Starting /dee2/code/volunteer_pipeline.sh SRR6958307 current disk space = 1549832876032 free memory = 1600270808 SRR6958307 SRAfilesize ec24e13e0feaf496f7c41d5fbfc76e4c SRR6958307.sra SRR6958307.sra file validated SRR6958307 is paired end SRR6958307 is conventional basespace SRR6958307 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958307_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.38325 32.0 30.0 33.0 18.0 33.0 2 31.6945 33.0 31.0 33.0 28.0 34.0 3 31.2945 33.0 31.0 33.0 28.0 34.0 4 31.0545 33.0 32.0 33.0 27.0 34.0 5 31.9815 33.0 32.0 33.0 30.0 34.0 6 36.52575 38.0 37.0 38.0 34.0 38.0 7 36.88825 38.0 38.0 38.0 35.0 38.0 8 37.1715 38.0 38.0 38.0 36.0 38.0 9 37.27825 38.0 38.0 38.0 36.0 38.0 10-14 37.266450000000006 38.0 38.0 38.0 36.8 38.0 15-19 37.3277 38.0 38.0 38.0 37.0 38.0 20-24 37.410250000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.335049999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.196299999999994 38.0 38.0 38.0 36.6 38.0 35-39 36.91074999999999 38.0 38.0 38.0 35.4 38.0 40-44 37.019149999999996 38.0 38.0 38.0 36.0 38.0 45-49 37.06565 38.0 38.0 38.0 35.8 38.0 50-54 36.94865 38.0 38.0 38.0 35.6 38.0 55-59 36.8383 38.0 38.0 38.0 35.0 38.0 60-64 36.879949999999994 38.0 38.0 38.0 35.4 38.0 65-69 36.9084 38.0 38.0 38.0 35.2 38.0 70-74 36.877449999999996 38.0 38.0 38.0 35.2 38.0 75-79 36.61065 38.0 38.0 38.0 34.4 38.0 80-84 36.2861 38.0 37.6 38.0 33.4 38.0 85-89 36.33485 38.0 37.6 38.0 33.6 38.0 90-94 36.39575 38.0 37.8 38.0 34.0 38.0 95-99 36.4014 38.0 37.8 38.0 33.8 38.0 100-104 36.103950000000005 38.0 37.0 38.0 32.8 38.0 105-109 35.69425 38.0 36.6 38.0 31.0 38.0 110-114 35.60935 38.0 36.0 38.0 30.6 38.0 115-119 35.600350000000006 38.0 36.2 38.0 30.6 38.0 120-124 35.40585 38.0 35.8 38.0 29.8 38.0 125-129 34.88175 38.0 35.0 38.0 27.6 38.0 130-134 34.6571 38.0 35.0 38.0 27.2 38.0 135-139 34.360800000000005 38.0 34.6 38.0 25.4 38.0 140-144 34.09095 38.0 34.6 38.0 24.2 38.0 145-149 32.6962 38.0 33.4 38.0 15.4 38.0 150-151 27.814875 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 3.0 17 0.0 18 0.0 19 6.0 20 4.0 21 3.0 22 7.0 23 6.0 24 10.0 25 16.0 26 14.0 27 30.0 28 41.0 29 45.0 30 69.0 31 76.0 32 95.0 33 141.0 34 215.0 35 353.0 36 926.0 37 1937.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.21049922799794 9.675759135357694 8.337622233659289 44.776119402985074 2 21.275 12.775 37.15 28.799999999999997 3 20.625 15.075 25.874999999999996 38.425 4 28.15 22.1 21.5 28.249999999999996 5 28.1 27.3 24.675 19.925 6 22.675 34.025 23.075000000000003 20.225 7 17.849999999999998 25.424999999999997 38.125 18.6 8 21.2 24.9 28.925 24.975 9 21.275 21.725 33.125 23.875 10-14 22.615 26.665 25.814999999999998 24.905 15-19 23.41 25.330000000000002 25.979999999999997 25.28 20-24 23.54 24.95 25.775 25.735000000000003 25-29 23.235 25.424999999999997 25.69 25.650000000000002 30-34 22.875 25.47 26.224999999999998 25.430000000000003 35-39 23.189999999999998 25.035 26.21 25.564999999999998 40-44 23.294999999999998 25.740000000000002 25.88 25.085 45-49 22.919999999999998 25.285000000000004 26.05 25.745 50-54 22.900000000000002 25.785000000000004 25.919999999999998 25.395 55-59 23.585 24.515 26.075 25.825 60-64 22.985 25.155 25.840000000000003 