Starting /dee2/code/volunteer_pipeline.sh SRR6958309 current disk space = 1549726556160 free memory = 1596764844 SRR6958309 SRAfilesize 55ad4f80ae7af01b9f724d764a78d1ad SRR6958309.sra SRR6958309.sra file validated SRR6958309 is paired end SRR6958309 is conventional basespace SRR6958309 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958309_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.405 30.0 18.0 32.0 18.0 33.0 2 30.169 31.0 29.0 33.0 27.0 33.0 3 31.9575 33.0 31.0 33.0 29.0 33.0 4 32.7795 33.0 33.0 34.0 32.0 34.0 5 33.06575 33.0 33.0 34.0 32.0 34.0 6 37.2785 38.0 38.0 38.0 36.0 38.0 7 37.44125 38.0 38.0 38.0 37.0 38.0 8 37.417 38.0 38.0 38.0 37.0 38.0 9 37.56675 38.0 38.0 38.0 38.0 38.0 10-14 37.506299999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.4686 38.0 38.0 38.0 37.8 38.0 20-24 37.57645 38.0 38.0 38.0 38.0 38.0 25-29 37.58365 38.0 38.0 38.0 38.0 38.0 30-34 37.51605 38.0 38.0 38.0 38.0 38.0 35-39 37.4531 38.0 38.0 38.0 38.0 38.0 40-44 37.4488 38.0 38.0 38.0 37.8 38.0 45-49 37.49165 38.0 38.0 38.0 37.8 38.0 50-54 37.452349999999996 38.0 38.0 38.0 37.6 38.0 55-59 37.37035 38.0 38.0 38.0 37.0 38.0 60-64 37.239549999999994 38.0 38.0 38.0 36.8 38.0 65-69 37.343450000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.29445 38.0 38.0 38.0 37.0 38.0 75-79 36.97735 38.0 38.0 38.0 36.4 38.0 80-84 36.9897 38.0 38.0 38.0 36.2 38.0 85-89 35.82685 38.0 36.6 38.0 30.4 38.0 90-94 36.73345 38.0 38.0 38.0 35.4 38.0 95-99 36.725300000000004 38.0 38.0 38.0 35.2 38.0 100-104 36.6731 38.0 38.0 38.0 35.0 38.0 105-109 36.436699999999995 38.0 38.0 38.0 34.4 38.0 110-114 36.004650000000005 38.0 37.4 38.0 32.6 38.0 115-119 36.2379 38.0 38.0 38.0 34.0 38.0 120-124 36.118700000000004 38.0 38.0 38.0 34.0 38.0 125-129 35.945350000000005 38.0 38.0 38.0 33.6 38.0 130-134 35.8437 38.0 37.8 38.0 33.0 38.0 135-139 35.662400000000005 38.0 37.6 38.0 31.8 38.0 140-144 34.940999999999995 38.0 35.4 38.0 27.6 38.0 145-149 33.1298 37.6 31.8 38.0 22.0 38.0 150-151 30.98275 35.5 30.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 5.0 19 28.0 20 6.0 21 7.0 22 4.0 23 5.0 24 6.0 25 7.0 26 12.0 27 15.0 28 22.0 29 21.0 30 26.0 31 39.0 32 56.0 33 76.0 34 138.0 35 223.0 36 622.0 37 2677.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.46723044397463 10.042283298097251 5.470401691331924 36.020084566596196 2 24.05 13.225000000000001 34.425 28.299999999999997 3 22.275 16.125 25.15 36.449999999999996 4 27.975 22.525000000000002 21.125 28.375 5 27.150000000000002 29.4 22.625 20.825 6 24.275 30.55 22.325 22.85 7 18.5 22.525000000000002 38.675 20.3 8 20.150000000000002 23.5 29.7 26.650000000000002 9 21.45 20.0 33.45 25.1 10-14 24.265 25.335 24.635 25.765 15-19 24.3 24.14 25.2 26.36 20-24 23.919999999999998 25.03 25.46 25.590000000000003 25-29 24.505 24.335 25.03 26.13 30-34 24.005000000000003 24.025 25.91 26.06 35-39 24.15 24.18 24.46 27.21 40-44 24.2 24.815 24.935 26.05 45-49 23.95979195839168 24.63492698539708 25.08501700340068 26.32026405281056 50-54 24.154999999999998 24.14 25.025 26.68 55-59 24.055 24.275 25.595000000000002 26.075 60-64 24.33 23.865 25.14 26.665 65-69 24.287428742874287 24.577457745774577 25.03750375037504 26.0976097609761 70-74 24.67 24.62 24.55 26.16 75-79 24.63 24.765 24.505 26.1 80-84 24.415 25.14 24.65 25.795 85-89 24.8 24.42 24.44 26.340000000000003 90-94 24.285 24.465 24.82 26.43 95-99 24.575 24.099999999999998 25.180000000000003 26.145000000000003 100-104 24.73 24.310000000000002 24.39 26.57 105-109 24.66 24.22 25.080000000000002 26.040000000000003 110-114 