Starting /dee2/code/volunteer_pipeline.sh SRR6958305 current disk space = 1549850210304 free memory = 1597481680 SRR6958305 SRAfilesize 1440473b5b26f3939612e4809a197894 SRR6958305.sra SRR6958305.sra file validated SRR6958305 is paired end SRR6958305 is conventional basespace SRR6958305 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958305_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.15475 25.0 18.0 32.0 18.0 33.0 2 22.14625 18.0 18.0 27.0 18.0 31.0 3 27.8115 29.0 27.0 31.0 18.0 33.0 4 30.15725 31.0 29.0 33.0 27.0 33.0 5 31.5835 33.0 32.0 33.0 30.0 33.0 6 36.07675 37.0 36.0 38.0 33.0 38.0 7 36.765 38.0 37.0 38.0 34.0 38.0 8 37.01725 38.0 38.0 38.0 35.0 38.0 9 37.096 38.0 38.0 38.0 36.0 38.0 10-14 37.293099999999995 38.0 38.0 38.0 36.8 38.0 15-19 37.25475 38.0 38.0 38.0 36.6 38.0 20-24 37.25035 38.0 38.0 38.0 36.6 38.0 25-29 37.287200000000006 38.0 38.0 38.0 36.8 38.0 30-34 37.174200000000006 38.0 38.0 38.0 36.2 38.0 35-39 37.17395 38.0 38.0 38.0 36.4 38.0 40-44 37.08785 38.0 38.0 38.0 36.0 38.0 45-49 37.16215 38.0 38.0 38.0 36.4 38.0 50-54 36.9678 38.0 38.0 38.0 35.4 38.0 55-59 36.516000000000005 38.0 37.8 38.0 34.0 38.0 60-64 36.1178 38.0 37.0 38.0 32.4 38.0 65-69 35.747499999999995 38.0 36.4 38.0 30.2 38.0 70-74 35.798899999999996 38.0 36.4 38.0 30.6 38.0 75-79 36.39475 38.0 37.0 38.0 34.0 38.0 80-84 36.307100000000005 38.0 37.0 38.0 33.4 38.0 85-89 36.13015 38.0 37.0 38.0 33.0 38.0 90-94 35.970549999999996 38.0 37.0 38.0 31.4 38.0 95-99 35.730399999999996 38.0 36.6 38.0 30.8 38.0 100-104 35.32475 38.0 36.0 38.0 29.2 38.0 105-109 35.000750000000004 38.0 35.2 38.0 28.0 38.0 110-114 34.23584999999999 38.0 34.0 38.0 24.0 38.0 115-119 33.755849999999995 38.0 34.0 38.0 22.2 38.0 120-124 33.63835 38.0 33.8 38.0 21.8 38.0 125-129 34.22765 38.0 34.2 38.0 24.0 38.0 130-134 34.18515 38.0 34.2 38.0 23.6 38.0 135-139 33.89155 38.0 34.0 38.0 23.2 38.0 140-144 33.32905 38.0 33.4 38.0 21.0 38.0 145-149 32.2528 37.0 32.8 38.0 13.2 38.0 150-151 26.994125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 2.0 12 0.0 13 1.0 14 1.0 15 0.0 16 2.0 17 0.0 18 4.0 19 3.0 20 2.0 21 8.0 22 8.0 23 7.0 24 6.0 25 25.0 26 11.0 27 38.0 28 41.0 29 65.0 30 79.0 31 108.0 32 159.0 33 208.0 34 345.0 35 592.0 36 1192.0 37 1092.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.472818880933442 19.199151418721826 5.780959957570936 47.5470697427738 2 16.625 21.425 26.775 35.175 3 19.05 19.125 23.225 38.6 4 25.900000000000002 25.45 21.075 27.575 5 24.668501376032022 28.49637227920941 23.967975981986488 22.86715036277208 6 21.8 32.35 24.575 21.275 7 16.1 23.225 40.225 20.45 8 18.8 22.925 28.825 29.45 9 18.95 22.025 32.85 26.174999999999997 10-14 22.415 26.889999999999997 26.16 24.535 15-19 22.15 26.314999999999998 26.584999999999997 24.95 20-24 22.33 26.155 26.05 25.465 25-29 22.035 26.46 26.165 25.34 30-34 22.105 24.95 27.12 25.825 35-39 22.435 25.490000000000002 26.99 25.085 40-44 22.09 25.71 27.41 24.79 45-49 22.040000000000003 26.040000000000003 26.205000000000002 25.715 50-54 22.62 25.985000000000003 26.534999999999997 24.86 55-59 22.02 26.040000000000003 26.68 25.259999999999998 60-64 22.075 25.900000000000002 26.405 25.619999999999997 65-69 22.134999999999998 25.71 26.590000000000003 25.564999999999998 70-74 22.415 24.98 26.939999999999998 25.665 75-79 