Starting /dee2/code/volunteer_pipeline.sh SRR6958310 current disk space = 1549749329920 free memory = 1396352060 SRR6958310 SRAfilesize 71ef295cdc0017e6a2912ac4d811defb SRR6958310.sra SRR6958310.sra file validated SRR6958310 is paired end SRR6958310 is conventional basespace SRR6958310 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958310_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.57625 18.0 18.0 33.0 18.0 33.0 2 24.72025 25.0 18.0 30.0 18.0 33.0 3 26.53325 27.0 25.0 30.0 18.0 31.0 4 28.33575 29.0 27.0 31.0 25.0 33.0 5 30.416 31.0 29.0 33.0 27.0 33.0 6 34.10275 36.0 33.0 37.0 28.0 38.0 7 36.072 37.0 36.0 38.0 33.0 38.0 8 37.0725 38.0 37.0 38.0 35.0 38.0 9 36.936 38.0 38.0 38.0 35.0 38.0 10-14 36.983349999999994 38.0 38.0 38.0 35.2 38.0 15-19 37.40599999999999 38.0 38.0 38.0 36.6 38.0 20-24 37.5064 38.0 38.0 38.0 37.4 38.0 25-29 37.565400000000004 38.0 38.0 38.0 37.8 38.0 30-34 37.58794999999999 38.0 38.0 38.0 37.8 38.0 35-39 37.51975 38.0 38.0 38.0 37.8 38.0 40-44 37.56705 38.0 38.0 38.0 37.8 38.0 45-49 37.36745 38.0 38.0 38.0 37.0 38.0 50-54 37.358050000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.1069 38.0 38.0 38.0 36.0 38.0 60-64 37.23295 38.0 38.0 38.0 36.2 38.0 65-69 37.185950000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.6211 38.0 38.0 38.0 34.2 38.0 75-79 37.078199999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.018299999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.9438 38.0 38.0 38.0 35.2 38.0 90-94 36.827450000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.74495 38.0 38.0 38.0 34.8 38.0 100-104 36.663599999999995 38.0 38.0 38.0 34.6 38.0 105-109 36.50535 38.0 37.8 38.0 34.0 38.0 110-114 36.3517 38.0 37.6 38.0 33.8 38.0 115-119 36.168049999999994 38.0 37.4 38.0 33.4 38.0 120-124 35.99805 38.0 36.6 38.0 32.6 38.0 125-129 35.94715 38.0 36.8 38.0 33.0 38.0 130-134 35.73975 38.0 36.0 38.0 32.2 38.0 135-139 35.3322 38.0 35.8 38.0 30.2 38.0 140-144 35.04795 38.0 35.4 38.0 29.8 38.0 145-149 34.20205 38.0 35.0 38.0 24.6 38.0 150-151 30.302999999999997 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 2.0 20 4.0 21 5.0 22 5.0 23 7.0 24 3.0 25 3.0 26 12.0 27 13.0 28 15.0 29 26.0 30 42.0 31 44.0 32 79.0 33 100.0 34 151.0 35 368.0 36 1081.0 37 2035.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.83333333333333 7.929292929292929 10.202020202020202 36.035353535353536 2 25.525 10.475 37.5 26.5 3 23.28664332166083 15.307653826913455 25.86293146573287 35.542771385692845 4 25.55 22.825 24.925 26.700000000000003 5 28.575 27.525 23.9 20.0 6 23.025000000000002 33.15 23.65 20.175 7 18.775 24.3 39.25 17.675 8 21.05 25.025 30.4 23.525 9 20.225 23.849999999999998 33.125 22.8 10-14 22.884999999999998 27.334999999999997 26.19 23.59 15-19 23.7 25.715 27.11 23.474999999999998 20-24 23.630000000000003 26.16 26.484999999999996 23.724999999999998 25-29 23.435 26.729999999999997 26.56 23.275000000000002 30-34 22.775000000000002 26.255 26.919999999999998 24.05 35-39 24.0 26.229999999999997 26.179999999999996 23.59 40-44 23.525 26.21 26.215 24.05 45-49 23.115 26.665 26.695 23.525 50-54 23.115 26.32 26.665 23.9 55-59 23.31 26.305 26.325 24.060000000000002 60-64 22.875 25.805 27.155 