Starting /dee2/code/volunteer_pipeline.sh SRR6958308 current disk space = 1549734907904 free memory = 1382667980 SRR6958308 SRAfilesize 9dbe81e85def34918c9c29214601ec8a SRR6958308.sra SRR6958308.sra file validated SRR6958308 is paired end SRR6958308 is conventional basespace SRR6958308 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958308_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.697 18.0 18.0 32.0 18.0 33.0 2 26.99575 27.0 25.0 31.0 18.0 33.0 3 30.5065 31.0 29.0 33.0 27.0 33.0 4 32.3805 33.0 33.0 33.0 31.0 34.0 5 32.85675 33.0 33.0 33.0 32.0 34.0 6 36.68625 38.0 37.0 38.0 34.0 38.0 7 37.25325 38.0 38.0 38.0 36.0 38.0 8 37.3895 38.0 38.0 38.0 37.0 38.0 9 37.502 38.0 38.0 38.0 37.0 38.0 10-14 37.56195 38.0 38.0 38.0 38.0 38.0 15-19 37.493550000000006 38.0 38.0 38.0 37.4 38.0 20-24 37.3701 38.0 38.0 38.0 36.8 38.0 25-29 37.4751 38.0 38.0 38.0 37.4 38.0 30-34 37.413149999999995 38.0 38.0 38.0 37.4 38.0 35-39 37.49855 38.0 38.0 38.0 38.0 38.0 40-44 37.46805 38.0 38.0 38.0 37.6 38.0 45-49 37.4326 38.0 38.0 38.0 37.0 38.0 50-54 37.271100000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.15825 38.0 38.0 38.0 36.6 38.0 60-64 37.18300000000001 38.0 38.0 38.0 36.0 38.0 65-69 37.18215 38.0 38.0 38.0 36.2 38.0 70-74 37.0586 38.0 38.0 38.0 36.0 38.0 75-79 36.7283 38.0 38.0 38.0 34.6 38.0 80-84 35.5565 38.0 35.8 38.0 29.0 38.0 85-89 36.8047 38.0 38.0 38.0 35.0 38.0 90-94 36.757 38.0 38.0 38.0 34.8 38.0 95-99 36.61535 38.0 38.0 38.0 34.4 38.0 100-104 36.399449999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.3056 38.0 38.0 38.0 34.0 38.0 110-114 36.201750000000004 38.0 37.4 38.0 33.4 38.0 115-119 35.88635 38.0 36.8 38.0 32.2 38.0 120-124 35.6677 38.0 36.2 38.0 31.4 38.0 125-129 35.48745 38.0 35.8 38.0 30.4 38.0 130-134 35.2181 38.0 35.8 38.0 29.0 38.0 135-139 35.057 38.0 35.6 38.0 28.6 38.0 140-144 34.51685 38.0 34.4 38.0 27.4 38.0 145-149 33.86465 38.0 34.0 38.0 23.0 38.0 150-151 29.139875 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 2.0 19 4.0 20 5.0 21 5.0 22 9.0 23 4.0 24 8.0 25 8.0 26 14.0 27 19.0 28 27.0 29 22.0 30 27.0 31 68.0 32 75.0 33 105.0 34 185.0 35 320.0 36 969.0 37 2118.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.193768002094785 25.13747054202671 6.572401152134066 28.096360303744433 2 25.75 13.350000000000001 30.425 30.475 3 22.1 19.125 24.7 34.075 4 24.875 27.400000000000002 24.05 23.674999999999997 5 25.35 31.05 23.775 19.825 6 20.05 35.25 23.875 20.825 7 16.575 23.849999999999998 41.8 17.775 8 20.025000000000002 23.825 30.45 25.7 9 19.125 23.7 33.85 23.325000000000003 10-14 22.055 27.96 26.634999999999998 23.35 15-19 22.225 26.384999999999998 27.57 23.82 20-24 22.07 27.089999999999996 27.105 23.735 25-29 22.375 26.840000000000003 26.595000000000002 24.19 30-34 21.925 27.474999999999998 26.615 23.985 35-39 22.605 26.44 27.29 23.665 40-44 22.575 26.5 27.084999999999997 23.84 45-49 22.189999999999998 26.615 27.07 24.125 50-54 21.925 26.705000000000002 26.83 24.54 55-59 22.375 26.950000000000003 26.645000000000003 24.03 60-64 22.439999999999998 27.089999999999996 26.924999999999997 23.544999999999998 65-69 21.975 27.32 26.479999999999997 24.224999999999998 70-74 22.435 26.5 26.61 24.455 75-79 22.155 26.495 27.08 24.27 80-84 22.0 26.69 26.790000000000003 24.52 85-89 22.14 26.995 26.595000000000002 24.27 90-94 22.075 26.384999999999998 