Starting /dee2/code/volunteer_pipeline.sh SRR6958311 current disk space = 1549850734592 free memory = 1475629428 SRR6958311 SRAfilesize fc218721b1584c8ccabe30ca6eba9dc4 SRR6958311.sra SRR6958311.sra file validated SRR6958311 is paired end SRR6958311 is conventional basespace SRR6958311 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958311_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.57175 32.0 25.0 33.0 18.0 34.0 2 30.3375 31.0 29.0 33.0 27.0 33.0 3 31.642 33.0 31.0 33.0 29.0 33.0 4 32.569 33.0 33.0 33.0 31.0 34.0 5 32.93075 33.0 33.0 34.0 33.0 34.0 6 36.86725 38.0 37.0 38.0 35.0 38.0 7 37.28625 38.0 38.0 38.0 36.0 38.0 8 37.51475 38.0 38.0 38.0 37.0 38.0 9 37.56375 38.0 38.0 38.0 38.0 38.0 10-14 37.584450000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.4632 38.0 38.0 38.0 37.6 38.0 20-24 37.505250000000004 38.0 38.0 38.0 37.8 38.0 25-29 37.51865 38.0 38.0 38.0 37.8 38.0 30-34 37.51755000000001 38.0 38.0 38.0 37.6 38.0 35-39 37.2823 38.0 38.0 38.0 36.8 38.0 40-44 37.5276 38.0 38.0 38.0 37.8 38.0 45-49 37.4117 38.0 38.0 38.0 37.4 38.0 50-54 37.4034 38.0 38.0 38.0 37.0 38.0 55-59 37.08885 38.0 38.0 38.0 36.2 38.0 60-64 37.355500000000006 38.0 38.0 38.0 37.0 38.0 65-69 36.8622 38.0 37.6 38.0 35.0 38.0 70-74 37.05585 38.0 37.8 38.0 35.6 38.0 75-79 36.66785 38.0 37.8 38.0 34.0 38.0 80-84 37.06545 38.0 38.0 38.0 36.0 38.0 85-89 37.08645 38.0 38.0 38.0 36.0 38.0 90-94 36.97965 38.0 38.0 38.0 35.4 38.0 95-99 36.877199999999995 38.0 38.0 38.0 35.4 38.0 100-104 36.73795 38.0 38.0 38.0 34.8 38.0 105-109 36.55335 38.0 38.0 38.0 34.2 38.0 110-114 36.47545 38.0 38.0 38.0 34.0 38.0 115-119 36.270050000000005 38.0 37.6 38.0 33.8 38.0 120-124 35.964600000000004 38.0 37.0 38.0 32.8 38.0 125-129 36.0726 38.0 37.2 38.0 33.4 38.0 130-134 35.6716 38.0 36.2 38.0 31.8 38.0 135-139 34.4076 38.0 34.0 38.0 25.2 38.0 140-144 30.8635 34.4 25.0 38.0 19.6 38.0 145-149 33.746050000000004 38.0 33.0 38.0 24.2 38.0 150-151 29.364375000000003 35.0 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 0.0 18 2.0 19 4.0 20 2.0 21 0.0 22 5.0 23 6.0 24 8.0 25 11.0 26 10.0 27 9.0 28 25.0 29 27.0 30 31.0 31 58.0 32 71.0 33 106.0 34 191.0 35 329.0 36 1051.0 37 2052.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.27691497762569 9.739405106607002 6.791260858120558 31.19241905764675 2 26.150000000000002 12.75 33.074999999999996 28.025 3 21.925 17.974999999999998 26.275 33.825 4 26.200000000000003 25.45 22.475 25.874999999999996 5 25.124999999999996 29.825000000000003 24.15 20.9 6 21.375 33.7 23.849999999999998 21.075 7 17.275 23.974999999999998 41.925000000000004 16.825000000000003 8 19.325 23.775 30.45 26.450000000000003 9 19.825 22.025 33.0 25.15 10-14 22.795 27.689999999999998 26.484999999999996 23.03 15-19 22.775000000000002 26.240000000000002 26.83 24.154999999999998 20-24 22.93 26.83 26.665 23.575 25-29 22.905 26.86 26.474999999999998 23.76 30-34 22.98 26.39 26.525 24.104999999999997 35-39 22.770000000000003 26.064999999999998 27.134999999999998 24.03 40-44 22.935 26.76 26.105 24.2 45-49 23.135 26.174999999999997 26.6 24.09 50-54 22.555 26.615 26.515 24.315 55-59 22.865 26.88 26.290000000000003 23.965 60-64 22.505 26.25 27.229999999999997 24.015 65-69 22.795 26.305 26.534999999999997 24.365000000000002 70-74 23.16 26.365 26.1 24.375 75-79 22.919999999999998 