24.165 65-69 22.884999999999998 26.55 26.555 24.01 70-74 23.465 26.0 26.395000000000003 24.14 75-79 23.035 25.900000000000002 27.005000000000003 24.060000000000002 80-84 22.825 26.419999999999998 26.57 24.185000000000002 85-89 22.895 26.945000000000004 26.545 23.615 90-94 23.43 26.005 26.779999999999998 23.785 95-99 23.605 25.755 26.6 24.04 100-104 23.865 26.150000000000002 26.115 23.87 105-109 23.965 25.679999999999996 26.924999999999997 23.43 110-114 24.276213810690532 25.401270063503173 27.006350317515874 23.316165808290414 115-119 24.387438743874387 26.67766776677668 26.452645264526453 22.48224822482248 120-124 23.665 25.735000000000003 26.740000000000002 23.86 125-129 23.567356735673567 26.01260126012601 26.2976297629763 24.122412241224122 130-134 23.826191309565477 25.98629931496575 26.251312565628282 23.936196809840492 135-139 23.41 26.450000000000003 25.919999999999998 24.22 140-144 22.655 26.63 26.179999999999996 24.535 145-149 23.400000000000002 26.015 26.105 24.48 150-151 23.200000000000003 25.837500000000002 25.912499999999998 25.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 4.0 29 6.5 30 11.0 31 15.5 32 19.0 33 23.5 34 35.0 35 39.5 36 54.0 37 77.0 38 95.5 39 126.5 40 147.0 41 172.0 42 201.5 43 208.5 44 221.0 45 225.5 46 228.5 47 224.5 48 191.0 49 171.5 50 174.0 51 169.5 52 138.5 53 119.5 54 110.5 55 100.5 56 92.0 57 72.0 58 61.0 59 63.5 60 65.0 61 56.0 62 42.0 63 43.5 64 36.5 65 26.0 66 28.0 67 23.5 68 18.5 69 14.5 70 12.0 71 10.0 72 8.0 73 6.0 74 3.0 75 1.5 76 2.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.01 120-124 0.0 125-129 0.01 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5789076264787314 1.15 3 0.0 0.0 4 0.0 0.0 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.9625 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.7999999999999998 0.0 0.0 0.0 0.0 128-129 2.1375 0.0 0.0 0.0 0.0 130-131 2.4625 0.0 0.0 0.0 0.0 132-133 2.9124999999999996 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.5 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAAAG 10 0.006830828 145.0 4 GGGGAGC 10 0.006830828 145.0 1 >>END_MODULE SRR6958310 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958310_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.33025 34.0 33.0 34.0 33.0 34.0 2 33.45225 34.0 33.0 34.0 33.0 34.0 3 33.48175 34.0 33.0 34.0 33.0 34.0 4 33.383 34.0 33.0 34.0 33.0 34.0 5 33.5 34.0 33.0 34.0 33.0 34.0 6 37.643 38.0 38.0 38.0 38.0 38.0 7 37.67325 38.0 38.0 38.0 38.0 38.0 8 37.67075 38.0 38.0 38.0 38.0 38.0 9 37.60875 38.0 38.0 38.0 38.0 38.0 10-14 37.120050000000006 38.0 38.0 38.0 35.8 38.0 15-19 37.5055 38.0 38.0 38.0 37.8 38.0 20-24 37.59275 38.0 38.0 38.0 38.0 38.0 25-29 37.62165 38.0 38.0 38.0 38.0 38.0 30-34 37.69355 38.0 38.0 38.0 38.0 38.0 35-39 37.0783 38.0 38.0 38.0 36.4 38.0 40-44 37.6274 38.0 38.0 38.0 38.0 38.0 45-49 37.38065 38.0 38.0 38.0 37.4 38.0 50-54 37.2121 38.0 38.0 38.0 36.6 38.0 55-59 36.8352 38.0 37.8 38.0 34.0 38.0 60-64 37.63435 38.0 38.0 38.0 38.0 38.0 65-69 37.2904 38.0 38.0 38.0 37.0 38.0 70-74 37.47725 38.0 38.0 38.0 37.8 38.0 75-79 37.104400000000005 38.0 38.0 38.0 36.2 38.0 80-84 37.47615 38.0 38.0 38.0 38.0 38.0 85-89 37.450649999999996 38.0 38.0 