26.02 65-69 23.105 25.245 26.46 25.19 70-74 22.869999999999997 25.540000000000003 25.72 25.869999999999997 75-79 23.215 24.825 26.305 25.655 80-84 23.43 25.290000000000003 25.335 25.945 85-89 22.7 25.064999999999998 26.075 26.16 90-94 23.345 24.735 26.729999999999997 25.19 95-99 22.95 24.375 26.46 26.215 100-104 23.31 25.09 25.650000000000002 25.95 105-109 23.73 25.669999999999998 25.235000000000003 25.365 110-114 23.385 24.965 26.27 25.380000000000003 115-119 23.43 25.53 25.4 25.64 120-124 23.380000000000003 25.005 25.585 26.029999999999998 125-129 22.965 25.86 25.840000000000003 25.335 130-134 23.715 25.355 25.8 25.130000000000003 135-139 23.885 25.4 24.92 25.795 140-144 23.97 25.335 25.465 25.230000000000004 145-149 23.615 25.019999999999996 25.535000000000004 25.83 150-151 23.71546443305413 25.59069883735467 25.078134766845857 25.61570196274534 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.5 28 3.0 29 5.5 30 5.5 31 7.5 32 17.5 33 24.0 34 24.0 35 30.5 36 46.5 37 54.5 38 88.0 39 120.0 40 127.5 41 145.5 42 169.0 43 197.5 44 209.0 45 215.0 46 221.5 47 202.5 48 180.5 49 173.0 50 168.5 51 159.5 52 138.0 53 125.0 54 111.0 55 91.5 56 85.5 57 84.0 58 78.5 59 74.0 60 67.5 61 60.5 62 62.5 63 56.0 64 47.0 65 50.5 66 50.0 67 41.0 68 40.0 69 36.5 70 25.0 71 16.0 72 12.0 73 14.0 74 11.0 75 5.0 76 4.0 77 6.0 78 4.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0911386013633 98.125 2 0.8331229487503155 1.6500000000000001 3 0.07573844988639232 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 0.9874999999999999 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.3625 0.0 0.0 0.0 0.025 122-123 1.5625 0.0 0.0 0.0 0.025 124-125 1.7125 0.0 0.0 0.0 0.025 126-127 1.9249999999999998 0.0 0.0 0.0 0.025 128-129 2.1125 0.0 0.0 0.0 0.025 130-131 2.325 0.0 0.0 0.0 0.025 132-133 2.6125 0.0 0.0 0.0 0.025 134-135 2.95 0.0 0.0 0.0 0.025 136-137 3.2874999999999996 0.0 0.0 0.0 0.025 138-139 3.7375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958307 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958307_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91475 33.0 33.0 34.0 32.0 34.0 2 33.01025 34.0 33.0 34.0 32.0 34.0 3 33.0045 34.0 33.0 34.0 32.0 34.0 4 33.04525 34.0 33.0 34.0 32.0 34.0 5 32.99625 34.0 33.0 34.0 32.0 34.0 6 37.092 38.0 38.0 38.0 36.0 38.0 7 37.027 38.0 38.0 38.0 36.0 38.0 8 36.9145 38.0 38.0 38.0 36.0 38.0 9 37.02775 38.0 38.0 38.0 36.0 38.0 10-14 36.8525 38.0 38.0 38.0 35.8 38.0 15-19 36.9591 38.0 38.0 38.0 36.0 38.0 20-24 36.954750000000004 38.0 38.0 38.0 36.0 38.0 25-29 37.08035 38.0 38.0 38.0 36.2 38.0 30-34 37.062149999999995 38.0 38.0 38.0 36.2 38.0 35-39 36.978049999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.899800000000006 38.0 38.0 38.0 35.8 38.0 45-49 36.9241 38.0 38.0 38.0 35.8 38.0 50-54 36.85905 38.0 38.0 38.0 35.6 38.0 55-59 36.79965 38.0 38.0 38.0 35.2 38.0 60-64 36.86065 38.0 38.0 38.0 35.4 38.0 65-69 36.7541 38.0 38.0 38.0 35.0 38.0 70-74 36.618700000000004 38.0 38.0 38.0 34.6 38.0 75-79 36.37205 38.0 38.0 38.0 33.8 38.0 80-84 36.274 38.0 37.8 38.0 33.6 38.0 85-89 36.15095 38.0 37.6 38.0 33.0 38.0 90-94 36.137299999999996 38.0 37.8 38.0 33.0 38.0 95-99 35.97430000000001 38.0 37.2 38.0 32.8 38.0 100-104 35.803250000000006 