22.759999999999998 25.624999999999996 26.295 25.319999999999997 80-84 22.805 25.595000000000002 26.810000000000002 24.79 85-89 22.415 25.765 26.395000000000003 25.424999999999997 90-94 22.515 25.380000000000003 26.700000000000003 25.405 95-99 22.555 25.715 26.13 25.6 100-104 22.68 25.72 26.415 25.185000000000002 105-109 22.63 25.095 26.400000000000002 25.874999999999996 110-114 22.605 25.180000000000003 26.625 25.590000000000003 115-119 23.26 25.21 26.075 25.455 120-124 22.675 25.365 26.290000000000003 25.669999999999998 125-129 22.865 25.735000000000003 26.375 25.025 130-134 23.119999999999997 25.415 26.41 25.055 135-139 23.244999999999997 25.845000000000002 25.715 25.195 140-144 23.080000000000002 25.424999999999997 26.305 25.19 145-149 23.54 25.674999999999997 25.580000000000002 25.205 150-151 23.2625 26.3 24.762500000000003 25.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.5 28 3.0 29 6.0 30 5.0 31 8.5 32 16.5 33 21.5 34 26.5 35 38.5 36 56.0 37 75.5 38 88.5 39 101.0 40 141.5 41 177.0 42 193.5 43 223.0 44 231.0 45 223.5 46 234.5 47 216.5 48 194.0 49 190.0 50 174.5 51 153.5 52 148.0 53 128.0 54 98.5 55 90.5 56 79.5 57 67.0 58 67.5 59 66.0 60 56.5 61 54.5 62 51.5 63 46.0 64 39.0 65 37.0 66 34.5 67 27.0 68 24.5 69 20.0 70 14.0 71 9.5 72 6.5 73 6.5 74 7.0 75 6.0 76 4.0 77 2.5 78 1.0 79 0.5 80 0.5 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.7250000000000005 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.6124999999999998 0.0 0.0 0.0 0.0 120-121 1.8375 0.0 0.0 0.0 0.0 122-123 2.0999999999999996 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.2750000000000004 0.0 0.0 0.0 0.0 130-131 3.7 0.0 0.0 0.0 0.0 132-133 4.1125 0.0 0.0 0.0 0.0 134-135 4.4375 0.0 0.0 0.0 0.0 136-137 4.675 0.0 0.0 0.0 0.0 138-139 5.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAGGC 10 0.006836113 144.9625 145 >>END_MODULE SRR6958305 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958305_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86275 33.0 33.0 34.0 32.0 34.0 2 32.898 34.0 33.0 34.0 32.0 34.0 3 32.86025 34.0 33.0 34.0 32.0 34.0 4 32.86775 34.0 33.0 34.0 32.0 34.0 5 32.813 34.0 33.0 34.0 32.0 34.0 6 36.85225 38.0 38.0 38.0 36.0 38.0 7 36.85775 38.0 38.0 38.0 35.0 38.0 8 36.61775 38.0 38.0 38.0 35.0 38.0 9 36.6245 38.0 38.0 38.0 35.0 38.0 10-14 36.738350000000004 38.0 38.0 38.0 35.0 38.0 15-19 36.90165 38.0 38.0 38.0 35.8 38.0 20-24 36.9139 38.0 38.0 38.0 35.8 38.0 25-29 36.92045 38.0 38.0 38.0 36.0 38.0 30-34 36.84515 38.0 38.0 38.0 35.8 38.0 35-39 36.622749999999996 38.0 38.0 38.0 34.8 38.0 40-44 36.622350000000004 38.0 38.0 38.0 34.8 38.0 45-49 36.6086 38.0 38.0 38.0 35.0 38.0 50-54 36.616699999999994 38.0 38.0 38.0 34.6 38.0 55-59 36.53075 38.0 38.0 38.0 34.2 38.0 60-64 36.55985 38.0 38.0 38.0 34.4 38.0 65-69 36.43825 38.0 38.0 38.0 34.0 38.0 70-74 36.37115000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.206900000000005 38.0 37.8 38.0 33.4 38.0 80-84 36.0413 38.0 37.6 38.0 32.6 38.0 85-89 36.04285 38.0 37.4 38.0 33.2 38.0 90-94 35.9918 38.0 37.0 38.0 33.0 38.0 95-99 35.88895 38.0 37.0 38.0 32.2 38.0 100-104 35.7435 38.0 37.0 38.0 31.4 38.0 105-109 35.12405 38.0 36.0 38.0 28.2 38.0 110-114 34.7558 38.0 35.2 38.0 26.6 38.0 115-119 34.4923 38.0 35.0 38.0 25.0 38.0 120-124 34.268600000000006 38.0 35.0 38.0 24.2 38.0 125-129 