Starting /dee2/code/volunteer_pipeline.sh SRR6958306 current disk space = 1549847576576 free memory = 1597640096 SRR6958306 SRAfilesize acedc1be6c99cb78846f6cdd99ce5b02 SRR6958306.sra SRR6958306.sra file validated SRR6958306 is paired end SRR6958306 is conventional basespace SRR6958306 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958306_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.21775 18.0 18.0 30.0 2.0 32.0 2 27.96875 29.0 27.0 31.0 18.0 33.0 3 29.53375 31.0 27.0 33.0 25.0 33.0 4 31.85225 33.0 32.0 33.0 30.0 33.0 5 32.701 33.0 33.0 33.0 32.0 34.0 6 36.65825 38.0 37.0 38.0 34.0 38.0 7 37.168 38.0 38.0 38.0 36.0 38.0 8 37.40575 38.0 38.0 38.0 37.0 38.0 9 37.4165 38.0 38.0 38.0 37.0 38.0 10-14 37.32299999999999 38.0 38.0 38.0 36.6 38.0 15-19 37.295100000000005 38.0 38.0 38.0 36.8 38.0 20-24 36.636100000000006 38.0 37.8 38.0 34.2 38.0 25-29 36.87434999999999 38.0 38.0 38.0 35.4 38.0 30-34 37.191649999999996 38.0 38.0 38.0 36.4 38.0 35-39 37.36015 38.0 38.0 38.0 37.0 38.0 40-44 37.30945 38.0 38.0 38.0 37.0 38.0 45-49 37.27185 38.0 38.0 38.0 36.8 38.0 50-54 37.0835 38.0 38.0 38.0 36.0 38.0 55-59 37.01995 38.0 38.0 38.0 35.8 38.0 60-64 37.116949999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.13325 38.0 38.0 38.0 36.0 38.0 70-74 37.1539 38.0 38.0 38.0 36.0 38.0 75-79 37.124900000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.046299999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.5884 38.0 38.0 38.0 34.2 38.0 90-94 36.0784 38.0 37.4 38.0 32.6 38.0 95-99 35.2024 38.0 36.2 38.0 27.0 38.0 100-104 35.069100000000006 38.0 36.0 38.0 26.6 38.0 105-109 35.06155 38.0 35.6 38.0 26.4 38.0 110-114 35.39575 38.0 36.0 38.0 28.8 38.0 115-119 35.76065 38.0 36.4 38.0 31.8 38.0 120-124 36.0212 38.0 37.0 38.0 33.0 38.0 125-129 36.0246 38.0 36.6 38.0 33.0 38.0 130-134 35.871449999999996 38.0 36.2 38.0 32.8 38.0 135-139 35.5459 38.0 36.0 38.0 31.2 38.0 140-144 34.6383 38.0 34.8 38.0 27.8 38.0 145-149 32.635450000000006 38.0 32.2 38.0 19.8 38.0 150-151 28.79475 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 0.0 19 2.0 20 3.0 21 4.0 22 4.0 23 0.0 24 9.0 25 16.0 26 18.0 27 24.0 28 36.0 29 46.0 30 47.0 31 84.0 32 108.0 33 137.0 34 205.0 35 388.0 36 900.0 37 1962.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.816326530612244 12.664243779703662 8.275090858261112 38.24433883142298 2 24.5 13.600000000000001 31.374999999999996 30.525000000000002 3 23.599999999999998 18.8 24.15 33.45 4 25.85 26.1 21.4 26.650000000000002 5 24.975 29.45 23.549999999999997 22.025 6 21.675 32.95 23.400000000000002 21.975 7 17.2 22.375 40.1 20.325 8 20.95 23.474999999999998 27.0 28.575 9 19.325 21.8 33.0 25.874999999999996 10-14 23.3 26.165 26.009999999999998 24.525 15-19 22.839567913582716 25.92018403680736 26.14022804560912 25.1000200040008 20-24 22.38 25.605 26.46 25.555 25-29 23.23 25.19 26.090000000000003 25.490000000000002 30-34 22.64 25.765 26.22 25.374999999999996 35-39 22.564999999999998 25.490000000000002 26.57 25.374999999999996 40-44 23.36 25.615 25.330000000000002 25.695 45-49 22.835 25.765 26.005 25.395 50-54 22.88 25.31 26.135 25.674999999999997 55-59 22.805 25.95 26.0 25.245 60-64 