26.305 26.275 24.5 80-84 22.915 26.424999999999997 26.565 24.095 85-89 22.54 26.924999999999997 26.0 24.535 90-94 22.15 26.185000000000002 26.625 25.040000000000003 95-99 22.78 26.450000000000003 26.200000000000003 24.57 100-104 22.81 26.35 26.865 23.974999999999998 105-109 23.25 25.695 26.384999999999998 24.67 110-114 23.155 26.090000000000003 26.865 23.89 115-119 23.23848577286593 26.869030354553182 26.498974846226936 23.393509026353954 120-124 22.770000000000003 26.215 26.334999999999997 24.68 125-129 23.332333233323332 25.937593759375936 26.27762776277628 24.45244524452445 130-134 23.28 26.245 25.885 24.59 135-139 22.405 26.35 25.525 25.72 140-144 22.2 26.334999999999997 26.155 25.31 145-149 23.11 26.82 25.264999999999997 24.805 150-151 23.6375 26.2125 25.3125 24.837500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 2.5 28 7.0 29 9.0 30 11.0 31 15.0 32 19.5 33 28.0 34 36.0 35 54.5 36 65.5 37 69.5 38 89.5 39 115.0 40 147.5 41 175.0 42 202.0 43 228.5 44 238.0 45 233.0 46 223.0 47 225.0 48 210.5 49 175.5 50 164.5 51 152.0 52 131.0 53 114.5 54 96.5 55 88.5 56 81.0 57 66.0 58 56.0 59 59.5 60 59.0 61 51.0 62 43.5 63 36.5 64 38.0 65 38.0 66 33.5 67 27.5 68 20.0 69 15.5 70 12.5 71 11.0 72 6.5 73 4.5 74 4.0 75 2.5 76 2.0 77 1.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.0999999999999996 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.6625 0.0 0.0 0.0 0.0 120-121 3.0875000000000004 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.85 0.0 0.0 0.0 0.0 126-127 4.237500000000001 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 4.95 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTACA 10 0.006836113 144.9625 6 >>END_MODULE SRR6958311 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958311_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.122 33.0 33.0 34.0 33.0 34.0 2 33.29125 34.0 33.0 34.0 33.0 34.0 3 33.31225 34.0 33.0 34.0 33.0 34.0 4 33.20575 34.0 33.0 34.0 33.0 34.0 5 33.27425 34.0 33.0 34.0 33.0 34.0 6 37.41225 38.0 38.0 38.0 38.0 38.0 7 37.5305 38.0 38.0 38.0 38.0 38.0 8 37.4525 38.0 38.0 38.0 38.0 38.0 9 37.4585 38.0 38.0 38.0 38.0 38.0 10-14 37.3399 38.0 38.0 38.0 37.8 38.0 15-19 37.0292 38.0 38.0 38.0 36.2 38.0 20-24 37.32835 38.0 38.0 38.0 37.6 38.0 25-29 37.4084 38.0 38.0 38.0 38.0 38.0 30-34 37.437749999999994 38.0 38.0 38.0 38.0 38.0 35-39 36.6737 38.0 37.8 38.0 33.8 38.0 40-44 37.41525 38.0 38.0 38.0 38.0 38.0 45-49 37.398399999999995 38.0 38.0 38.0 37.8 38.0 50-54 37.3535 38.0 38.0 38.0 37.8 38.0 55-59 37.3284 38.0 38.0 38.0 37.6 38.0 60-64 37.22245 38.0 38.0 38.0 37.2 38.0 65-69 37.14395 38.0 38.0 38.0 37.0 38.0 70-74 37.108450000000005 38.0 38.0 38.0 36.8 38.0 75-79 37.173950000000005 38.0 38.0 38.0 37.0 38.0 80-84 35.9514 38.0 35.6 38.0 32.4 38.0 85-89 36.446349999999995 38.0 37.2 38.0 33.8 38.0 90-94 35.4351 38.0 35.8 38.0 29.6 38.0 95-99 34.38405 37.8 33.4 38.0 26.0 38.0 100-104 34.58675 37.8 33.6 38.0 27.4 38.0 105-109 36.41155 38.0 37.8 38.0 34.0 38.0 110-114 36.49425 38.0 38.0 38.0 34.0 38.0 115-119 36.21905 38.0 38.0 38.0 33.0 38.0 120-124 36.145900000000005 38.0 38.0 38.0 33.0 38.0 125-129 35.47705 38.0 37.0 38.0 30.0 38.0 130-134 35.5707 38.0 37.6 38.0 31.4 38.0 135-139 34.836650000000006 38.0 36.0 38.0 28.2 38.0 140-144 31.731100000000005 36.2 29.8 38.0 18.8 38.0 145-149 28.8339 35.0 24.8 38.0 2.0 38.0 150-151 21.549374999999998 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 2.0 6 0.0 7 2.0 8 0.0 9 0.0 10 2.0 11 2.0 12 1.0 13 2.0 14 1.0 15 4.0 16 0.0 17 3.0 18 2.0 19 4.0 20 5.0 21 3.0 22 7.0 23 9.0 24 9.0 25 18.0 26 25.0 27 9.0 28 24.0 29 32.0 30 53.0 31 58.0 32 95.0 33 126.0 34 231.0 35 421.0 36 1216.0 37 1631.