33.736650000000004 38.0 34.0 38.0 21.8 38.0 130-134 32.87525 37.8 33.2 38.0 14.8 38.0 135-139 31.34035 36.2 28.8 38.0 14.0 38.0 140-144 31.11575 36.0 30.6 38.0 13.8 38.0 145-149 31.07145 36.0 31.0 38.0 8.6 38.0 150-151 26.506 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 4.0 5 2.0 6 3.0 7 1.0 8 0.0 9 0.0 10 3.0 11 0.0 12 1.0 13 2.0 14 0.0 15 2.0 16 6.0 17 5.0 18 4.0 19 10.0 20 10.0 21 8.0 22 7.0 23 19.0 24 19.0 25 30.0 26 30.0 27 43.0 28 33.0 29 59.0 30 80.0 31 90.0 32 117.0 33 154.0 34 249.0 35 455.0 36 920.0 37 1623.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.574999999999996 19.275000000000002 12.85 30.3 2 31.175000000000004 24.224999999999998 26.924999999999997 17.675 3 22.875 26.35 27.575 23.200000000000003 4 25.224999999999998 32.9 21.2 20.674999999999997 5 26.775 33.300000000000004 20.599999999999998 19.325 6 25.30632658164541 34.98374593648413 20.280070017504375 19.42985746436609 7 22.775000000000002 19.775000000000002 36.475 20.974999999999998 8 24.575 24.525 22.85 28.050000000000004 9 23.674999999999997 23.7 27.825 24.8 10-14 25.597559755975595 26.46264626462646 24.122412241224122 23.817381738173818 15-19 25.555 26.455000000000002 24.654999999999998 23.335 20-24 25.545 26.045 24.555 23.855 25-29 24.61246124612461 25.90759075907591 25.192519251925194 24.287428742874287 30-34 25.36 26.465 24.895 23.28 35-39 25.39 26.205000000000002 25.255 23.150000000000002 40-44 25.085 25.685000000000002 25.040000000000003 24.19 45-49 26.009999999999998 25.729999999999997 24.91 23.35 50-54 25.180000000000003 26.055 25.724999999999998 23.04 55-59 26.07 25.924999999999997 24.91 23.095 60-64 25.485000000000003 26.055 25.290000000000003 23.169999999999998 65-69 25.44 26.900000000000002 24.375 23.285 70-74 25.619999999999997 25.71 25.46 23.21 75-79 25.405 26.334999999999997 25.045 23.215 80-84 25.245 25.955000000000002 25.605 23.195 85-89 25.53 25.945 25.03 23.494999999999997 90-94 25.074999999999996 26.575 25.525 22.825 95-99 25.895000000000003 25.94 25.295 22.869999999999997 100-104 25.1 25.835 26.06 23.005 105-109 25.1 26.595000000000002 25.395 22.91 110-114 25.435000000000002 26.064999999999998 25.665 22.835 115-119 25.555 25.8 25.435000000000002 23.21 120-124 25.47 26.375 25.855 22.3 125-129 26.005 26.005 25.155 22.835 130-134 26.06021204240848 26.485297059411884 24.789957991598317 22.664532906581318 135-139 26.20441242683476 26.91480314172795 24.753614487968385 22.127169943468907 140-144 26.643321660830416 26.273136568284144 25.147573786893446 21.935967983991997 145-149 26.55 26.740000000000002 24.905 21.805 150-151 27.35 27.0625 23.849999999999998 21.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.5 28 3.5 29 6.0 30 7.5 31 10.0 32 11.0 33 12.0 34 20.5 35 30.0 36 42.5 37 58.5 38 81.0 39 119.0 40 135.5 41 142.5 42 174.5 43 199.5 44 212.0 45 204.5 46 206.5 47 209.5 48 198.0 49 201.0 50 184.0 51 150.5 52 146.5 53 136.0 54 108.0 55 105.5 56 92.0 57 84.5 58 78.5 59 66.5 60 64.5 61 57.0 62 54.5 63 46.5 64 50.5 65 48.0 66 37.5 67 40.0 68 36.5 69 30.5 70 23.5 71 20.5 72 17.0 73 9.5 74 7.5 75 7.0 76 3.5 77 1.5 78 1.0 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.02 135-139 0.055 140-144 0.05 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.2625000000000002 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 2.0375 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.8375 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.55 0.0 0.0 0.0 0.0 132-133 3.9625000000000004 0.0 0.0 0.0 0.0 134-135 4.3125 0.0 0.0 0.0 0.0 136-137 4.5625 0.0 0.0 0.0 0.0 138-139 5.