38.0 37.0 38.0 31.4 38.0 105-109 35.60205 38.0 36.6 38.0 30.6 38.0 110-114 35.40505 38.0 36.0 38.0 30.2 38.0 115-119 35.115899999999996 38.0 35.6 38.0 28.4 38.0 120-124 34.9714 38.0 35.0 38.0 27.8 38.0 125-129 34.5824 38.0 35.0 38.0 26.4 38.0 130-134 34.043549999999996 38.0 34.2 38.0 23.0 38.0 135-139 33.5968 38.0 34.0 38.0 21.4 38.0 140-144 33.2209 38.0 33.6 38.0 18.6 38.0 145-149 32.2934 38.0 32.4 38.0 13.2 38.0 150-151 27.358875 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 2.0 12 0.0 13 1.0 14 2.0 15 3.0 16 3.0 17 1.0 18 2.0 19 9.0 20 6.0 21 11.0 22 11.0 23 14.0 24 10.0 25 22.0 26 26.0 27 23.0 28 37.0 29 50.0 30 54.0 31 91.0 32 104.0 33 137.0 34 215.0 35 341.0 36 807.0 37 2009.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.275 17.474999999999998 12.1 38.15 2 29.207301825456366 22.680670167541887 28.982245561390346 19.129782445611404 3 22.305576394098527 26.131532883220803 27.781945486371594 23.78094523630908 4 25.95648912228057 30.15753938484621 21.705426356589147 22.18054513628407 5 28.482120530132534 32.0830207551888 21.030257564391096 18.404601150287572 6 23.200000000000003 35.4 20.599999999999998 20.8 7 24.05 18.6 34.225 23.125 8 24.075 22.825 25.3 27.800000000000004 9 24.4 22.625 27.325 25.650000000000002 10-14 26.040000000000003 26.325 23.09 24.545 15-19 25.330000000000002 25.6 24.224999999999998 24.845 20-24 25.865 25.424999999999997 24.815 23.895 25-29 25.6 25.569999999999997 24.27 24.560000000000002 30-34 25.245 26.064999999999998 24.235 24.455 35-39 25.56 26.05 24.32 24.07 40-44 25.765 25.615 24.635 23.985 45-49 25.21 25.729999999999997 24.62 24.44 50-54 25.525 25.405 24.654999999999998 24.415 55-59 25.705 25.39 24.385 24.52 60-64 25.465 25.535000000000004 25.05 23.95 65-69 25.7 25.755 24.805 23.74 70-74 25.755 25.52 24.85 23.875 75-79 25.564999999999998 25.88 24.18 24.375 80-84 25.729999999999997 25.3 25.130000000000003 23.84 85-89 25.885 25.77 24.365000000000002 23.98 90-94 25.430000000000003 25.324999999999996 25.025 24.22 95-99 25.96 25.259999999999998 24.97 23.810000000000002 100-104 26.284999999999997 25.295 25.014999999999997 23.405 105-109 25.39 25.885 25.380000000000003 23.345 110-114 26.22 25.955000000000002 24.235 23.59 115-119 26.21 25.66 24.855 23.275000000000002 120-124 25.8 26.41 24.33 23.46 125-129 25.75 26.27 24.785 23.195 130-134 26.35 26.085 24.39 23.175 135-139 26.165 25.564999999999998 25.5 22.770000000000003 140-144 26.229999999999997 26.150000000000002 24.555 23.064999999999998 145-149 26.455000000000002 26.38 24.37 22.795 150-151 27.078384798099762 25.9407425928241 23.8404800600075 23.140392549068633 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 2.0 27 2.5 28 3.5 29 6.0 30 8.0 31 11.5 32 15.0 33 18.5 34 25.0 35 25.5 36 37.5 37 62.5 38 75.0 39 87.0 40 115.5 41 144.0 42 161.0 43 175.0 44 184.0 45 206.0 46 222.0 47 203.0 48 182.5 49 172.5 50 153.0 51 136.0 52 120.5 53 109.5 54 100.0 55 98.0 56 97.0 57 92.0 58 92.5 59 88.0 60 96.5 61 82.5 62 70.0 63 74.5 64 74.5 65 65.0 66 53.5 67 52.0 68 38.0 69 31.0 70 31.5 71 24.5 72 23.0 73 20.0 74 11.0 75 5.5 76 4.0 77 3.0 78 1.5 79 1.5 80 0.5 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2936427850656 98.4 2 0.6054490413723511 1.2 3 0.07568113017154389 