38.0 38.0 38.0 90-94 37.347750000000005 38.0 38.0 38.0 37.4 38.0 95-99 37.29315 38.0 38.0 38.0 37.2 38.0 100-104 36.5899 38.0 37.8 38.0 34.0 38.0 105-109 36.373999999999995 38.0 37.4 38.0 32.2 38.0 110-114 36.880199999999995 38.0 38.0 38.0 35.2 38.0 115-119 37.0252 38.0 38.0 38.0 36.0 38.0 120-124 36.9139 38.0 38.0 38.0 35.4 38.0 125-129 36.7198 38.0 38.0 38.0 35.0 38.0 130-134 36.5807 38.0 38.0 38.0 34.6 38.0 135-139 36.3248 38.0 38.0 38.0 34.2 38.0 140-144 35.71405 38.0 36.4 38.0 32.4 38.0 145-149 35.413 38.0 37.2 38.0 31.2 38.0 150-151 30.024875 35.5 28.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 3.0 19 6.0 20 3.0 21 3.0 22 2.0 23 2.0 24 2.0 25 5.0 26 3.0 27 10.0 28 7.0 29 14.0 30 21.0 31 34.0 32 29.0 33 53.0 34 86.0 35 193.0 36 572.0 37 2945.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.125 19.35 13.900000000000002 34.625 2 29.049999999999997 23.325000000000003 28.975 18.65 3 22.475 27.1 28.475 21.95 4 24.5 30.425 22.85 22.225 5 27.150000000000002 32.725 20.424999999999997 19.7 6 22.025 36.9 20.7 20.375 7 21.0 21.325 35.825 21.85 8 23.825 23.7 25.275 27.200000000000003 9 23.549999999999997 24.15 27.55 24.75 10-14 24.905 27.155 24.025 23.915 15-19 24.675 26.58 25.759999999999998 22.985 20-24 24.560000000000002 26.605 25.77 23.064999999999998 25-29 24.54 26.615 25.055 23.79 30-34 24.005000000000003 26.845000000000002 25.31 23.84 35-39 24.55 27.0 24.87 23.580000000000002 40-44 24.66 26.695 25.275 23.369999999999997 45-49 24.015 27.02 26.040000000000003 22.925 50-54 24.695 26.784999999999997 25.869999999999997 22.650000000000002 55-59 24.315 26.565 25.540000000000003 23.580000000000002 60-64 24.45 26.825 26.135 22.59 65-69 24.805 26.615 25.779999999999998 22.8 70-74 24.465 25.64 26.26 23.635 75-79 24.044999999999998 26.36 26.355 23.24 80-84 24.13 26.71 25.580000000000002 23.580000000000002 85-89 24.915000000000003 26.974999999999998 25.124999999999996 22.985 90-94 24.490000000000002 27.26 25.71 22.54 95-99 24.36 26.950000000000003 25.655 23.035 100-104 24.6 26.029999999999998 25.915 23.455000000000002 105-109 24.36 26.215 26.290000000000003 23.135 110-114 24.325 26.815 25.990000000000002 22.869999999999997 115-119 24.25 26.950000000000003 25.430000000000003 23.369999999999997 120-124 24.025 27.1 25.285000000000004 23.59 125-129 24.785 26.66 25.61 22.945 130-134 24.575 26.765 25.679999999999996 22.98 135-139 24.485 26.87 25.53 23.115 140-144 24.755 27.255000000000003 25.155 22.835 145-149 24.94 27.065 25.135 22.86 150-151 24.025 27.650000000000002 25.5625 22.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 2.0 26 3.5 27 2.5 28 2.0 29 5.5 30 10.5 31 14.0 32 16.0 33 21.0 34 33.5 35 43.0 36 55.5 37 79.5 38 103.0 39 125.5 40 150.5 41 179.5 42 191.0 43 207.5 44 219.0 45 202.0 46 192.5 47 193.5 48 185.5 49 180.0 50 177.5 51 153.5 52 137.0 53 124.0 54 116.5 55 106.5 56 82.0 57 78.0 58 78.5 59 74.5 60 66.0 61 56.5 62 64.5 63 55.0 64 35.5 65 29.5 66 27.0 67 26.0 68 24.0 69 18.0 70 11.0 71 10.5 72 11.0 73 7.5 74 5.0 75 4.0 76 1.