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCAAA 10 0.006830828 145.0 145 AAGATGC 10 0.006830828 145.0 5 GATCCCC 10 0.006830828 145.0 9 AGATGCA 10 0.006830828 145.0 6 AGATCCC 10 0.006830828 145.0 8 >>END_MODULE Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854066 spots for SRR6958305.sra Written 854066 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra Read 854059 spots for SRR6958305.sra Written 854059 spots for SRR6958305.sra SRR ids: ['SRR6958305.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bcllfcu2 SRR6958305.sra spots: 17081187 blocks: [[1, 854059], [854060, 1708118], [1708119, 2562177], [2562178, 3416236], [3416237, 4270295], [4270296, 5124354], [5124355, 5978413], [5978414, 6832472], [6832473, 7686531], [7686532, 8540590], [8540591, 9394649], [9394650, 10248708], [10248709, 11102767], [11102768, 11956826], [11956827, 12810885], [12810886, 13664944], [13664945, 14519003], [14519004, 15373062], [15373063, 16227121], [16227122, 17081187]] SRR6958305 file size 5766553 SRR6958305 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958305 SRR6958305_1.fastq SRR6958305_2.fastq Input file: SRR6958305_1.fastq Paired file: SRR6958305_2.fastq trimmed: SRR6958305-trimmed-pair1.fastq, SRR6958305-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:22:15 2024 >> started Fri Dec 6 19:22:35 2024 >> done (20.035s) 17081187 read pairs processed; of these: 12002 ( 0.07%) short read pairs filtered out after trimming by size control 7913 ( 0.05%) empty read pairs filtered out after trimming by size control 17061272 (99.88%) read pairs available; of these: 7085062 (41.53%) trimmed read pairs available after processing 9976210 (58.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 1 0.00% 23 6 0.00% 24 3 0.00% 25 4 0.00% 26 5 0.00% 27 3 0.00% 28 8 0.00% 29 7 0.00% 30 1 0.00% 31 6 0.00% 32 4 0.00% 33 5 0.00% 34 6 0.00% 35 10 0.00% 36 10 0.00% 37 4 0.00% 38 13 0.00% 39 11 0.00% 40 13 0.00% 41 20 0.00% 42 22 0.00% 43 19 0.00% 44 14 0.00% 45 10 0.00% 46 19 0.00% 47 18 0.00% 48 18 0.00% 49 23 0.00% 50 20 0.00% 51 40 0.00% 52 39 0.00% 53 46 0.00% 54 40 0.00% 55 53 0.00% 56 58 0.00% 57 58 0.00% 58 73 0.00% 59 74 0.00% 60 86 0.00% 61 112 0.00% 62 124 0.00% 63 129 0.00% 64 141 0.00% 65 158 0.00% 66 153 0.00% 67 196 0.00% 68 210 0.00% 69 227 0.00% 70 280 0.00% 71 344 0.00% 72 408 0.00% 73 443 0.00% 74 493 0.00% 75 515 0.00% 76 611 0.00% 77 660 0.00% 78 780 0.00% 79 794 0.00% 80 1023 0.01% 81 1117 0.01% 82 1308 0.01% 83 1485 0.01% 84 2261 0.01% 85 2628 0.02% 86 2792 0.02% 87 3002 0.02% 88 3231 0.02% 89 3193 0.02% 90 3547 0.02% 91 3771 0.02% 92 4216 0.02% 93 4538 0.03% 94 4992 0.03% 95 5362 0.03% 96 5738 0.03% 97 6235 0.04% 98 6512 0.04% 99 7030 0.04% 100 7469 0.04% 101 7960 0.05% 102 8736 0.05% 103 9389 0.06% 104 10156 0.06% 105 10662 0.06% 106 11607 0.07% 107 12111 0.07% 108 12785 0.07% 109 13449 0.08% 110 14240 0.08% 111 14831 0.09% 112 16236 0.10% 113 17047 0.10% 114 17997 0.11% 115 19565 0.11% 116 20300 0.12% 117 21690 0.13% 118 22550 0.13% 119 23342 0.14% 120 24512 0.14% 121 25783 0.15% 122 26869 0.16% 123 28660 