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025227043390514632 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.9625 0.0 0.0 0.0 0.0 118-119 1.1125 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.1125 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.6125 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138-139 3.7874999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231289 spots for SRR6958307.sra Written 1231289 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra Read 1231276 spots for SRR6958307.sra Written 1231276 spots for SRR6958307.sra SRR ids: ['SRR6958307.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qiwrrb8t SRR6958307.sra spots: 24625533 blocks: [[1, 1231276], [1231277, 2462552], [2462553, 3693828], [3693829, 4925104], [4925105, 6156380], [6156381, 7387656], [7387657, 8618932], [8618933, 9850208], [9850209, 11081484], [11081485, 12312760], [12312761, 13544036], [13544037, 14775312], [14775313, 16006588], [16006589, 17237864], [17237865, 18469140], [18469141, 19700416], [19700417, 20931692], [20931693, 22162968], [22162969, 23394244], [23394245, 24625533]] SRR6958307 file size 8323084 SRR6958307 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958307 SRR6958307_1.fastq SRR6958307_2.fastq Input file: SRR6958307_1.fastq Paired file: SRR6958307_2.fastq trimmed: SRR6958307-trimmed-pair1.fastq, SRR6958307-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:19:26 2024 >> started Fri Dec 6 19:19:50 2024 >> done (24.518s) 24625533 read pairs processed; of these: 12841 ( 0.05%) short read pairs filtered out after trimming by size control 10046 ( 0.04%) empty read pairs filtered out after trimming by size control 24602646 (99.91%) read pairs available; of these: 9079136 (36.90%) trimmed read pairs available after processing 15523510 (63.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 1 0.00% 21 3 0.00% 22 1 0.00% 23 0 0.00% 24 6 0.00% 25 11 0.00% 26 9 0.00% 27 4 0.00% 28 5 0.00% 29 9 0.00% 30 10 0.00% 31 9 0.00% 32 3 0.00% 33 9 0.00% 34 13 0.00% 35 17 0.00% 36 4 0.00% 37 13 0.00% 38 15 0.00% 39 16 0.00% 40 10 0.00% 41 12 0.00% 42 19 0.00% 43 21 0.00% 44 15 0.00% 45 20 0.00% 46 29 0.00% 47 19 0.00% 48 15 0.00% 49 25 0.00% 50 43 0.00% 51 33 0.00% 52 38 0.00% 53 40 0.00% 54 56 0.00% 55 47 0.00% 56 64 0.00% 57 72 0.00% 58 89 0.00% 59 74 0.00% 60 88 0.00% 61 106 0.00% 62 132 0.00% 63 155 0.00% 64 164 0.00% 65 194 0.00% 66 228 0.00% 67 233 0.00% 68 262 0.00% 69 271 0.00% 70 320 0.00% 71 310 0.00% 72 393 0.00% 73 425 0.00% 74 497 0.00% 75 574 0.00% 76 654 0.00% 77 693 0.00% 78 757 0.00% 79 958 0.00% 80 1033 0.00% 81 1174 0.00% 82 1255 0.01% 83 1510 0.01% 84 2220 0.01% 85 2648 0.01% 86 2915 0.01% 87 3181 0.01% 88 3477 0.01% 89 3640 0.01% 90 3721 0.02% 91 4090 0.02% 92 4400 0.02% 93 4752 0.02% 94 5146 0.02% 95 5449 0.02% 96 5966 0.02% 97 6327 0.03% 98 7030 0.03% 99 7372 0.03% 100 8118 0.03% 101 8512 0.03% 102 8967 0.04% 103 9945 0.04% 104 10486 0.04% 105 11135 0.05% 106 12090 0.05% 107 12642 0.05% 108 13493 0.05% 109 14466 0.06% 110 15306 0.06% 111 16108 0.07% 112 17427 0.07% 113 18132 0.07% 114 19436 0.08% 115 20834 0.08% 116 22013 0.09% 117 23253 0.09% 118 24391 0.10% 119 25561 0.10% 120 26718 0.11% 121 28169 0.11% 