26.935 24.605 95-99 21.990000000000002 26.775 26.540000000000003 24.695 100-104 22.40060015003751 26.28657164291073 27.101775443860966 24.2110527631908 105-109 21.765 27.025 26.979999999999997 24.23 110-114 22.96 26.889999999999997 26.83 23.32 115-119 22.634999999999998 27.279999999999998 25.94 24.145 120-124 22.71 26.540000000000003 26.700000000000003 24.05 125-129 22.58 26.82 26.545 24.055 130-134 22.425 26.595000000000002 26.375 24.605 135-139 22.255 26.47 26.465 24.81 140-144 22.62 26.6 26.02 24.759999999999998 145-149 22.32 26.724999999999998 25.900000000000002 25.055 150-151 22.55 26.450000000000003 25.45 25.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.0 27 1.0 28 3.0 29 7.0 30 12.5 31 18.0 32 26.5 33 36.0 34 41.5 35 46.5 36 56.0 37 82.0 38 111.0 39 133.5 40 161.5 41 197.0 42 221.5 43 227.0 44 242.5 45 252.0 46 242.0 47 229.0 48 207.5 49 189.5 50 168.0 51 129.0 52 102.5 53 94.5 54 89.5 55 85.0 56 77.5 57 64.5 58 61.5 59 61.0 60 57.5 61 50.0 62 36.0 63 28.5 64 28.0 65 25.5 66 17.5 67 17.0 68 14.0 69 8.0 70 6.0 71 8.0 72 6.5 73 4.5 74 6.0 75 3.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 2.0250000000000004 0.0 0.0 0.0 0.0 116-117 2.4625000000000004 0.0 0.0 0.0 0.0 118-119 2.8375000000000004 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.6375 0.0 0.0 0.0 0.0 130-131 5.112500000000001 0.0 0.0 0.0 0.0 132-133 5.550000000000001 0.0 0.0 0.0 0.0 134-135 6.025 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958308 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958308_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0925 33.0 33.0 34.0 33.0 34.0 2 33.2085 34.0 33.0 34.0 33.0 34.0 3 33.23325 34.0 33.0 34.0 33.0 34.0 4 33.20575 34.0 33.0 34.0 33.0 34.0 5 33.19625 34.0 33.0 34.0 33.0 34.0 6 37.44575 38.0 38.0 38.0 38.0 38.0 7 37.39175 38.0 38.0 38.0 38.0 38.0 8 37.3875 38.0 38.0 38.0 38.0 38.0 9 37.37475 38.0 38.0 38.0 38.0 38.0 10-14 37.3697 38.0 38.0 38.0 38.0 38.0 15-19 36.0057 38.0 36.2 38.0 31.0 38.0 20-24 35.8995 38.0 36.2 38.0 29.6 38.0 25-29 37.2303 38.0 38.0 38.0 37.2 38.0 30-34 37.34365 38.0 38.0 38.0 38.0 38.0 35-39 37.244699999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.26595 38.0 38.0 38.0 37.2 38.0 45-49 37.27035 38.0 38.0 38.0 37.4 38.0 50-54 37.1192 38.0 38.0 38.0 36.8 38.0 55-59 37.1392 38.0 38.0 38.0 37.0 38.0 60-64 37.123599999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.059250000000006 38.0 38.0 38.0 37.0 38.0 70-74 37.04 38.0 38.0 38.0 36.8 38.0 75-79 36.9676 38.0 38.0 38.0 36.2 38.0 80-84 36.87815 38.0 38.0 38.0 36.0 38.0 85-89 36.8572 38.0 38.0 38.0 36.0 38.0 90-94 35.50855 38.0 36.4 38.0 29.2 38.0 95-99 33.8495 37.6 32.2 38.0 22.8 38.0 100-104 34.2798 37.8 33.2 38.0 25.8 38.0 105-109 36.30085 38.0 37.8 38.0 34.2 38.0 110-114 36.097899999999996 38.0 37.8 38.0 32.4 38.0 115-119 35.372800000000005 38.0 36.6 38.0 28.2 38.0 120-124 35.28765 38.0 36.6 38.0 29.6 38.0 125-129 35.354549999999996 38.0 36.0 38.0 29.8 38.0 130-134 33.35385 37.4 30.2 38.0 24.0 38.0 135-139 33.919050000000006 38.0 33.8 38.0 24.2 38.0 140-144 33.53855 38.0 33.8 38.0 19.4 38.0 145-149 33.7533 38.0 33.6 38.0 23.4 38.0 150-151 29.368625 35.5 24.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 2.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 2.0 12 4.0 13 4.0 14 5.0 15 3.0 16 2.0 17 3.0 18 2.0 19 2.0 20 6.0 21 7.0 22 5.0 23 7.0 24 9.0 25 15.0 26 22.0 27 20.0 28 25.0 29 20.0 30 33.0 31 51.0 32 74.0 33 125.0 34 189.0 35 369.0 36 1212.0 37 1771.