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.3 21.425 9.125 25.15 2 31.0 23.200000000000003 27.450000000000003 18.35 3 21.85 26.325 29.45 22.375 4 25.174999999999997 32.45 20.974999999999998 21.4 5 26.200000000000003 35.175 19.55 19.075 6 21.85 38.375 19.525000000000002 20.25 7 21.925 19.6 36.725 21.75 8 23.175 24.4 25.6 26.825 9 23.5 23.05 28.025 25.424999999999997 10-14 24.975 27.500000000000004 24.285 23.24 15-19 25.105 26.68 25.1 23.115 20-24 24.755 27.055 25.155 23.035 25-29 24.345 26.284999999999997 25.585 23.785 30-34 24.455 26.83 25.355 23.36 35-39 24.64 26.83 25.380000000000003 23.150000000000002 40-44 24.87 26.900000000000002 24.775 23.455000000000002 45-49 24.395 26.82 25.355 23.43 50-54 25.672836418209105 25.5927963981991 25.867933966983493 22.866433216608304 55-59 24.907490749074906 26.662666266626662 25.40754075407541 23.022302230223023 60-64 25.020008003201283 25.94037615046018 25.585234093637453 23.45438175270108 65-69 25.188778316747513 25.968895334300147 25.93389008351253 22.908436265439818 70-74 25.06627982592167 26.056725526486918 25.89165124305938 22.98534340453204 75-79 24.456005202341053 26.171777299784903 26.501925866639986 22.870291631234053 80-84 24.85988791032826 26.931545236188953 25.49039231385108 22.718174539631704 85-89 24.732312618833184 26.64865405784049 25.687981587110976 22.931051736215352 90-94 24.874974994999 26.4252850570114 26.530306061212244 22.169433886777355 95-99 24.37 27.465 25.21 22.955000000000002 100-104 25.36126806340317 26.671333566678335 25.246262313115658 22.72113605680284 105-109 24.988746061121393 26.77437102986045 25.658980643225128 22.57790226579303 110-114 24.935 26.240000000000002 26.145000000000003 22.68 115-119 25.522552255225524 27.13271327132713 25.192519251925194 22.152215221522155 120-124 24.90624531226561 26.631331566578332 25.641282064103205 22.821141057052852 125-129 24.70494098819764 27.150430086017202 25.785157031406282 22.359471894378878 130-134 26.05 26.875 25.330000000000002 21.745 135-139 25.34387035462412 26.62932026209173 25.508928124843695 22.517881258440454 140-144 25.91259125912591 27.10771077107711 25.52755275527553 21.45214521452145 145-149 26.367636763676366 26.262626262626267 25.597559755975595 21.772177217721772 150-151 26.703337917239654 26.428303537942245 25.29066133266658 21.57769721215152 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 1.5 26 1.0 27 2.5 28 3.5 29 5.0 30 11.0 31 15.5 32 17.5 33 18.0 34 27.0 35 40.0 36 56.5 37 73.0 38 95.5 39 125.5 40 143.0 41 166.5 42 187.5 43 207.0 44 214.0 45 212.5 46 221.0 47 204.5 48 189.5 49 191.0 50 178.5 51 166.5 52 143.0 53 104.0 54 93.5 55 90.5 56 84.5 57 85.5 58 77.5 59 63.5 60 55.5 61 62.0 62 58.5 63 47.5 64 45.5 65 38.5 66 30.0 67 28.0 68 27.5 69 28.0 70 20.5 71 10.0 72 5.5 73 5.5 74 8.0 75 5.0 76 1.5 77 0.5 78 1.