23.205000000000002 25.7 25.69 25.405 65-69 23.52 24.740000000000002 26.16 25.580000000000002 70-74 22.715 25.215 26.064999999999998 26.005 75-79 22.975 25.330000000000002 25.86 25.835 80-84 23.005 25.615 25.615 25.765 85-89 23.525 24.959999999999997 25.915 25.6 90-94 23.485 24.169999999999998 26.515 25.83 95-99 23.27 25.014999999999997 26.155 25.56 100-104 23.200000000000003 25.205 25.89 25.705 105-109 23.635 25.119999999999997 25.585 25.66 110-114 23.64 25.115 25.845000000000002 25.4 115-119 23.605 25.419999999999998 25.330000000000002 25.645 120-124 23.200000000000003 24.884999999999998 26.005 25.91 125-129 23.425 25.480000000000004 25.46 25.635 130-134 23.445 25.15 25.45 25.955000000000002 135-139 24.154999999999998 24.335 25.779999999999998 25.729999999999997 140-144 23.555 25.52 25.395 25.53 145-149 23.53 25.259999999999998 25.040000000000003 26.169999999999998 150-151 23.6625 24.825 26.125 25.387500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 1.5 28 2.5 29 3.5 30 6.5 31 12.0 32 16.0 33 18.5 34 31.0 35 37.5 36 46.0 37 70.5 38 84.0 39 101.0 40 130.0 41 147.0 42 163.0 43 181.5 44 201.5 45 219.0 46 219.5 47 212.0 48 196.0 49 194.0 50 186.5 51 156.5 52 133.5 53 124.0 54 116.0 55 99.5 56 87.0 57 85.0 58 81.5 59 79.0 60 78.0 61 63.5 62 52.5 63 45.0 64 42.5 65 48.0 66 46.0 67 38.0 68 30.5 69 26.0 70 20.5 71 15.5 72 12.5 73 13.5 74 11.5 75 6.0 76 3.5 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.02 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.6298815822625347 1.25 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 1.0750000000000002 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.2999999999999998 0.0 0.0 0.0 0.0 120-121 1.5125 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 2.0125 0.0 0.0 0.0 0.0 126-127 2.2375 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.7249999999999996 0.0 0.0 0.0 0.0 132-133 3.0125 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 4.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAGTG 10 0.006843168 144.91249 2 ACAAGAA 10 0.006843168 144.91249 2 >>END_MODULE SRR6958306 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958306_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76525 33.0 33.0 34.0 32.0 34.0 2 32.906 33.0 33.0 34.0 32.0 34.0 3 33.001 34.0 33.0 34.0 32.0 34.0 4 32.92175 34.0 33.0 34.0 32.0 34.0 5 32.96175 34.0 33.0 34.0 32.0 34.0 6 37.074 38.0 38.0 38.0 36.0 38.0 7 37.0475 38.0 38.0 38.0 36.0 38.0 8 36.80975 38.0 38.0 38.0 35.0 38.0 9 36.84325 38.0 38.0 38.0 36.0 38.0 10-14 36.61165 38.0 38.0 38.0 34.4 38.0 15-19 36.447449999999996 38.0 38.0 38.0 34.0 38.0 20-24 36.63645 38.0 38.0 38.0 35.2 38.0 25-29 36.6975 38.0 38.0 38.0 35.2 38.0 30-34 36.90065 38.0 38.0 38.0 36.0 38.0 35-39 36.99225 38.0 38.0 38.0 36.2 38.0 40-44 36.8891 38.0 38.0 38.0 36.0 38.0 45-49 36.81615 38.0 38.0 38.0 35.8 38.0 50-54 36.391 38.0 38.0 38.0 34.4 38.0 55-59 36.3804 38.0 38.0 38.0 34.0 38.0 60-64 36.59355 38.0 38.0 38.0 34.8 38.0 65-69 36.2442 38.0 38.0 38.0 33.8 38.0 70-74 36.15025 38.0 38.0 38.0 33.4 38.0 75-79 35.93515 38.0 37.8 38.0 32.2 38.0 80-84 35.754 38.0 37.4 38.0 31.2 38.0 85-89 35.54795 38.0 37.0 38.0 30.2 38.0 90-94 