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.85 21.224999999999998 8.625 22.3 2 30.2 24.75 27.025 18.025 3 22.400000000000002 26.375 29.2 22.025 4 26.400000000000002 33.074999999999996 20.225 20.3 5 26.125 33.825 21.725 18.325 6 21.675 38.3 20.5 19.525000000000002 7 21.85 21.05 34.675 22.425 8 23.474999999999998 24.925 24.6 27.0 9 23.474999999999998 23.525 28.349999999999998 24.65 10-14 25.415 27.544999999999998 24.365000000000002 22.675 15-19 25.330000000000002 26.985 25.405 22.28 20-24 24.725 27.810000000000002 25.355 22.11 25-29 24.58 26.810000000000002 25.755 22.855 30-34 24.195 26.945000000000004 26.179999999999996 22.68 35-39 24.455 26.935 26.145000000000003 22.465 40-44 24.42 26.645000000000003 26.150000000000002 22.785 45-49 24.615000000000002 27.04 25.55 22.795 50-54 24.229074889867842 26.912294753704447 25.69082899479375 23.16780136163396 55-59 24.734522139851734 26.878381085954718 25.440793428170704 22.94630334602284 60-64 24.877315973960943 26.71507260891337 26.199298948422634 22.208312468703053 65-69 24.455569461827285 27.2540675844806 25.797246558197745 22.49311639549437 70-74 24.952419112491235 26.12942001402384 26.364820194330363 22.553340679154562 75-79 24.432757325319308 26.471324818432258 26.210869020786376 22.885048835462058 80-84 24.934817488969113 27.31147212194144 25.94765342960289 21.80605695948656 85-89 24.31592663125188 26.911897363937054 26.280445023554172 22.49173098125689 90-94 24.916145181476846 26.51314142678348 26.282853566958696 22.287859824780977 95-99 24.066473120432473 27.054760236259884 26.514165582140354 22.36460106116728 100-104 24.894852793911475 27.03785299419187 26.261766473062288 21.805527738834368 105-109 24.610763454317897 27.043804755944933 26.558197747183982 21.78723404255319 110-114 24.959951942330797 27.102523027633158 25.465558670404487 22.47196635963156 115-119 24.798477945226054 26.58589095278626 26.42567466079207 22.189956441195612 120-124 24.784784784784787 27.42242242242242 25.5005005005005 22.29229229229229 125-129 24.562018220042045 27.49023926318951 25.72830113124437 22.219441385524078 130-134 25.267633816908454 26.398199099549775 26.07303651825913 22.26113056528264 135-139 25.205287402363307 27.638694171840577 26.166633286601243 20.989385139194873 140-144 25.003757326787234 27.303241320575122 25.905515755723663 21.78748559691398 145-149 25.579648455105414 26.76148029445641 26.19560318493665 21.463268065501527 150-151 26.249843378022803 26.45031950883348 25.961658939982456 21.338178173161257 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 3.0 25 3.0 26 2.5 27 4.5 28 8.5 29 10.0 30 15.0 31 15.0 32 16.5 33 25.0 34 29.5 35 39.5 36 56.0 37 73.0 38 84.5 39 113.5 40 154.5 41 179.5 42 203.0 43 214.5 44 230.5 45 256.0 46 235.0 47 215.0 48 210.5 49 177.5 50 157.0 51 142.5 52 125.0 53 117.0 54 102.5 55 85.5 56 67.0 57 63.5 58 75.5 59 71.0 60 60.5 61 53.5 62 49.5 63 49.5 64 41.5 65 30.0 66 23.0 67 21.5 68 22.0 69 17.5 70 13.0 71 13.0 72 8.5 73 4.0 74 3.0 75 1.