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.05 55-59 0.01 60-64 0.04 65-69 0.015 70-74 0.045 75-79 0.045 80-84 0.08 85-89 0.06999999999999999 90-94 0.02 95-99 0.0 100-104 0.005 105-109 0.034999999999999996 110-114 0.0 115-119 0.01 120-124 0.005 125-129 0.02 130-134 0.0 135-139 0.034999999999999996 140-144 0.01 145-149 0.01 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24261550113607 98.275 2 0.6059075990911386 1.2 3 0.12623074981065388 0.375 4 0.0 0.0 5 0.0 0.0 6 0.025246149962130777 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.7 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.9 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.725 0.0 0.0 0.0 0.0 126-127 4.112500000000001 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.862500000000001 0.0 0.0 0.0 0.0 132-133 5.2125 0.0 0.0 0.0 0.0 134-135 5.6 0.0 0.0 0.0 0.0 136-137 6.1375 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922800 spots for SRR6958311.sra Written 922800 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra Read 922789 spots for SRR6958311.sra Written 922789 spots for SRR6958311.sra SRR ids: ['SRR6958311.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6q8510sn SRR6958311.sra spots: 18455791 blocks: [[1, 922789], [922790, 1845578], [1845579, 2768367], [2768368, 3691156], [3691157, 4613945], [4613946, 5536734], [5536735, 6459523], [6459524, 7382312], [7382313, 8305101], [8305102, 9227890], [9227891, 10150679], [10150680, 11073468], [11073469, 11996257], [11996258, 12919046], [12919047, 13841835], [13841836, 14764624], [14764625, 15687413], [15687414, 16610202], [16610203, 17532991], [17532992, 18455791]] SRR6958311 file size 6232361 SRR6958311 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958311 SRR6958311_1.fastq SRR6958311_2.fastq Input file: SRR6958311_1.fastq Paired file: SRR6958311_2.fastq trimmed: SRR6958311-trimmed-pair1.fastq, SRR6958311-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 19:32:54 2024 >> started Fri Dec 6 19:36:09 2024 >> done (194.375s) 18455791 read pairs processed; of these: 11248 ( 0.06%) short read pairs filtered out after trimming by size control 12221 ( 0.07%) empty read pairs filtered out after trimming by size control 18432322 (99.87%) read pairs available; of these: 7424441 (40.28%) trimmed read pairs available after processing 11007881 (59.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 11 0.00% 20 9 0.00% 21 9 0.00% 22 11 0.00% 23 18 0.00% 24 9 0.00% 25 9 0.00% 26 10 0.00% 27 7 0.00% 28 11 0.00% 29 10 0.00% 30 11 0.00% 31 8 0.00% 32 13 0.00% 33 10 0.00% 34 14 0.00% 35 11 0.00% 36 10 0.00% 37 19 0.00% 38 27 0.00% 39 15 0.00% 40 22 0.00% 41 34 0.00% 42 19 0.00% 43 35 0.00% 44 22 0.00% 45 22 0.00% 46 30 0.00% 47 39 0.00% 48 45 0.00% 49 49 0.00% 50 58 0.00% 51 74 0.00% 52 70 0.00% 53 88 0.00% 54 107 0.00% 55 92 0.00% 56 115 0.00% 57 139 0.00% 58 142 0.00% 59 145 0.00% 60 185 0.00% 61 235 0.00% 62 229 0.00% 63 249 0.00% 64 271 0.00% 65 311 0.00% 66 335 0.00% 67 378 0.00% 68 410 0.00% 69 458 0.00% 70 566 0.00% 71 634 0.00% 72 738 0.00% 73 846 0.00% 74 926 0.01% 75 1033 0.01% 76 1211 0.01% 77 1421 0.01% 78 1470 0.01% 79 1658 0.01% 80 1837 0.01% 81 2012 0.01% 82 2332 0.01% 83 2665 0.01% 84 3590 0.02% 85 3790 0.02% 86 4073 0.02% 87 4382 0.02% 88 4829 0.03% 89 5168 0.03% 90 5533 0.03% 91 5996 0.03% 92 6652 0.04% 93 7339 0.04% 94 8017 0.04% 95 8864 0.05% 96 9211 0.05% 97 10124 0.05% 98 10764 0.06% 99 12424 0.07% 