35.943799999999996 38.0 37.8 38.0 32.4 38.0 95-99 36.12985 38.0 38.0 38.0 33.4 38.0 100-104 36.064350000000005 38.0 38.0 38.0 33.2 38.0 105-109 35.999449999999996 38.0 37.8 38.0 33.4 38.0 110-114 35.7338 38.0 37.2 38.0 31.4 38.0 115-119 35.44395 38.0 36.4 38.0 30.6 38.0 120-124 33.9377 38.0 34.4 38.0 23.2 38.0 125-129 33.5591 38.0 33.0 38.0 19.8 38.0 130-134 27.95695 31.0 19.6 36.6 13.6 38.0 135-139 33.51065 37.8 32.8 38.0 22.6 38.0 140-144 33.847950000000004 38.0 33.0 38.0 23.8 38.0 145-149 33.06765 38.0 33.0 38.0 16.2 38.0 150-151 28.00975 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 6.0 4 6.0 5 2.0 6 3.0 7 1.0 8 3.0 9 1.0 10 0.0 11 1.0 12 3.0 13 1.0 14 0.0 15 2.0 16 0.0 17 2.0 18 3.0 19 6.0 20 7.0 21 8.0 22 11.0 23 20.0 24 17.0 25 15.0 26 33.0 27 43.0 28 46.0 29 56.0 30 62.0 31 80.0 32 126.0 33 151.0 34 216.0 35 392.0 36 846.0 37 1823.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.45 20.025000000000002 11.15 29.375 2 30.325000000000003 24.25 26.200000000000003 19.225 3 23.775 26.150000000000002 26.55 23.525 4 25.55 32.324999999999996 20.7 21.425 5 26.75 33.475 18.875 20.9 6 24.224999999999998 34.775 20.25 20.75 7 22.6 19.75 34.0 23.65 8 24.675 22.275 23.775 29.275000000000002 9 22.575 23.775 27.775 25.874999999999996 10-14 25.779999999999998 26.415 23.9 23.905 15-19 25.16 26.21 24.145 24.485 20-24 25.435000000000002 26.3 24.345 23.919999999999998 25-29 26.174999999999997 25.545 24.33 23.95 30-34 26.105 26.0 24.18 23.715 35-39 25.724999999999998 26.16 23.73 24.385 40-44 25.695 26.11 24.185000000000002 24.01 45-49 26.155 25.405 24.725 23.715 50-54 25.8 25.825 24.595 23.78 55-59 26.255 25.825 23.905 24.015 60-64 25.825 25.669999999999998 24.675 23.830000000000002 65-69 25.995 25.53 24.5 23.974999999999998 70-74 26.255 25.34 24.349999999999998 24.055 75-79 26.27 25.835 24.185000000000002 23.71 80-84 25.8 25.605 24.975 23.62 85-89 26.005 25.485000000000003 24.560000000000002 23.95 90-94 25.6 25.374999999999996 25.064999999999998 23.96 95-99 25.924999999999997 26.255 24.55 23.27 100-104 26.215 25.27 24.68 23.835 105-109 25.259999999999998 25.865 25.0 23.875 110-114 25.619999999999997 26.32 24.605 23.455000000000002 115-119 26.015 26.305 24.445 23.235 120-124 25.865 25.795 24.915000000000003 23.425 125-129 25.924999999999997 26.32 24.6 23.155 130-134 26.565 26.075 24.595 22.765 135-139 26.314999999999998 25.674999999999997 25.085 22.925 140-144 26.415 26.490000000000002 24.6 22.495 145-149 26.395000000000003 26.625 24.085 22.895 150-151 27.287499999999998 25.95 24.712500000000002 22.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.0 28 2.5 29 4.5 30 7.0 31 11.5 32 14.0 33 15.5 34 22.0 35 33.5 36 44.0 37 55.0 38 67.0 39 86.5 40 116.0 41 139.5 42 159.5 43 175.5 44 178.5 45 189.5 46 206.5 47 202.0 48 191.0 49 177.0 50 163.5 51 155.5 52 138.5 53 131.5 54 127.5 55 110.5 56 96.5 57 95.5 58 94.0 59 86.5 60 82.0 61 81.0 62 75.0 63 65.5 64 59.0 65 55.0 66 45.5 67 41.0 68 37.0 69 33.0 70 33.0 71 20.5 72 15.0 73 13.5 74 12.5 75 11.5 76 7.0 77 5.5 78 3.