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.6048387096774194 1.2 3 0.10080645161290322 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.0750000000000002 0.0 0.0 0.0 0.0 120-121 1.2625000000000002 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.8250000000000002 0.0 0.0 0.0 0.0 128-129 2.1624999999999996 0.0 0.0 0.0 0.0 130-131 2.4875 0.0 0.0 0.0 0.0 132-133 2.9375 0.0 0.0 0.0 0.0 134-135 3.2249999999999996 0.0 0.0 0.0 0.0 136-137 3.5250000000000004 0.0 0.0 0.0 0.0 138-139 3.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACAC 10 0.006830828 145.0 2 ACAGAAT 10 0.006830828 145.0 7 ACACAGA 10 0.006830828 145.0 5 CAGAATA 10 0.006830828 145.0 8 ATTTTTC 10 0.006830828 145.0 9 AACACAG 10 0.006830828 145.0 4 >>END_MODULE Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645540 spots for SRR6958310.sra Written 645540 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra Read 645539 spots for SRR6958310.sra Written 645539 spots for SRR6958310.sra SRR ids: ['SRR6958310.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_skce4de6 SRR6958310.sra spots: 12910781 blocks: [[1, 645539], [645540, 1291078], [1291079, 1936617], [1936618, 2582156], [2582157, 3227695], [3227696, 3873234], [3873235, 4518773], [4518774, 5164312], [5164313, 5809851], [5809852, 6455390], [6455391, 7100929], [7100930, 7746468], [7746469, 8392007], [8392008, 9037546], [9037547, 9683085], [9683086, 10328624], [10328625, 10974163], [10974164, 11619702], [11619703, 12265241], [12265242, 12910781]] SRR6958310 file size 4353339 SRR6958310 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958310 SRR6958310_1.fastq SRR6958310_2.fastq Input file: SRR6958310_1.fastq Paired file: SRR6958310_2.fastq trimmed: SRR6958310-trimmed-pair1.fastq, SRR6958310-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:25:45 2024 >> started Fri Dec 6 19:26:13 2024 >> done (28.314s) 12910781 read pairs processed; of these: 7364 ( 0.06%) short read pairs filtered out after trimming by size control 5922 ( 0.05%) empty read pairs filtered out after trimming by size control 12897495 (99.90%) read pairs available; of these: 4601017 (35.67%) trimmed read pairs available after processing 8296478 (64.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 2 0.00% 21 1 0.00% 22 4 0.00% 23 4 0.00% 24 1 0.00% 25 3 0.00% 26 9 0.00% 27 2 0.00% 28 2 0.00% 29 4 0.00% 30 2 0.00% 31 2 0.00% 32 2 0.00% 33 4 0.00% 34 1 0.00% 35 0 0.00% 36 5 0.00% 37 4 0.00% 38 8 0.00% 39 6 0.00% 40 6 0.00% 41 9 0.00% 42 4 0.00% 43 7 0.00% 44 5 0.00% 45 6 0.00% 46 6 0.00% 47 12 0.00% 48 10 0.00% 49 15 0.00% 50 13 0.00% 51 16 0.00% 52 17 0.00% 53 16 0.00% 54 16 0.00% 55 22 0.00% 56 26 0.00% 57 23 0.00% 58 39 0.00% 59 34 0.00% 60 35 0.00% 61 49 0.00% 62 62 0.00% 63 65 0.00% 64 61 0.00% 65 64 0.00% 66 98 0.00% 67 101 0.00% 68 91 0.00% 69 115 0.00% 70 143 0.00% 71 156 0.00% 72 200 0.00% 73 204 0.00% 74 217 0.00% 75 263 0.00% 76 263 0.00% 77 348 0.00% 78 393 0.00% 79 449 0.00% 80 480 0.00% 81 554 0.00% 82 710 0.01% 83 730 0.01% 84 1088 0.01% 85 1227 0.01% 86 1349 0.01% 87 1528 0.01% 88 1658 0.01% 89 1750 0.01% 90 1828 0.01% 91 2064 0.02% 92 2222 0.02% 93 2384 0.02% 94 2739 0.02% 95 2901 0.02% 96 3116 0.02% 97 3208 0.02% 98 3425 0.03% 99 3712 0.03% 100 4090 0.03% 101 4266 0.03% 102 4616 0.04% 103 4881 0.04% 104 5310 0.04% 105 5696 0.04% 106 6341 0.05% 107 6633 0.05% 108 6854 0.05% 109 7228 0.06% 