122 29570 0.12% 123 31086 0.13% 124 32791 0.13% 125 34812 0.14% 126 36757 0.15% 127 38502 0.16% 128 40291 0.16% 129 42242 0.17% 130 45239 0.18% 131 47259 0.19% 132 49983 0.20% 133 53328 0.22% 134 55820 0.23% 135 59506 0.24% 136 64100 0.26% 137 68005 0.28% 138 72165 0.29% 139 78757 0.32% 140 84298 0.34% 141 92340 0.38% 142 102936 0.42% 143 115989 0.47% 144 134659 0.55% 145 161961 0.66% 146 201994 0.82% 147 276622 1.12% 148 430915 1.75% 149 891850 3.63% 150 5252533 21.35% 151 15523510 63.10% 24602646 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=20 prefix-density=0.58 prefix-fanout=3.0 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=64.73 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=10.7 sequence=ATTTCTTCAAAACAAACTACTTGTCGAGGCTGGAGTCACGTGGAGGCTTCGCTGTCGAGGCGAATCCTTTTGGTGCCAACCTCGTCACTAGCCGGCACCCTATTCTCCTTCGCTTCCACCGAGCACCTCTTGTAAGGTTTGAAGCCTGTCCGGTGGGATTTCATATTCAGGTGTGACAATTCAATGGGAAGGGAAGCTATCGGACCGACCGATGTATCGAGTTCATGATCAATAATCGAGGCGCACTC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=17 prefix-density=0.60 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=27.34 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958307 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:20:41 Started mapping on | Dec 06 19:20:41 Finished on | Dec 06 19:23:29 Mapping speed, Million of reads per hour | 527.20 Number of input reads | 24602646 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 23885968 Uniquely mapped reads % | 97.09% Average mapped length | 297.17 Number of splices: Total | 27976752 Number of splices: Annotated (sjdb) | 26368011 Number of splices: GT/AG | 27587248 Number of splices: GC/AG | 328012 Number of splices: AT/AC | 9865 Number of splices: Non-canonical | 51627 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263616 % of reads mapped to multiple loci | 1.07% Number of reads mapped to too many loci | 10844 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 461127 461127 461127 N_multimapping 263616 263616 263616 N_noFeature 843042 23136856 1036547 N_ambiguous 647548 2965 93206 UnstrandedReadsAssigned:22395378 PositiveStrandReadsAssigned:746147 NegativeStrandReadsAssigned:22756215 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958307 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958307-trimmed-pair1.fastq SRR6958307-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,602,646 reads, 22,715,384 reads pseudoaligned [quant] estimated average fragment length: 264.845 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52973 SRR6958307.ke.tsv 35125 SRR6958307.se.tsv 88098 total ==> SRR6958307.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.574 0 0 PNS24247 1044 780.155 60.0786 5.01121 PNS24249 1928 1664.16 68.2528 2.66889 PNS24246 1044 780.155 60.0786 5.01121 PNS24248 1044 780.155 60.0786 5.01121 PNS24244 1471 1207.16 52.5115 2.83071 PNS24243 293 81.3818 0 0 KQK14069 1603 1339.16 9446.61 459.039 KQK14071 474 223.423 158.526 46.172 ==> SRR6958307.se.tsv <== BRADI_1g14170v3 10989 BRADI_1g53295v3 1928 BRADI_1g59795v3 135 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 338 BRADI_1g74790v3 139 BRADI_1g09890v3 0 BRADI_1g77505v3 292 BRADI_1g48960v3 0 SRR6958307 completed mapping pipeline successfully