24.615000000000002 24.38 25.019999999999996 25.985000000000003 115-119 24.68 24.495 24.47 26.355 120-124 25.074999999999996 24.535 24.38 26.009999999999998 125-129 24.605 24.88 24.279999999999998 26.235000000000003 130-134 25.105 24.65 23.91 26.334999999999997 135-139 24.349999999999998 24.46 24.815 26.375 140-144 24.855 24.490000000000002 23.965 26.69 145-149 25.255 24.92 23.93 25.895000000000003 150-151 24.552845528455283 24.677923702313947 24.44027517198249 26.32895559724828 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 0.5 25 0.5 26 0.5 27 1.5 28 2.5 29 3.0 30 5.5 31 6.5 32 7.5 33 16.5 34 25.5 35 32.0 36 43.0 37 51.0 38 69.0 39 88.0 40 113.5 41 143.5 42 166.0 43 180.0 44 176.5 45 192.5 46 192.0 47 172.5 48 163.0 49 154.0 50 144.0 51 126.0 52 129.0 53 119.0 54 101.5 55 92.0 56 100.5 57 104.5 58 91.0 59 95.0 60 89.0 61 85.5 62 75.0 63 64.5 64 73.0 65 75.0 66 67.0 67 61.5 68 56.5 69 52.0 70 45.0 71 33.0 72 26.0 73 21.5 74 20.0 75 16.5 76 9.5 77 5.5 78 3.5 79 4.5 80 2.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9795918367347 97.0 2 0.9183673469387756 1.7999999999999998 3 0.025510204081632654 0.075 4 0.05102040816326531 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025510204081632654 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGCTCAAATCTCGTAT 37 0.9249999999999999 TruSeq Adapter, Index 10 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.5875000000000004 0.0 0.0 0.0 0.0 116-117 3.0875000000000004 0.0 0.0 0.0 0.0 118-119 3.4375 0.0 0.0 0.0 0.0 120-121 3.775 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.574999999999999 0.0 0.0 0.0 0.0 126-127 5.1 0.0 0.0 0.0 0.0 128-129 5.525 0.0 0.0 0.0 0.0 130-131 6.0125 0.0 0.0 0.0 0.0 132-133 6.5625 0.0 0.0 0.0 0.0 134-135 6.975 0.0 0.0 0.0 0.0 136-137 7.825 0.0 0.0 0.0 0.0 138-139 8.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958309 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958309_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5065 33.0 33.0 34.0 32.0 34.0 2 32.95625 34.0 33.0 34.0 32.0 34.0 3 33.0145 34.0 33.0 34.0 32.0 34.0 4 33.08125 34.0 33.0 34.0 33.0 34.0 5 32.803 34.0 33.0 34.0 32.0 34.0 6 37.161 38.0 38.0 38.0 37.0 38.0 7 37.2155 38.0 38.0 38.0 37.0 38.0 8 37.17 38.0 38.0 38.0 37.0 38.0 9 37.1215 38.0 38.0 38.0 37.0 38.0 10-14 36.93755 38.0 38.0 38.0 35.8 38.0 15-19 37.1954 38.0 38.0 38.0 37.0 38.0 20-24 37.3025 38.0 38.0 38.0 37.8 38.0 25-29 36.96605000000001 38.0 38.0 38.0 36.0 38.0 30-34 37.2106 38.0 38.0 38.0 37.0 38.0 35-39 37.03645 38.0 38.0 38.0 36.8 38.0 40-44 36.70334999999999 38.0 38.0 38.0 35.8 38.0 45-49 36.71345 38.0 38.0 38.0 35.6 38.0 50-54 36.562850000000005 38.0 38.0 38.0 34.4 38.0 55-59 36.92365 38.0 38.0 38.0 36.8 38.0 60-64 36.86955 38.0 38.0 38.0 36.2 38.0 65-69 36.05545000000001 38.0 37.6 38.0 31.8 38.0 70-74 36.78065 38.0 38.0 38.0 35.6 38.0 75-79 36.9075 38.0 38.0 38.0 36.4 38.0 80-84 36.50815 38.0 38.0 38.0 35.0 38.0 85-89 36.3675 38.0 38.0 38.0 35.0 38.0 90-94 36.2628 38.0 38.0 38.0 34.6 38.0 95-99 34.854200000000006 38.0 35.8 38.0 26.6 38.0 100-104 36.13225 38.0 38.0 38.0 33.8 38.0 105-109 35.536 38.0 37.4 38.0 30.6 38.0 110-114 36.07185 38.0 38.0 38.0 34.0 38.0 115-119 35.97755 38.0 38.0 38.0 33.8 38.0 120-124 34.86785 38.0 36.4 38.0 27.2 38.0 125-129 35.3565 38.0 37.0 38.0 30.4 38.0 130-134 35.3784 38.0 37.4 38.0 31.0 38.0 135-139 33.848949999999995 38.0 33.8 38.0 24.2 38.0 140-144 34.5603 38.0 36.0 38.0 27.8 38.0 145-149 33.2636 38.0 34.0 38.0 18.6 38.0 150-151 28.505249999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 1.0 5 1.0 6 1.0 7 3.0 8 4.0 9 1.0 10 4.0 11 3.0 12 2.0 13 2.0 14 3.0 15 3.0 16 5.0 17 10.0 18 14.0 19 6.0 20 4.0 21 5.0 22 4.0 23 6.0 24 12.0 25 12.0 26 23.0 27 19.0 28 33.0 29 36.0 30 49.0 31 47.0 32 66.0 33 104.0 34 165.0 35 248.0 36 607.0 37 2484.