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24337957124843 98.375 2 0.6557377049180327 1.3 3 0.07566204287515763 0.22499999999999998 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 1.0750000000000002 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.3250000000000002 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 1.95 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.45 0.0 0.0 0.0 0.0 132-133 2.6875 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.3875 0.0 0.0 0.0 0.0 138-139 3.7750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAAGA 10 0.006830828 145.0 145 >>END_MODULE Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271630 spots for SRR6958306.sra Written 1271630 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra Read 1271622 spots for SRR6958306.sra Written 1271622 spots for SRR6958306.sra SRR ids: ['SRR6958306.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lff6p4ez SRR6958306.sra spots: 25432448 blocks: [[1, 1271622], [1271623, 2543244], [2543245, 3814866], [3814867, 5086488], [5086489, 6358110], [6358111, 7629732], [7629733, 8901354], [8901355, 10172976], [10172977, 11444598], [11444599, 12716220], [12716221, 13987842], [13987843, 15259464], [15259465, 16531086], [16531087, 17802708], [17802709, 19074330], [19074331, 20345952], [20345953, 21617574], [21617575, 22889196], [22889197, 24160818], [24160819, 25432448]] SRR6958306 file size 8596521 SRR6958306 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958306 SRR6958306_1.fastq SRR6958306_2.fastq Input file: SRR6958306_1.fastq Paired file: SRR6958306_2.fastq trimmed: SRR6958306-trimmed-pair1.fastq, SRR6958306-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:20:48 2024 >> started Fri Dec 6 19:21:20 2024 >> done (31.661s) 25432448 read pairs processed; of these: 36866 ( 0.14%) short read pairs filtered out after trimming by size control 33922 ( 0.13%) empty read pairs filtered out after trimming by size control 25361660 (99.72%) read pairs available; of these: 9385015 (37.00%) trimmed read pairs available after processing 15976645 (63.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 4 0.00% 21 5 0.00% 22 5 0.00% 23 1 0.00% 24 8 0.00% 25 2 0.00% 26 9 0.00% 27 10 0.00% 28 8 0.00% 29 10 0.00% 30 10 0.00% 31 8 0.00% 32 2 0.00% 33 4 0.00% 34 11 0.00% 35 8 0.00% 36 9 0.00% 37 11 0.00% 38 13 0.00% 39 12 0.00% 40 10 0.00% 41 27 0.00% 42 18 0.00% 43 17 0.00% 44 17 0.00% 45 23 0.00% 46 27 0.00% 47 25 0.00% 48 34 0.00% 49 39 0.00% 50 47 0.00% 51 47 0.00% 52 47 0.00% 53 46 0.00% 54 63 0.00% 55 66 0.00% 56 61 0.00% 57 80 0.00% 58 104 0.00% 59 114 0.00% 60 142 0.00% 61 176 0.00% 62 142 0.00% 63 173 0.00% 64 208 0.00% 65 234 0.00% 66 252 0.00% 67 268 0.00% 68 374 0.00% 69 381 0.00% 70 406 0.00% 71 525 0.00% 72 649 0.00% 73 704 0.00% 74 787 0.00% 75 844 0.00% 76 1018 0.00% 77 1070 0.00% 78 1232 0.00% 79 1307 0.01% 80 1620 0.01% 81 1788 0.01% 82 2117 0.01% 83 2422 0.01% 84 4149 0.02% 85 5197 0.02% 86 5409 0.02% 87 5420 0.02% 88 5730 0.02% 89 5617 0.02% 90 6059 0.02% 91 6478 0.03% 92 7062 0.03% 93 7448 0.03% 94 8147 0.03% 95 8467 0.03% 96 8934 0.04% 97 9336 0.04% 98 9719 0.04% 99 10291 0.04% 100 10949 0.04% 101 11643 0.05% 102 12560 0.05% 103 13581 0.05% 104 14571 0.06% 105 15378 0.06% 106 16386 0.06% 107 16691 0.07% 108 17313 