100 15787 0.09% 101 18197 0.10% 102 13557 0.07% 103 14509 0.08% 104 15628 0.08% 105 16159 0.09% 106 17604 0.10% 107 18164 0.10% 108 18668 0.10% 109 19807 0.11% 110 20985 0.11% 111 21963 0.12% 112 23468 0.13% 113 24439 0.13% 114 26111 0.14% 115 27426 0.15% 116 28510 0.15% 117 29147 0.16% 118 30023 0.16% 119 31013 0.17% 120 32617 0.18% 121 33638 0.18% 122 35055 0.19% 123 36981 0.20% 124 38935 0.21% 125 40332 0.22% 126 41604 0.23% 127 43069 0.23% 128 44185 0.24% 129 45958 0.25% 130 47407 0.26% 131 48869 0.27% 132 51235 0.28% 133 53724 0.29% 134 55500 0.30% 135 58764 0.32% 136 61007 0.33% 137 62935 0.34% 138 66107 0.36% 139 70338 0.38% 140 73856 0.40% 141 79447 0.43% 142 86101 0.47% 143 94616 0.51% 144 107397 0.58% 145 126292 0.69% 146 152869 0.83% 147 204833 1.11% 148 305456 1.66% 149 623257 3.38% 150 4036122 21.90% 151 11007881 59.72% 18432322 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=30 prefix-density=0.59 prefix-fanout=2.4 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=62.35 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=24 prefix-density=0.40 prefix-fanout=2.9 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=110.86 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=8.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCC SRR6958311 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 19:41:39 Started mapping on | Dec 06 19:41:39 Finished on | Dec 06 19:59:09 Mapping speed, Million of reads per hour | 63.20 Number of input reads | 18432322 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18102289 Uniquely mapped reads % | 98.21% Average mapped length | 295.57 Number of splices: Total | 20694644 Number of splices: Annotated (sjdb) | 19458156 Number of splices: GT/AG | 20425155 Number of splices: GC/AG | 242670 Number of splices: AT/AC | 9015 Number of splices: Non-canonical | 17804 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 150976 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 9609 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 186738 186738 186738 N_multimapping 150976 150976 150976 N_noFeature 734581 17610944 878984 N_ambiguous 410212 2421 63840 UnstrandedReadsAssigned:16957496 PositiveStrandReadsAssigned:488924 NegativeStrandReadsAssigned:17159465 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958311 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958311-trimmed-pair1.fastq SRR6958311-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,432,322 reads, 17,202,113 reads pseudoaligned [quant] estimated average fragment length: 243.739 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR6958311.ke.tsv 35125 SRR6958311.se.tsv 88098 total ==> SRR6958311.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 693.737 0 0 PNS24247 1044 801.261 55.2173 6.03253 PNS24249 1928 1685.26 32.0191 1.66319 PNS24246 1044 801.261 55.2173 6.03253 PNS24248 1044 801.261 55.2173 6.03253 PNS24244 1471 1228.26 44.329 3.15934 PNS24243 293 92.2888 0 0 KQK14069 1603 1360.26 1968.11 126.656 KQK14071 474 239.752 37.335 13.6318 ==> SRR6958311.se.tsv <== BRADI_1g14170v3 2241 BRADI_1g53295v3 200 BRADI_1g59795v3 460 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 325 BRADI_1g74790v3 68 BRADI_1g09890v3 0 BRADI_1g77505v3 307 BRADI_1g48960v3 0 SRR6958311 completed mapping pipeline successfully