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.86096524131033 18.154538634658664 8.427106776694174 29.557389347336834 2 29.95 24.575 25.324999999999996 20.150000000000002 3 22.3 24.45 27.750000000000004 25.5 4 25.55 31.525 18.925 24.0 5 27.150000000000002 34.225 18.45 20.175 6 24.275 34.050000000000004 20.3 21.375 7 23.1 20.275000000000002 32.425 24.2 8 23.0 24.25 23.125 29.625 9 24.387193596798397 21.735867933966986 26.93846923461731 26.93846923461731 10-14 26.245 25.264999999999997 23.075000000000003 25.415 15-19 25.81258125812581 24.51745174517452 23.82238223822382 25.84758475847585 20-24 26.38 25.445 23.385 24.79 25-29 25.937593759375936 25.197519751975193 23.502350235023503 25.36253625362536 30-34 26.229999999999997 25.575 23.61 24.585 35-39 25.53510702140428 25.625125025005 23.424684936987397 25.41508301660332 40-44 26.572657265726573 24.792479247924792 23.067306730673067 25.567556755675568 45-49 26.367636763676366 24.797479747974798 23.387338733873385 25.447544754475448 50-54 26.17761776177618 24.652465246524653 23.697369736973698 25.472547254725477 55-59 27.333199959987997 24.492347704311292 22.916875062518756 25.25757727318195 60-64 26.174999999999997 24.135 23.57 26.119999999999997 65-69 25.94 24.085 24.41 25.564999999999998 70-74 25.619999999999997 24.775 24.29 25.314999999999998 75-79 26.118917837675653 24.948742311346702 23.648547282092313 25.28379256888533 80-84 26.62766276627663 25.03750375037504 23.442344234423445 24.892489248924893 85-89 26.176308815440773 25.016250812540626 23.406170308515424 25.401270063503173 90-94 26.862686268626863 25.28252825282528 23.022302230223023 24.832483248324834 95-99 26.14 25.22 23.485 25.155 100-104 26.85 24.9 23.380000000000003 24.87 105-109 26.992699269926995 24.847484748474848 23.352335233523352 24.80748074807481 110-114 26.628994349152375 26.08391258688803 23.263489523428515 24.02360354053108 115-119 26.915 24.745 23.494999999999997 24.845 120-124 27.24 25.66 22.825 24.275 125-129 26.83 25.779999999999998 22.81 24.58 130-134 27.42 25.525 22.939999999999998 24.115000000000002 135-139 27.275 25.77 23.51 23.445 140-144 28.055000000000003 25.005 23.315 23.625 145-149 27.661383069153455 25.116255812790637 23.566178308915443 23.656182809140457 150-151 27.651325662831418 26.088044022011005 23.149074537268636 23.111555777888945 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.5 25 1.0 26 2.0 27 3.5 28 4.0 29 4.5 30 3.5 31 4.5 32 11.0 33 16.0 34 20.5 35 32.5 36 41.5 37 46.5 38 68.0 39 90.5 40 99.5 41 107.5 42 128.5 43 151.5 44 160.0 45 166.5 46 166.0 47 171.5 48 172.0 49 165.0 50 150.0 51 141.0 52 137.5 53 113.0 54 94.5 55 96.5 56 107.5 57 109.0 58 108.0 59 102.5 60 92.5 61 87.0 62 94.0 63 95.0 64 88.0 65 79.0 66 69.5 67 60.5 68 60.5 69 56.0 70 49.0 71 47.5 72 31.5 73 22.5 74 22.0 75 18.5 76 10.5 77 6.0 78 4.5 79 1.5 80 0.5 81 1.0 82 1.0 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.02 40-44 0.01 45-49 0.01 50-54 0.01 55-59 0.03 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.015 80-84 0.01 85-89 0.005 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.015 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.55892949047865 95.75 2 0.9521358723623262 1.8499999999999999 3 0.23160061760164694 0.675 4 0.12866700977869275 0.5 5 0.07720020586721565 0.375 6 0.0 0.0 