% 51 49 0.00% 52 57 0.00% 53 64 0.00% 54 57 0.00% 55 67 0.00% 56 75 0.00% 57 78 0.00% 58 80 0.00% 59 108 0.00% 60 114 0.00% 61 146 0.00% 62 130 0.00% 63 182 0.00% 64 204 0.00% 65 241 0.00% 66 252 0.00% 67 239 0.00% 68 284 0.00% 69 337 0.00% 70 385 0.00% 71 472 0.00% 72 533 0.00% 73 626 0.00% 74 719 0.00% 75 780 0.00% 76 888 0.00% 77 978 0.00% 78 996 0.00% 79 1230 0.01% 80 1378 0.01% 81 1649 0.01% 82 1945 0.01% 83 2143 0.01% 84 3043 0.01% 85 3678 0.02% 86 3766 0.02% 87 4120 0.02% 88 4284 0.02% 89 4756 0.02% 90 5087 0.02% 91 5259 0.02% 92 5937 0.03% 93 6533 0.03% 94 7124 0.03% 95 7520 0.03% 96 7990 0.03% 97 8580 0.04% 98 8872 0.04% 99 9379 0.04% 100 10295 0.04% 101 11194 0.05% 102 12105 0.05% 103 13366 0.06% 104 14135 0.06% 105 14918 0.07% 106 15817 0.07% 107 16335 0.07% 108 17196 0.08% 109 17632 0.08% 110 18763 0.08% 111 19872 0.09% 112 21566 0.09% 113 23063 0.10% 114 24412 0.11% 115 25946 0.11% 116 27154 0.12% 117 27310 0.12% 118 28373 0.12% 119 28912 0.13% 120 30348 0.13% 121 31434 0.14% 122 33285 0.15% 123 35417 0.15% 124 37643 0.16% 125 39775 0.17% 126 41211 0.18% 127 42261 0.18% 128 43824 0.19% 129 44495 0.19% 130 45714 0.20% 131 47683 0.21% 132 50490 0.22% 133 53821 0.23% 134 56485 0.25% 135 60133 0.26% 136 62758 0.27% 137 64740 0.28% 138 67528 0.29% 139 71649 0.31% 140 75169 0.33% 141 81545 0.36% 142 88505 0.39% 143 98700 0.43% 144 112438 0.49% 145 130423 0.57% 146 156435 0.68% 147 203026 0.89% 148 297773 1.30% 149 598900 2.61% 150 4548714 19.86% 151 15052502 65.71% 22907085 reads passed initial QC criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=28 prefix-density=1.09 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=69.78 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=9.6 sequence=ATTTCTTCAAAACAAACTACTTGTCGAGGCTGGAGTCACGTGGAGGCTTCGCTGTCGAGGCGAATCCTTTTGGTGCCAACCTCGTCACTAGCCGGCACCCTATTCTCCTTCGCTTCCACCGAGCACCTCTTGTAAGGTTTGAAGCCTGTCCGGTGGGATTTCATATTCAGGTGTGACAATTCAATGGGAAGGGAAGCTATCGGACCGACCGATGTATCGAGTTCATGATCAATAATCGAGGCGCACTC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=15 prefix-density=0.72 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=63.45 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.2 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGC SRR6958304 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:22:25 Started mapping on | Dec 06 19:22:25 Finished on | Dec 06 19:24:37 Mapping speed, Million of reads per hour | 624.74 Number of input reads | 22907085 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 22083847 Uniquely mapped reads % | 96.41% Average mapped length | 296.52 Number of splices: Total | 26164895 Number of splices: Annotated (sjdb) | 24699672 Number of splices: GT/AG | 25807731 Number of splices: GC/AG | 303302 Number of splices: AT/AC | 8748 Number of splices: Non-canonical | 45114 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 246871 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 15249 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.06% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 587755 587755 587755 N_multimapping 246871 246871 246871 N_noFeature 665666 21388842 824698 N_ambiguous 618457 2831 83538 UnstrandedReadsAssigned:20799724 PositiveStrandReadsAssigned:692174 NegativeStrandReadsAssigned:21175611 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958304 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958304-trimmed-pair1.fastq SRR6958304-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,907,085 reads, 21,149,093 reads pseudoaligned [quant] estimated average fragment length: 268.372 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52973 SRR6958304.ke.tsv 35125 SRR6958304.se.tsv 88098 total ==> SRR6958304.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.239 0 0 PNS24247 1044 776.628 64.8611 5.78873 PNS24249 1928 1660.63 30.8306 1.28683 PNS24246 1044 776.628 64.8611 5.78873 PNS24248 1044 776.628 64.8611 5.78873 PNS24244 1471 1203.63 44.586 2.56754 PNS24243 293 86.9985 0 0 KQK14069 1603 1335.63 6905.88 358.381 KQK14071 474 225.94 95.9254 29.4275 ==> SRR6958304.se.tsv <== BRADI_1g14170v3 7594 BRADI_1g53295v3 1168 BRADI_1g59795v3 101 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 319 BRADI_1g74790v3 85 BRADI_1g09890v3 0 BRADI_1g77505v3 306 BRADI_1g48960v3 0 SRR6958304 completed mapping pipeline successfully