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.12 55-59 0.18 60-64 0.15 65-69 0.125 70-74 0.16999999999999998 75-79 0.17500000000000002 80-84 0.27999999999999997 85-89 0.22999999999999998 90-94 0.125 95-99 0.11 100-104 0.13999999999999999 105-109 0.125 110-114 0.12 115-119 0.135 120-124 0.1 125-129 0.11 130-134 0.05 135-139 0.13999999999999999 140-144 0.19499999999999998 145-149 0.155 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.6735308890005 99.225 2 0.22601707684580613 0.44999999999999996 3 0.07533902561526871 0.22499999999999998 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2125 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.8 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.675 0.0 0.0 0.0 0.0 130-131 4.1 0.0 0.0 0.0 0.0 132-133 4.475 0.0 0.0 0.0 0.0 134-135 4.85 0.0 0.0 0.0 0.0 136-137 5.375 0.0 0.0 0.0 0.0 138-139 5.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTCA 10 0.006830828 145.0 5 GAAATGG 10 0.006830828 145.0 1 TTGGCAA 10 0.006830828 145.0 2 >>END_MODULE Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737581 spots for SRR6958308.sra Written 737581 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra Read 737579 spots for SRR6958308.sra Written 737579 spots for SRR6958308.sra SRR ids: ['SRR6958308.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f36pgch4 SRR6958308.sra spots: 14751582 blocks: [[1, 737579], [737580, 1475158], [1475159, 2212737], [2212738, 2950316], [2950317, 3687895], [3687896, 4425474], [4425475, 5163053], [5163054, 5900632], [5900633, 6638211], [6638212, 7375790], [7375791, 8113369], [8113370, 8850948], [8850949, 9588527], [9588528, 10326106], [10326107, 11063685], [11063686, 11801264], [11801265, 12538843], [12538844, 13276422], [13276423, 14014001], [14014002, 14751582]] SRR6958308 file size 4977126 SRR6958308 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958308 SRR6958308_1.fastq SRR6958308_2.fastq Input file: SRR6958308_1.fastq Paired file: SRR6958308_2.fastq trimmed: SRR6958308-trimmed-pair1.fastq, SRR6958308-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:25:14 2024 >> started Fri Dec 6 19:25:31 2024 >> done (16.532s) 14751582 read pairs processed; of these: 9744 ( 0.07%) short read pairs filtered out after trimming by size control 13592 ( 0.09%) empty read pairs filtered out after trimming by size control 14728246 (99.84%) read pairs available; of these: 8708712 (59.13%) trimmed read pairs available after processing 6019534 (40.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 20 0.00% 21 12 0.00% 22 9 0.00% 23 10 0.00% 24 13 0.00% 25 8 0.00% 26 17 0.00% 27 13 0.00% 28 14 0.00% 29 7 0.00% 30 8 0.00% 31 18 0.00% 32 13 0.00% 33 11 0.00% 34 10 0.00% 35 16 0.00% 36 10 0.00% 37 15 0.00% 38 16 0.00% 39 26 0.00% 40 28 0.00% 41 31 0.00% 42 27 0.00% 43 47 0.00% 44 22 0.00% 45 38 0.00% 46 43 0.00% 47 48 0.00% 48 49 0.00% 49 63 0.00% 50 68 0.00% 51 78 0.00% 52 77 0.00% 53 65 0.00% 54 109 0.00% 55 91 0.00% 56 123 0.00% 57 144 0.00% 58 143 0.00% 59 164 0.00% 60 195 0.00% 61 241 0.00% 62 292 0.00% 63 305 0.00% 64 323 0.00% 65 330 0.00% 66 419 0.00% 67 479 0.00% 68 489 0.00% 69 586 0.00% 70 668 0.00% 71 758 0.01% 72 886 0.01% 73 1040 0.01% 74 1208 0.01% 75 1413 0.01% 76 1644 0.01% 77 1689 0.01% 78 1776 0.01% 79 2119 0.01% 80 2448 0.02% 81 2386 0.02% 82 2758 0.02% 83 3062 0.02% 84 3749 0.03% 85 4166 0.03% 86 4567 0.03% 87 4871 0.03% 88 5156 0.04% 89 5661 0.04% 90 5873 0.04% 91 6543 0.04% 92 7239 0.05% 93 7733 0.05% 94 8572 0.06% 95 9120 0.06% 96 9727 0.07% 97 10298 0.07% 98 11201 0.08% 99 12755 0.09% 100 16242 0.11% 101 