7 0.0 0.0 8 0.02573340195573855 0.2 9 0.0 0.0 >10 0.02573340195573855 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGAGCTCAAGTGTAGATCT 26 0.65 Illumina Single End PCR Primer 1 (96% over 32bp) AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 8 0.2 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit GCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTT 5 0.125 No Hit GGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.3250000000000002 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.325 0.0 0.0 0.0 0.0 114-115 2.6624999999999996 0.0 0.0 0.0 0.0 116-117 3.1624999999999996 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.8375000000000004 0.0 0.0 0.0 0.0 122-123 4.2125 0.0 0.0 0.0 0.0 124-125 4.65 0.0 0.0 0.0 0.0 126-127 5.175000000000001 0.0 0.0 0.0 0.0 128-129 5.6125 0.0 0.0 0.0 0.0 130-131 6.0625 0.0 0.0 0.0 0.0 132-133 6.625 0.0 0.0 0.0 0.0 134-135 7.075 0.0 0.0 0.0 0.0 136-137 7.9 0.0 0.0 0.0 0.0 138-139 8.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATCTG 10 0.006830828 145.0 4 AACATCT 10 0.006830828 145.0 3 >>END_MODULE Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092997 spots for SRR6958309.sra Written 1092997 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra Read 1092985 spots for SRR6958309.sra Written 1092985 spots for SRR6958309.sra SRR ids: ['SRR6958309.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lnmh080m SRR6958309.sra spots: 21859712 blocks: [[1, 1092985], [1092986, 2185970], [2185971, 3278955], [3278956, 4371940], [4371941, 5464925], [5464926, 6557910], [6557911, 7650895], [7650896, 8743880], [8743881, 9836865], [9836866, 10929850], [10929851, 12022835], [12022836, 13115820], [13115821, 14208805], [14208806, 15301790], [15301791, 16394775], [16394776, 17487760], [17487761, 18580745], [18580746, 19673730], [19673731, 20766715], [20766716, 21859712]] SRR6958309 file size 7385838 SRR6958309 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958309 SRR6958309_1.fastq SRR6958309_2.fastq Input file: SRR6958309_1.fastq Paired file: SRR6958309_2.fastq trimmed: SRR6958309-trimmed-pair1.fastq, SRR6958309-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:26:33 2024 >> started Fri Dec 6 19:26:55 2024 >> done (21.897s) 21859712 read pairs processed; of these: 24397 ( 0.11%) short read pairs filtered out after trimming by size control 194636 ( 0.89%) empty read pairs filtered out after trimming by size control 21640679 (99.00%) read pairs available; of these: 8527774 (39.41%) trimmed read pairs available after processing 13112905 (60.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 18 0.00% 20 15 0.00% 21 26 0.00% 22 20 0.00% 23 13 0.00% 24 20 0.00% 25 20 0.00% 26 19 0.00% 27 25 0.00% 28 21 0.00% 29 25 0.00% 30 21 0.00% 31 23 0.00% 32 22 0.00% 33 22 0.00% 34 22 0.00% 35 21 0.00% 36 30 0.00% 37 34 0.00% 38 42 0.00% 39 38 0.00% 40 46 0.00% 41 58 0.00% 42 43 0.00% 43 50 0.00% 44 49 0.00% 45 66 0.00% 46 85 0.00% 47 100 0.00% 48 134 0.00% 49 113 0.00% 50 118 0.00% 51 164 0.00% 52 160 0.00% 53 126 0.00% 54 184 0.00% 55 186 0.00% 56 230 0.00% 57 251 0.00% 58 317 0.00% 59 340 0.00% 60 352 0.00% 61 398 0.00% 62 444 0.00% 63 462 0.00% 64 529 0.00% 65 584 0.00% 66 650 0.00% 67 740 0.00% 68 838 0.00% 69 937 0.00% 70 1062 0.00% 71 1342 0.01% 72 1406 0.01% 73 1536 0.01% 74 1810 0.01% 75 2128 0.01% 76 2886 0.01% 77 3316 0.02% 78 2892 0.01% 79 3182 0.01% 80 3436 0.02% 81 4099 0.02% 82 4605 0.02% 83 5172 0.02% 84 6421 0.03% 85 7812 0.04% 86 8191 0.04% 87 8760 0.04% 88 9580 0.04% 89 9955 0.05% 90 10683 0.05% 91 11679 