0.07% 109 18025 0.07% 110 18971 0.07% 111 19964 0.08% 112 21388 0.08% 113 22693 0.09% 114 24564 0.10% 115 25681 0.10% 116 26765 0.11% 117 27617 0.11% 118 28408 0.11% 119 29249 0.12% 120 30462 0.12% 121 32099 0.13% 122 33483 0.13% 123 35906 0.14% 124 38454 0.15% 125 40233 0.16% 126 41853 0.17% 127 43056 0.17% 128 45027 0.18% 129 45965 0.18% 130 47549 0.19% 131 50131 0.20% 132 53611 0.21% 133 57221 0.23% 134 60452 0.24% 135 64340 0.25% 136 67847 0.27% 137 71887 0.28% 138 76074 0.30% 139 81096 0.32% 140 86888 0.34% 141 95718 0.38% 142 106984 0.42% 143 121733 0.48% 144 138514 0.55% 145 166762 0.66% 146 209348 0.83% 147 285638 1.13% 148 434380 1.71% 149 849862 3.35% 150 5346673 21.08% 151 15976645 63.00% 25361660 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=23 prefix-density=0.85 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=42.62 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=27 prefix-density=0.62 prefix-fanout=2.3 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=73.54 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGC SRR6958306 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:22:11 Started mapping on | Dec 06 19:22:11 Finished on | Dec 06 19:24:48 Mapping speed, Million of reads per hour | 581.54 Number of input reads | 25361660 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 24484470 Uniquely mapped reads % | 96.54% Average mapped length | 296.51 Number of splices: Total | 29049275 Number of splices: Annotated (sjdb) | 27381412 Number of splices: GT/AG | 28651882 Number of splices: GC/AG | 337780 Number of splices: AT/AC | 10728 Number of splices: Non-canonical | 48885 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287507 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 10185 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.04% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 612305 612305 612305 N_multimapping 287507 287507 287507 N_noFeature 788324 23717089 975294 N_ambiguous 672904 3412 94402 UnstrandedReadsAssigned:23023242 PositiveStrandReadsAssigned:763969 NegativeStrandReadsAssigned:23414774 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958306 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958306-trimmed-pair1.fastq SRR6958306-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,361,660 reads, 23,391,853 reads pseudoaligned [quant] estimated average fragment length: 272.195 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52973 SRR6958306.ke.tsv 35125 SRR6958306.se.tsv 88098 total ==> SRR6958306.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.393 0 0 PNS24247 1044 772.805 73.6491 6.10341 PNS24249 1928 1656.81 43.5184 1.68219 PNS24246 1044 772.805 73.6491 6.10341 PNS24248 1044 772.805 73.6491 6.10341 PNS24244 1471 1199.81 31.5344 1.68325 PNS24243 293 83.6266 0 0 KQK14069 1603 1331.81 7451.8 358.34 KQK14071 474 221.056 122.216 35.408 ==> SRR6958306.se.tsv <== BRADI_1g14170v3 8500 BRADI_1g53295v3 1261 BRADI_1g59795v3 116 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 488 BRADI_1g74790v3 140 BRADI_1g09890v3 1 BRADI_1g77505v3 269 BRADI_1g48960v3 0 SRR6958306 completed mapping pipeline successfully