17504 0.12% 102 13449 0.09% 103 14067 0.10% 104 15230 0.10% 105 15923 0.11% 106 16812 0.11% 107 17456 0.12% 108 18381 0.12% 109 19424 0.13% 110 20216 0.14% 111 21271 0.14% 112 22765 0.15% 113 23767 0.16% 114 25249 0.17% 115 26871 0.18% 116 27729 0.19% 117 28958 0.20% 118 29731 0.20% 119 30838 0.21% 120 32303 0.22% 121 34315 0.23% 122 36080 0.24% 123 37965 0.26% 124 40716 0.28% 125 41984 0.29% 126 44320 0.30% 127 46240 0.31% 128 47698 0.32% 129 50510 0.34% 130 52887 0.36% 131 55131 0.37% 132 58320 0.40% 133 62522 0.42% 134 65965 0.45% 135 70715 0.48% 136 75719 0.51% 137 79504 0.54% 138 85147 0.58% 139 91775 0.62% 140 100764 0.68% 141 111778 0.76% 142 124427 0.84% 143 140644 0.95% 144 164636 1.12% 145 202992 1.38% 146 254885 1.73% 147 349298 2.37% 148 512061 3.48% 149 968282 6.57% 150 4100765 27.84% 151 6019534 40.87% 14728246 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=19 prefix-density=0.64 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=46.78 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=20 prefix-density=0.39 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=226.47 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=8.2 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958308 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:26:38 Started mapping on | Dec 06 19:26:38 Finished on | Dec 06 19:28:05 Mapping speed, Million of reads per hour | 609.44 Number of input reads | 14728246 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14258967 Uniquely mapped reads % | 96.81% Average mapped length | 292.54 Number of splices: Total | 16121448 Number of splices: Annotated (sjdb) | 15144009 Number of splices: GT/AG | 15892912 Number of splices: GC/AG | 187814 Number of splices: AT/AC | 6480 Number of splices: Non-canonical | 34242 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 178192 % of reads mapped to multiple loci | 1.21% Number of reads mapped to too many loci | 5706 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.76% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 298818 298818 298818 N_multimapping 178192 178192 178192 N_noFeature 639868 13813812 783363 N_ambiguous 352590 2002 51334 UnstrandedReadsAssigned:13266509 PositiveStrandReadsAssigned:443153 NegativeStrandReadsAssigned:13424270 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958308 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958308-trimmed-pair1.fastq SRR6958308-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,728,246 reads, 13,425,280 reads pseudoaligned [quant] estimated average fragment length: 235.092 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52973 SRR6958308.ke.tsv 35125 SRR6958308.se.tsv 88098 total ==> SRR6958308.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 702.356 0 0 PNS24247 1044 809.908 42.3248 6.02316 PNS24249 1928 1693.91 22.6692 1.54245 PNS24246 1044 809.908 42.3248 6.02316 PNS24248 1044 809.908 42.3248 6.02316 PNS24244 1471 1236.91 38.3563 3.57408 PNS24243 293 94.0826 0 0 KQK14069 1603 1368.91 1494.6 125.839 KQK14071 474 246.172 32.8527 15.3814 ==> SRR6958308.se.tsv <== BRADI_1g14170v3 1876 BRADI_1g53295v3 929 BRADI_1g59795v3 103 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 323 BRADI_1g74790v3 44 BRADI_1g09890v3 0 BRADI_1g77505v3 225 BRADI_1g48960v3 1 SRR6958308 completed mapping pipeline successfully