110 7676 0.06% 111 8134 0.06% 112 8753 0.07% 113 8996 0.07% 114 9739 0.08% 115 10559 0.08% 116 11225 0.09% 117 11320 0.09% 118 11866 0.09% 119 12715 0.10% 120 13051 0.10% 121 13357 0.10% 122 14273 0.11% 123 15265 0.12% 124 16043 0.12% 125 16642 0.13% 126 17702 0.14% 127 18575 0.14% 128 19154 0.15% 129 20307 0.16% 130 21778 0.17% 131 22663 0.18% 132 23420 0.18% 133 25278 0.20% 134 26718 0.21% 135 28192 0.22% 136 30278 0.23% 137 32543 0.25% 138 34044 0.26% 139 37001 0.29% 140 40417 0.31% 141 44339 0.34% 142 49753 0.39% 143 55340 0.43% 144 63856 0.50% 145 77957 0.60% 146 98583 0.76% 147 135738 1.05% 148 212116 1.64% 149 443555 3.44% 150 2733758 21.20% 151 8296478 64.33% 12897495 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=23 prefix-density=0.76 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=44.28 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=27 prefix-density=0.59 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=30.96 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.8 sequence=CTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR6958310 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:27:13 Started mapping on | Dec 06 19:27:13 Finished on | Dec 06 19:28:29 Mapping speed, Million of reads per hour | 610.93 Number of input reads | 12897495 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12576583 Uniquely mapped reads % | 97.51% Average mapped length | 297.90 Number of splices: Total | 14985644 Number of splices: Annotated (sjdb) | 14136639 Number of splices: GT/AG | 14799160 Number of splices: GC/AG | 170946 Number of splices: AT/AC | 5809 Number of splices: Non-canonical | 9729 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 92476 % of reads mapped to multiple loci | 0.72% Number of reads mapped to too many loci | 14202 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.95% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 231704 231704 231704 N_multimapping 92476 92476 92476 N_noFeature 490027 12230996 592854 N_ambiguous 286719 1435 45050 UnstrandedReadsAssigned:11799837 PositiveStrandReadsAssigned:344152 NegativeStrandReadsAssigned:11938679 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958310 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958310-trimmed-pair1.fastq SRR6958310-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,897,495 reads, 11,961,142 reads pseudoaligned [quant] estimated average fragment length: 245.239 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR6958310.ke.tsv 35125 SRR6958310.se.tsv 88098 total ==> SRR6958310.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 692.33 0 0 PNS24247 1044 799.761 41.0224 6.83958 PNS24249 1928 1683.76 15.5351 1.23028 PNS24246 1044 799.761 41.0224 6.83958 PNS24248 1044 799.761 41.0224 6.83958 PNS24244 1471 1226.76 24.3978 2.65192 PNS24243 293 83.5085 0 0 KQK14069 1603 1358.76 1205.76 118.328 KQK14071 474 235.519 37.5635 21.2671 ==> SRR6958310.se.tsv <== BRADI_1g14170v3 1502 BRADI_1g53295v3 256 BRADI_1g59795v3 193 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 200 BRADI_1g74790v3 79 BRADI_1g09890v3 1 BRADI_1g77505v3 100 BRADI_1g48960v3 0 SRR6958310 completed mapping pipeline successfully