0.17% 124 30115 0.18% 125 32360 0.19% 126 34034 0.20% 127 35779 0.21% 128 37574 0.22% 129 38994 0.23% 130 41174 0.24% 131 43301 0.25% 132 46331 0.27% 133 49416 0.29% 134 53304 0.31% 135 57656 0.34% 136 61738 0.36% 137 66563 0.39% 138 71976 0.42% 139 78680 0.46% 140 85933 0.50% 141 93641 0.55% 142 103248 0.61% 143 110541 0.65% 144 119588 0.70% 145 132687 0.78% 146 159359 0.93% 147 215680 1.26% 148 344557 2.02% 149 717926 4.21% 150 3743323 21.94% 151 9976210 58.47% 17061272 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=24 prefix-density=0.73 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=82.17 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=10.2 sequence=ATTTCTTCAAAACAAACTACTTGTCGAGGCTGGAGTCACGTGGAGGCTTCGCTGTCGAGGCGAATCCTTTTGGTGCCAACCTCGTCACTAGCCGGCACCCTATTCTCCTTCGCTTCCACCGAGCACCTCTTGTAAGGTTTGAAGCCTGTCCGGTGGGATTTCATATTCAGGTGTGACAATTCAATGGGAAGGGAAGCTATCGGACCGACCGATGTATCGAGTTCATGATCAATAATCGAGGCGCACTC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=15 prefix-density=0.47 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=57.38 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.4 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGC SRR6958305 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:23:27 Started mapping on | Dec 06 19:23:27 Finished on | Dec 06 19:25:30 Mapping speed, Million of reads per hour | 499.35 Number of input reads | 17061272 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16419386 Uniquely mapped reads % | 96.24% Average mapped length | 295.83 Number of splices: Total | 19269838 Number of splices: Annotated (sjdb) | 18135959 Number of splices: GT/AG | 19008436 Number of splices: GC/AG | 220886 Number of splices: AT/AC | 7199 Number of splices: Non-canonical | 33317 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 194949 % of reads mapped to multiple loci | 1.14% Number of reads mapped to too many loci | 14115 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.05% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 454862 454862 454862 N_multimapping 194949 194949 194949 N_noFeature 593405 15892564 733117 N_ambiguous 447397 2172 61258 UnstrandedReadsAssigned:15378584 PositiveStrandReadsAssigned:524650 NegativeStrandReadsAssigned:15625011 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958305 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958305-trimmed-pair1.fastq SRR6958305-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,061,272 reads, 15,617,699 reads pseudoaligned [quant] estimated average fragment length: 262.008 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,239 rounds 52973 SRR6958305.ke.tsv 35125 SRR6958305.se.tsv 88098 total ==> SRR6958305.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.472 0 0 PNS24247 1044 782.992 39.6365 4.97516 PNS24249 1928 1666.99 16.1927 0.954675 PNS24246 1044 782.992 39.6365 4.97516 PNS24248 1044 782.992 39.6365 4.97516 PNS24244 1471 1209.99 45.8977 3.72801 PNS24243 293 86.3622 0 0 KQK14069 1603 1341.99 5442.08 398.551 KQK14071 474 228.507 78.8501 33.9133 ==> SRR6958305.se.tsv <== BRADI_1g14170v3 6248 BRADI_1g53295v3 1365 BRADI_1g59795v3 77 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 234 BRADI_1g74790v3 78 BRADI_1g09890v3 0 BRADI_1g77505v3 215 BRADI_1g48960v3 0 SRR6958305 completed mapping pipeline successfully