0.05% 92 12444 0.06% 93 13361 0.06% 94 14347 0.07% 95 14917 0.07% 96 15989 0.07% 97 17054 0.08% 98 18071 0.08% 99 19505 0.09% 100 20244 0.09% 101 21611 0.10% 102 23083 0.11% 103 24515 0.11% 104 25715 0.12% 105 26858 0.12% 106 28643 0.13% 107 29875 0.14% 108 31002 0.14% 109 32164 0.15% 110 33792 0.16% 111 35178 0.16% 112 37274 0.17% 113 38492 0.18% 114 40269 0.19% 115 42697 0.20% 116 43521 0.20% 117 44800 0.21% 118 46195 0.21% 119 47464 0.22% 120 48974 0.23% 121 50589 0.23% 122 52006 0.24% 123 54639 0.25% 124 56706 0.26% 125 59037 0.27% 126 61388 0.28% 127 62805 0.29% 128 63368 0.29% 129 64909 0.30% 130 67103 0.31% 131 68870 0.32% 132 71873 0.33% 133 74463 0.34% 134 76721 0.35% 135 80070 0.37% 136 81794 0.38% 137 83760 0.39% 138 87539 0.40% 139 91632 0.42% 140 94999 0.44% 141 100972 0.47% 142 107737 0.50% 143 116656 0.54% 144 128077 0.59% 145 146302 0.68% 146 171296 0.79% 147 216577 1.00% 148 307925 1.42% 149 634769 2.93% 150 4223927 19.52% 151 13112905 60.59% 21640679 reads passed initial QC criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=17 prefix-density=1.09 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=42.21 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.7 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=20 prefix-density=0.68 prefix-fanout=2.3 sequence=CTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=70.80 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.6 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCC SRR6958309 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:27:38 Started mapping on | Dec 06 19:27:38 Finished on | Dec 06 19:29:10 Mapping speed, Million of reads per hour | 846.81 Number of input reads | 21640679 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21211011 Uniquely mapped reads % | 98.01% Average mapped length | 293.85 Number of splices: Total | 22666123 Number of splices: Annotated (sjdb) | 21245125 Number of splices: GT/AG | 22366963 Number of splices: GC/AG | 258419 Number of splices: AT/AC | 8062 Number of splices: Non-canonical | 32679 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 160154 % of reads mapped to multiple loci | 0.74% Number of reads mapped to too many loci | 12764 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 287114 287114 287114 N_multimapping 160154 160154 160154 N_noFeature 735190 20537693 975858 N_ambiguous 519712 2999 88377 UnstrandedReadsAssigned:19956109 PositiveStrandReadsAssigned:670319 NegativeStrandReadsAssigned:20146776 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958309 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958309-trimmed-pair1.fastq SRR6958309-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,640,679 reads, 20,135,134 reads pseudoaligned [quant] estimated average fragment length: 253.439 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR6958309.ke.tsv 35125 SRR6958309.se.tsv 88098 total ==> SRR6958309.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 684.136 0 0 PNS24247 1044 791.561 53.3724 4.84509 PNS24249 1928 1675.56 76.9471 3.2999 PNS24246 1044 791.561 53.3724 4.84509 PNS24248 1044 791.561 53.3724 4.84509 PNS24244 1471 1218.56 41.9358 2.4729 PNS24243 293 97.5473 0 0 KQK14069 1603 1350.56 6255.29 332.815 KQK14071 474 240.363 132.835 39.7114 ==> SRR6958309.se.tsv <== BRADI_1g14170v3 7123 BRADI_1g53295v3 226 BRADI_1g59795v3 231 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 264 BRADI_1g74790v3 94 BRADI_1g09890v3 0 BRADI_1g77505v3 216 BRADI_1g48960v3 0 SRR6958309 completed mapping pipeline successfully